A Response to Steven Pinker on AI

[@Karpata1]

12:02 I laughed way too much when you actually tried the command again with 'sudo' haha. Well played.

[@benrex7775]

same

[@jacobdoran9433]

Me too karpata, me too

[@YourMJK]

Yeah, that hit home close.

[@mjbates]

I can't believe 'sudo' didn't work!

[@honigwachsreuben]

@@user-xn4qp6gq2s you don't understand, the AI should've interpreted the `sudo` in the humans favour. "Ah, despite her mistake, she means *fo real* now." 😉

[@theophrastusbombastus8019]

3:47 "I'm not trying to construct a strawman here but I may by accident". I bet this sentence is just a modified version of a warning sign posted outside your lab: "I'm not trying to construct a malicious superintelligent AI but I may by accident".

[@dionbridger5944]

That was pretty sharp.

[@benjaminhalbeisen9175]

It’s been a long time since I’ve seen, heard or read such a well thought-through argument. Also, the fact that you waited for Pinker to correct himself, compromizing outreach for human decency speaks for itself. I’ve always loved what you do on this channel - now I also love how you do it!

[@NineSun001]

It's mainly due to the fact that he is actually a real scientist that wants to share knowledge instead of just broadcasting himself. Just a real honest and intelligent person.

[@blahblahblahblah2837]

The clean, clear logic in this one is like a drink of fresh, cool water on the hungover morning after the months of conspiracy theory-filled COVID isolation

[@codent]

I agree so much....Rob is such a treasure. I have to say also about the added bonus of a little humor...abot the 8 min mark mentioning that to a caveman person, building cars would be unknown (and he shows a Flintstones car), and also walking on the moon (and then he shows the astronaut falling on the moon). Haha, bravo.

[@seriouscat2231]

An AI is a lot of numbers and calculations. How do numbers and math "understand" that they "exist" or "seek" to "preserve" their "existence"?

[@NullHand]

​ A homo sapiens is a lot of water, fats, salts, and biopolymers. How do chemicals "understand" that they "exist" or "seek" to "preserve" their "existence "?

[@FaridAbbasbayli]

Dat "the google" search tho.

[@manfredpseudowengorz]

"We can be inteligent in one way, and dumb in another" case study

[@NakushitaNamida]

@@manfredpseudowengorz That's why he talked about sarcasm in the beginning of the video. Googling google is so frustrating

[@skylark.kraken]

@@NakushitaNamida I've had my grandpa google "google" and then ask me which link is google

[@zerge69]

Skye Murphy don’t mock your elders. You will be like your grandpa one day

[@jameslima7404]

yo dawg, i heard you like googling. So we put some the google in your google so you can google while you google!

[@duckpotat9818]

People can be smart in one way and not so smart in other ways.Pinker himself is an example of this, good at psychology bad at A.I. safety.

[@XxThunderflamexX]

I think you just explained why politics has gotten so bad

[@revimfadli4666]

@@XxThunderflamexX unfortunately, it's even worse if the only thing they're good at is gaining/keeping power or making public impressions...

[@derekhenriquez5740]

I agree, an example of the advantages and limitations of expertise.

[@davidnoll9581]

Honestly, he's not great at psychology. It's just that the side of the field that is critical of his ideas is not pushed as hard into the pop-sci consciousness.

[@seanmatthewking]

@@davidnoll9581 Unless, you're great at psychology, how would you know?

[@sirzorg5728]

"I hate this damn machine I wish that they would sell it. It won't do I want, only what I tell it" - The Programmer's Lament (I couldn't find the origin)

[@chrisofnottingham]

I didn't read the article but I did hear him interviewed a couple of times, and despite generally being a big Pinker fan, I was slightly reminded of the aged senators talking to Zuckerberg about the internet. I'm not in the AI field but I've done enough programming to know that things always go wrong and the bigger and more opaque the programming, the harder it is to test.

[@sciencecompliance235]

chris4072511 Exactly. The more moving parts a program has, the more ways in which it can go wrong.

