Katharine ME

Пікірлер

@wakeup9199 9 күн бұрын

Well done, bt still i have doubt!!! So if uploated vcf file in yfull and after that i upload da bam wht is da advantages??

@franzbuchel7295 12 күн бұрын

Excellent information! Could You explain Epigenetics in an other video and tell what test You would consider for that?

@sapandeepsandhu4410 26 күн бұрын

SAM File Structure: Header Section: Optional, starts with '@', contains metadata about the sequence and the alignments. Alignment Section: Contains alignment information with each line representing a read. Columns in SAM: QNAME: Query template name. FLAG: Bitwise flag. RNAME: Reference sequence name. POS: 1-based leftmost mapping position. MAPQ: Mapping quality. CIGAR: CIGAR string. RNEXT: Reference name of the mate/next read. PNEXT: Position of the mate/next read. TLEN: Observed template length. SEQ: Segment sequence. QUAL: ASCII of Phred-scaled base quality+33.

@sapandeepsandhu4410 26 күн бұрын

@SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAACTGAGGGTGATGCAG + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

@sapandeepsandhu4410 26 күн бұрын

.FASTQ (Raw Sequence Data) FASTQ is a text-based format for storing both nucleotide sequences and their corresponding quality scores. It is widely used in high-throughput sequencing. File Structure: Header Line: Starts with '@' followed by a sequence identifier. Sequence Line: Contains the nucleotide sequence. Plus Line: Starts with a '+' and may be followed by the same sequence identifier. Quality Line: Contains quality scores for each nucleotide in the sequence, encoded as ASCII characters

@phobe645 Ай бұрын

Hi Katherine, At this time is it possible to use whole geneome sequencing & whole ecome sequencing in combination at present (5-24)?Your presentation was wonderful on many levels~~thank you!!

@KatharineME Ай бұрын

Hi JC, yes it is possible. The whole exome has sequence data on the coding regions only (2% of genome) while whole genome obviously has sequence data on the whole genome. So the exome data is kind of a subset of the genome data. But you could use them together to increase confidence of variant calls in coding regions. Does that make sense?

@JS-de8yi Ай бұрын

Thanks so much for a great answer😅 Katherine

@P.viridis Ай бұрын

Thank you 7 years later!

@joshdanao4987 Ай бұрын

May I ask who or what company you would recommend to go to for if I want to get a whole genome sequencing test (specifically for ancestry?)?

@KatharineME Ай бұрын

To be honest, for ancestry I think using the paper trail is much more accurate. There are services that will help you do that I believe, but I do not have experience with anyone in particular.

@joshdanao4987 Ай бұрын

@@KatharineME yeah fair enough, I mean I am doing my own research now, only problem is being away from the country of origin of my ancestors and having enough resources (money). Also, do you see any of the current genotyping companies (ancestry, 23andme, etc.) switching to whole genome sequencing in the near or distant future? Coz regarding database numbers, the former have a huge advantage.

@doctorkash0792 Ай бұрын

Amazing explanation, really cleared up many things just by watching, thanks a ton and keep up the good work:)

@cikakalyanamitta2690 Ай бұрын

VERY HELPFULLY, THANK U SO MUCH

@deepap1307 Ай бұрын

Thank you for the clear explanations of basics.

@NM-tx7zm 2 ай бұрын

This was excellently done and easy to follow! Thank you!

@Andre-ym6ep 2 ай бұрын

Damn you cute😊

@user-wb5nz4bw1p 2 ай бұрын

FASTQ data need trimming.

@randmaatouk7765 3 ай бұрын

منك لله يا علوم

@zainabumarabdullahi9446 3 ай бұрын

No one can ever explain this better, love from Australia!

@chyokomizo 3 ай бұрын

thank you , great video, excellent explanation.

@Jupiter_Crash 3 ай бұрын

Katherine, can a consumer of Guardiome whole genome sequencing be able to detect loss of function to Neiman-Pick C1-Like 1 and/or ATP Binding Cassettes G5/G8? Or would I need to submit this to a Genetic Counselor for deciphering? There is no “sample report” on the website so I don’t how specific results get. Does Guardiome offer private genetic counseling to understand the results? Thank you for your time and expertise.

@KatharineME 3 ай бұрын

Hi Jupiter, Guardiome just updated its website and i think it's more clear now what is offered. Guardiome is unique because they will actually look for variants (however rare) that might be causing loss of function for example. So yes they would probably be able to do that.

@Jupiter_Crash 3 ай бұрын

@@KatharineME - thx u!

@Jupiter_Crash Ай бұрын

Katherine, I ordered your 30x test today! I shared your link with my cousin as well. Hopefully she’ll order too! Can’t wait for the app later this year. Your updated site offers very clear information. Thxs for sharing your expertise to the world!

@Jupiter_Crash Ай бұрын

Was 30x the correct test to order for “loss of function?”

@KatharineME Ай бұрын

@@Jupiter_Crash 👋 Yep 30X is deep enough for most variant calling.

@user-je6iz1wt1j 4 ай бұрын

Brilliant wAY 5:50 that you have explained DNA HOW WILL I KNOW IF I WILL GET TOLD ALL OF THE INFORMATION FROM MY DNA THAT YOU FIND ???