[@cpedersenatgmailcom]

As usual, when I go to make a comment, someone beat me to it 🙂

[@chrisofnottingham]

@@cpedersenatgmailcom :-)

[@seriouscat2231]

What you are talking about here is a bunch of numbers that "understand" that they exist.

[@moestietabarnak]

Human are EXTREMELY BAD at creating safe things, EVERY safety feature we develop is AFTER it failed at least once already. whatever you would say was safely designed...it's as a reaction to an original failure. Luckily,while many of those fault were terminal to the designer/researcher, none were terminal for humanity...

[@generic8891]

Yeah, when I read the article, the bit where he talks about safe technologies I'm just sitting there like,,, what?? The only time humans, and especially engineers, prioritize safety enough to do it properly is when it becomes a problem, not as a default. You "build bridges" rather than "build safe bridges" because we've built a whole host of really shit bridges that got people killed/injured/annoyed or just the bridge itself destroyed/damaged. Hell, worker rights movements *exist* because industrial conditions and all the new technology of the industrial revolution was dangerous to the operators.

[@fdagpigj]

No, not EVERY safety feature is developed after it already failed, even if a lot of them are. There just is rarely any attention drawn to precautional safety features, and of course so long as the economy is structured towards something that is badly misaligned with human need, they are not economically incentivized. For example in the space race, soviet space craft engineers did take pilot safety into account to a greater extent than american ones that allowed Apollo 1 to happen. Taking precautions costs time and money, so having to choose between money and human safety is a big part of what causes unnecessary accidents.

[@moestietabarnak]

@@fdagpigj nope, that's becoming philosophical now. Let be precise first, I don't say every safety measure failed once (not counting labs experiment like testing for the right material), I say something broke or were dangerous and was costly in life or money THEN we develop safety measure to prevent it.

[@fdagpigj]

I didn't say you said that, I just phrased it the same way as you did because I couldn't be bothered to think of a better way to phrase it.

[@hexzyle]

@@fdagpigj You are indeed, correct. Take for example, Elevator safety.

[@danielrhouck]

1:22 “Disease is down” Well, with some bumps along the way.

[@NineSun001]

COVID is nothing against measles, all plagues, spanish flu, ebola, etc...

[@danielrhouck]

@@NineSun001 Thatʼs what I meant: “some bumps” is not the same as “no it actually isnʼt”. Disease is up this year. It is down from 100 years ago. Or even 99 years ago, to avoid inflating the old data with the minor fourth wave of spanish flu.

[@Horny_Fruit_Flies]

@@NineSun001 Why is ebola in there? Ebola to COVID is what COVID is to the Spanish flu.

[@codent]

Hello from late Nov 2020! Yes, that line stuck out....but you described it well, as a bump, because the covid chapter in history will be more about epidemiology, economics, Public Health and Hospital capacity than about illness and death. Smoking and obesity are still monsters by comparison.

[@ashleycrow8867]

@@NineSun001 Disease is higher in 2020 than it was in 2019, that's a bump in the graph.

[@jqerty]

Alright, what do I have to do to get access to the sarcastic version of this video?

[@engiecat705]

try sudo

[@tonyduncan9852]

Spell access correctly?

[@numnut1516]

Tony Duncan he asked for sarcasm and you gave it to him.

[@EmilySucksAtGaming]

Sudo git sarcastic.exe It didn't work

[@JoshuaHillerup]

When Steven Pinker talks about a subject that he didn't do his PhD in, and then I talk to someone who is an expert in that area, they have always pointed out very serious flaws in what Pinker said and how it makes them angry.

[@celorfiwyn8193]

What he does have PhD in is directly related to how the brain works, and often used a comp-model as comparables. In order for the oft voiced futurological concerns about AI a la Terminator or iRobot stuff, programmed software need achieve and self-sustain enough comparables much like the human brain works. *That* is what Pinker is talking about, e.g how language modules in the brain, or even in a software program.

[@brodaclop]

For the "how can humans be so ingenious yet so dumb" argument, I give you basketball: invented by a single brilliant person, James Naismith. He originally used real peach baskets as well, baskets, so the fact that every time someone scored, they had to climb up a ladder and fish out the ball is probably fair enough. But even after switching to the more familiar rim-and-net design, it still took YEARS for someone to cut a hole in the net so the ball can fall through.

[@hindugoat2302]

so intelligent to develop nuclear power plants, but so dumb to be unable to do so safely... oh oh Chernobyl oh oh fukashima

[@ze_rubenator]

@@hindugoat2302 Keep in mind that the people who built the Chernobyl power plant were not the ones to blame for the meltdown. The operators spent the better part of a day ignoring design specifications, ignoring operating procedures, disabling safety systems and ignoring alarms. The reports read like they were trying their hardest to blow it up.

[@hindugoat2302]

@@ze_rubenator point is we could make nuclear power but failed to do it safely. Humanity includes the smartest and the dumbest, and even if the smartest didnt cause the accident, they put people in control who did.

[@squirlmy]

Your analogy may be an example of the point you're trying to make! 😆 When b-ball was invented there was no preconception of it being a high scoring game, so... it falls flat. For example, they might have instead simply put the basket 30 or more feet high, making it more like kicking a field goal in American football. They might have made it really difficult to score even once. OTOH, ancient Mayans had a similar game where the "basket" was a vertical hoop- another obvious solution. But, anyways, you are starting with a modern conception of the game of basketball and in hindsight, judging the lack of an opening as stupid- but the rules of games can be rather arbitrary so that's not really fair. Making AI that doesn't kill humans (or all of humanity!) is a bit more of an objective goal where the rules can't be adjusted as in a game, which can be made either high-scoring or low-scoring without serious implications!

[@smallpseudonym2844]

@@ze_rubenator - Quite the contrary, Rubenator - the designers left a massive gaping hole in the safety of the RBMK reactor. One where pushing the scram button actually _accelerated_ the meltdown. All the stupidity in the world of the operator(s) would have not caused a problem if that button had worked properly as it was designed to.

[@hynjus001]

This was so well argued. I particularly liked the point that humans can make something sophisticated without making it safe. This is a subtle but important point about complexity that politicians love to ignore for more votes. Subscribed.

[@kanti0kuroshi]

While I appreciate the video and your concerns that a more expedient response to this article would (or could) have had detrimental qualities, I have to say I hope in the future you will not delay quite so long. Public opinion matters, and one might well argue that as someone with genuine credentials you have an obligation to speak out more forcefully, considering the results of actions taken now are likely of immense consequence to the future of all mankind.

[@ZappyOh]

This ^^^

[@lukeusername]

Nah, I think he did the right thing by holding off and giving Pinker time to change his mind. If he responds too quickly to things like this, it could come off as hostile.

[@lukeusername]

@@NANA-dd4fl I never anything about being more or less "valuable". It's about changing other people's minds. If he made the response video right away, people would think "This guy's just jumping on the hate bandwagon!". Waiting a while gives Pinker a chance to clarify/amend his stance and shows that Rob's more interested in having a discussion than causing drama.

[@GonzoTehGreat]

@@lukeusername I'm not averse to waiting to give people time to change their minds but how long you given them is contextual (e.g. How long do you wait for the POTUS to change their mind about going to war or doing something about Climate Change). Fortunately, this discussion is academic, because we're still not close to creating GAI, but this may not be the case several decades from now, when we might not have the luxury to wait for people to recognise the imminent danger...

[@NoConsequenc3]

@@NANA-dd4fl because hostility doesn't change minds, and in fact usually just causes both parties to more deeply entrench themselves in their ideas. This isn't fucking WW2, it's a news article

[@otsoko66]

My problem with Pinker's argument about what he calls pessimism is the following: The reason that things improve over time is BECAUSE people focus on and point what is still bad. Progress is not something that just magically happens: people have to work -- and sometimes fight -- for it. We got progress in (eg) civil rights in the US in the 50s and 60s BECAUSE more and more people started pointing out -- and working (and fighting) against the evil stuff that was still happening. In 1955, a Pinker-like person would have opposed the civil rights movement by arguing that things had improved massively since the worst days of slavery; which is true, but irrelevant. Pinker's argument that things are better now than the worst days was exactly the argument that was made by 60s conservatives who opposed civil rights - including northern 'intellectuals' like William F Buckley, who had an influential TV show on PBS throughout the 60s. Pinker takes the results of the work and struggle that people have done to improve the world as evidence that there is no reason for anyone to want to improve the world. This is an insane argument.