@KatharineME 4 ай бұрын

Hi Jessica, Illumina library preparation and whole genome sequencing does a pretty good job of reading all your DNA. For example in 30X whole genome sequencing, each letter of your DNA will be read an average of 30 times.

@Whiteiris999 4 ай бұрын

Now Dante Labs or Genomics are just scamers. NO REFUND POLICY, NO CUSTOMER PHONE NUMBER, NO REPLY TO EMAIL, samples there for 1 year and half, bacteria infested the lab in summer 2023 , had to send other blood test but never rich me , neither their emails. Just ignoring me and so many other clie ts, just check their lab for reviews and convince yourself. Stay away of this company !

@aleksandraperz5037 4 ай бұрын

Katharine, thank you so much for this video <3 It was well-explained with clear visuals and easy to follow for me. I'd definitely watch more!

@user-io8ix4zp1u 4 ай бұрын

thanks brilliant- very helpful!

@humarafique3093 5 ай бұрын

Superb👏

@DecodingAgriculture_MD 5 ай бұрын

But mam, You say 20cM but from where ? Means for eg. you say Marker M1 is locate 20cM have 60% chance to linked QTL but your measure distance 20cM is from which point ? Is it the whole interval of 2 flanking markers? Please clear my doubt

@dbottrel 5 ай бұрын

What about “methylation genetic test”? Is this a 4th option or is it included in one of the three tests you mentioned? Thank you for your video. :)

@TheTobacko1 5 ай бұрын

My favorite company in this field is definitly INVITAE ❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤

@DGarcia007 5 ай бұрын

Once I get my gene test results, who can help me with them? For example, a gene consultant or Dr. Any resources?

@martinwhitney9343 5 ай бұрын

brilliant video, thank you

@franciscoromogaray3076 5 ай бұрын

Really clear, thanks!

@LappingMaster 6 ай бұрын

GREAT VIDEO!!!!!!!!!

@AlexHop1 6 ай бұрын

Thank you, very informative.

@zulucharlie5244 7 ай бұрын

Great explanation.

@deltamouse09 9 ай бұрын

Is it easy to describe how to arrive at the 90% correlation for blue SNPs?

@miguelarellano5260 9 ай бұрын

Thank you so much Katharine! you saved a biotech eng. student from Mexico! 🇲🇽

@user-xx7or5qg8u 9 ай бұрын

Do all the whole genome sequencing companies charge a monthly fee to access one's DNA results?

@KatharineME 9 ай бұрын

Many do. Or for example they will charge a subscription for access to their analysis suites. Guardiome is the only company I know of that does everything up front, gives you all your data, and doesn't keep your data.

@diegogutierrez3384 9 ай бұрын

nice explanation, thanks

@mattbrady130 9 ай бұрын

Thank you so much for making this video. I am doing a project in my masters program and this was a huge help!

@MolleenL 10 ай бұрын

Good morning! Quick question. My boyfriend wants to do DNA to our 1 year old son . However the place he recommended says they gonna take him blood and from my son they gonna take cheek swap ! How accurate is this combo ? I’m not scared of the outcome of the results because I know his the father I’m just panicking wondering what could go wrong at Lab.

@sebastianrodriguez1021 11 ай бұрын

It's an awesome video, Katharine. :) Txs By the way, can you make something similar but focused in microbial sequencing? Greetings from Ecuador.

@KatharineME 11 ай бұрын

Thanks Sebastian, I'll keep microbial sequencing on my radar 👍.

@organicjuice 11 ай бұрын

I encountered this question in a molecular exam and I could not find a clear answer online. Maybe you can help me with it. What percentage of cancer is caused by an Exon mutation?

@KatharineME 11 ай бұрын

I think the reason you could not find a clear answer is because it's difficult definitively say that X mutation in Y exon caused Z cancer, especially if the mutation is somatic. The development and progression of cancer is complex. We do know however that roughly 5-10% of cancer are caused by an inherited germline mutation (but these metric doesn't represent exonic mutations only)

@organicjuice 11 ай бұрын

@@KatharineMEThanks for taking the time to answer my question 😊

@eduardofernandezdelpeloso8663 11 ай бұрын

Nice video! do you know any software tool I can use to compare the results of full genome sequencing from two different companies? I have bought tests from Dante and Nebula, and once I get the results I would like to be able to compare them and do some statistical analysis of the differences.

@TheGnomatic Жыл бұрын

What is the best way to determine the allele frequency (Hardy-Weinberg Equilibrium) of an individual from a WHG VCF file?

@DrAF-hz5mp Жыл бұрын

Great! Let's talk when can!

@heathercutburth2363 Жыл бұрын

Can any of these tell if you have a auto immune disease

@KatharineME 11 ай бұрын

Yes, some autoimmune diseases. The idea is, once you have your genome sequence, you can take advantage of all genomic links to autoimmune disease as they are discovered by the community. When a paper comes out that links gene X to autoimmune disease Y. You can check your gene X sequence to find out if you may have disease Y.