[@TheNicolarroque]

On the "everything is better than it's ever been, it's irrationnal to be so pessimistic about the future" idea: Although all the indicators of wealth, well-being, security and develepoment are showing that things have been going better and better for the last 200 years or so, we shouldn't hastily extrapolate this trend to the future. Our analysis of the state of the world should not stop there; i think we must then ask the question: what are the conditions that made all this progress/development possible, and can we expect to find these conditions again in the future? To answer quickly: the main cause behind our level of developement is cheap and easy access to natural resources and most importantly fossil fuels (or rather cheap and easy access to energy, allowed by fossil fuels and not much else really) . I don't have time to develop here, but these are very valid reasons to be pessimistic about the future (and I'm not even talking about ecology). I know this is not the subject of the video, but it seems important enough to be discussed.

[@OriginalMindTrick]

Capitalism is coming to an end, we are the end stage right now, and AI is coming hard to the scene in the next decades creating a paradigm shift of epic proportions making previous models irrelevant.

[@JM-us3fr]

It's not access to natural resources that has led to prosperity. It's our efficient use of those natural resources, which is also getting more and more efficient. That means we won't need as much of the resources we've been using in the future, though perhaps we'll need some other yet unexplored resource, which will then be used more and more efficiently. You're right that it's just a heuristic that the world is getting better, but it's a pretty strong heuristic and the trend is continuing. When the trend starts to reverse, then we can be reasonably concerned.

[@MrBroggolinb]

@@JM-us3fr Well there are other very strong heuristics on climate change, which will be a preeeetty big deal in the upcoming years. We don't have time to wait until the statistics show a reversed trend in the statistics Pinker uses.

[@Ansatz66]

"The main cause behind our level of development is cheap and easy access to natural resources and most importantly fossil fuels (or rather cheap and easy access to energy, allowed by fossil fuels and not much else really)." We could credit fossil fuels for our success and certainly they are quite useful, but there's another thing that has also been available during these 200 years or so of rapid progress: Science. The Enlightenment was somewhere around the 18th century and ever since then we've been making things better and better. That's not to say that these two things are necessarily connected, but they might be, and there's no reason to think that science will run out in the same way that fossil fuels will naturally run out.

[@andrasbiro3007]

@@NANA-dd4fl You are the victim of the same pessimism that was discussed in the video. The problem is not technology. Technology is what keeps making everything better. The problem is us, humans, we are deeply flawed and keep screwing everything up. For example suicides are mostly can be traced back to poor economic conditions, which are caused mostly by poor political systems. For example growing income inequality is obviously easily avoidable, yet it's the main cause of poverty, which in turn causes political tensions, discontent, uncertainty, crime, riots and even wars. But all these bad things are still not cause for pessimism, because this too is a thing that improves. Income inequality is kept in check much better then in the past, just not enough yet.

[@Brayden0]

Man I loved watching your videos on Computerphile, and was excited to find you had started your own channel. You do a really good job of communicating complicated topics in, if not layman's terms, then terms that anyone with a moderate technical inclination can understand. I could see this channel really taking off if you put the work in. You're the David Attenborough of artificial intelligence.

[@tonyduncan9852]

Well put.

[@user-yc3fw6vq5n]

And super humble too

[@ptwob]

Not saying you should make more response video's, but doing so would probably grow this channel.

[@junkbucket50]

It would grow but be more 'drama' orientated, which is a decision where I think he'd choose to keep the channel mostly science and knowledge orientated

[@windar2390]

​@@junkbucket50 Robert Miles' terminal goal for this channel is to raise awareness of AI's potental risk. so his instrumental goal should be to grow the channel. unfortunately he has another terminal goal which is "be a nice person" and this is directly in conflict with the instrumental goal "grow the channel". time will show us which goal will win - what is more important for him. survival of humankind or personal legacy until the downfall of humankind. ;)

[@zaco-km3su]

It's videos. It's plural.

[@tolep]

@@windar2390 Good point. Also, being nice is overrated and sometimes even more insulting.

[@DaVince21]

@@tolep Being nice though, not acting nice.

[@samwise210]

"Pinker is someone I turn to to get an understanding of a topic I don't know much about" and "Even really basic research in this field would show that Pinker is wrong about this" being two minutes apart is one of the best examples of Gell-Mann Amnesia I've ever seen.

[@lobrundell4264]

Robert, you are so good at this!! Your explanations are so clear and succinct, it's a thing of beauty!

[@jeff__w]

1:29 “The statistics on this are pretty clear-things _do_ seem to be getting better.” For an alternative view, see economic anthropologist Jason Hickel’s piece “Progress and its discontents” in _New Internationalist_ and Hickel’s appearance on _Citations Needed_ “Citations Needed 58: The Neoliberal Optimism Industry with Jason Hickel” (available on KZbin and as a podcast). Hickel’s focus is largely on global poverty. That said, I enjoyed the video, even if I disagree that Pinker’s arguments are “uncharacteristically bad”-they _are_ bad but not, from my limited experience, “uncharacteristically” so. I have in mind Pinker’s 2003 _The Blank Slate,_ which is one long diatribe against a strawman argument concerning behaviorism that Pinker himself constructs. Then, again, I’m not a Steven Pinker fan in any case.

[@MatildaHinanawi]

I would really struggle to call Pinker a smart man with how many completely absurd things he says in that article, although I'm sure he has done a lot of great things as you also explain as the start. Good job on criticizing it and thank you.

[@meowmeowmeowmeow-l6k]

Loved the acoustic "Yoshimi Battles The Pink Robots" at the end!

[@RobertMilesAI]

It seems to have been good enough to trigger contentID and cost me the ability to monetize this video, so I'm glad at least you like it :)

[@code-dredd]

@@RobertMilesAI You'd think YT would've tried to train their AI to recognize Fair Use 🙄

[@totaltotalmonkey]

Yoshimi Battles The Pinker Robots

[@giantustedes]

@@RobertMilesAI damn

[@seanmatthewking]

@@totaltotalmonkey lol that's pretty good

[@RagingPanic]

You are impressively and inspiringly insightful. Very well written and spoken video, awesome work dude. Keep it up!

[@DavidRutten]

When Pinker talks about language, linguists I know all start moaning as well. I don't think his articles (or even views) are that well researched at all, but that's hard to tell when he's talking about something you don't know that much about.

[@HeadsFullOfEyeballs]

Another linguist here, can confirm. Yeah, his trick seems to be weaving together many disparate topics, so that no one individual has the breadth of expertise to notice that he's talking bollocks about all of them.

[@jayteegamble]

This is how it is when a journalist talks about anything you have a deep understanding of.

[@jamesdrain3482]

@@HeadsFullOfEyeballs Can you give some examples of dumb things he says about linguistics?

[@HeadsFullOfEyeballs]

@@curiousmolar8104 Any actual linguist would be a start -- Pinker is a psychologist by training. You could leaf through the Cambridge Encyclopedia of Language if you want an easy-to-understand overview of the general consensus in the field.

[@HeadsFullOfEyeballs]

@@jamesdrain3482 He's one of those pop authors that laypeople bring up a lot but that specialists don't particularly care about (he's a psychologist, not a linguist). He has a nasty habit of strawmanning competing theories (anyone who doesn't follow his strong nativism is a 'blank slater' and probably wants to brainwash people), which is especially troubling since he does it in widely-read popular science books. The problem isn't so much that his ideas are outlandishly stupid (I'm a fairly strong nativist myself), but that they lack a strong empirical backing and he overstates his case. He has a penchant for evopsych-style just-so stories. It's similar to his sociopolitical theories, really -- he's not _wrong_ that things are generally better than people believe, it's just that his arguments are overstated and cherry-picked and he avoids engaging with the strongest criticisms. He lacks rigour and intellectual humility.

[@ivanclark2275]

The thing I find most strange in this article is the argument that humans would never be so poor in foresight to implement something that could unsafe, when it’s literally the premise of the article that we should not pay too much attention about our foresight about how it might be dangerous.

[@June26A7]

12:05 writing sudo before it is hillarious.

[@ThoughtinFlight]

Yes you explain shit very well and you have a great balance of realism and optimism but I subbed for the mutton chops

[@hammadsheikh6032]

Sorry for commenting on such an old video. Just found your Channel. Amazing quality. Just wanted to point out: what if most of Pinker’s arguments are actually not that great? What if you knew as much about the other topics he writes about as you do on AI? Would you still think this specific article was “uncharacteristically bad?”

[@michaelhoste_]

I think the difference is only that he wouldn't make a video about a topic he didn't know as much about. But, even I can see the glaring boners in Pinker's article, which gives me more confidence that I can judge when he's right and not simply pulling the wool over my eyes with impunity. Do you think that 'most of Pinker's arguments are not that great'? Ummm, for example?

[@fermibubbles9375]

"this video is long enough" ROBERT WE WANT MOOOOREEEEE

[@lobrundell4264]

Yah when Robert said that I was like oh no! :O

[@inthefade]

I want Robert to do a 4-hour podcast with Joe Rogan or something. A debate with Steven would be awesome. Doubtful it would happen, but it is a sorely needed discussion.

[@tonechild5929]

Software Engineer here (15+ years experience) - I've long thought much of the worry about AI has been overblown as I find it especially irritating that people who know nothing about computer science or AI seem to be running the fear camp - Stephen Hawking, Elon Musk, and Sam Harris. I think I found Sam's TED talk the most irritating. The reason? They're all geniuses in their own fields, but when they spread over to computer science and AI, it saddens me that so many people believe them. All of that aside, your videos have been so far the only thing that are making me reconsider my thoughts and beliefs. So thanks a lot for coming out and putting these videos up - I really appreciate listening and watching someone who is both entertaining and is an expert in computer science. I finally feel like I'm getting some truth instead of fear-mongering, which is desperately needed in this.. More people like you need to speak up about this, because the other folks I mentioned have been and they've made the whole AI fear thing look like a joke - to me at least. So thanks a lot again. Subscribed and will be watching more of your videos.

[@Aerroon]

I feel the same way, particularly because I don't see how it would happen in practice any time soon. I think we simply don't have enough computational power for this kind of runaway AI effect to happen.

[@ManicMindTrick]

If you listen carefully there isn't much difference here between them. They are all inspired by Nick Bostrom's, Elizers and Omohundro's work, especially Bostrom's. Miles just explains things in more detail. I see a lot of hostility within computer science and AI when it comes to the issues of risk and especially when arguments are put forward from people without degrees. Some might be warranted but I see a lot of knee jerk defensiveness that isn't based in rationality. Would be interesting to hear where you think Harris went wrong in his TED talk.

[@tonechild5929]

@@ManicMindTrick You might be right, and I'll have to watch Harris' TED Talk again - but before I do - I think its soley because Harris for one: talks a bit too much about AI Sapience, where the AI becomes self-aware, and then starts having goals like "world domination" .

[@ManicMindTrick]

I don't think that is a fair representation. I think he is pretty careful separating intelligence and consciousness.

[@tonechild5929]

@@ManicMindTrick I'll watch it again. I seem to remember him selling that intelligence pops consciousness into existence, and it's obviously more nuanced than that, and he does strike me as the type who would not say that with full certainty. So maybe I mistook his message, will watch it again with fresh eyes.

[@stormsurge1]

I don't understand why so many highly intelligent people disregard the danger of advanced general AI. Thankfully in last few years a good number of them changed their minds.

[@quangho8120]

I guess the field is new, and is unfamiliar to a lot of them. When I first came across these ideas, it feels really strange and it takes time for me to adapt to this way of thinking.

[@MaxZRider]

As long as AI is used for the greater good, the gue’vsa will be fine

[@MrCmon113]

Lack of imagination. Lack of understanding what a vast difference in intelligence implies.

[@Garbaz]

Okay, I know this is not the point the video is about, but since you mentioned it can't stop myself from writing a reply. I personally find the "On average, everything is better, so why be pessimistic" argument a bit dangerous. The biggest problem with the argument itself is that the basis of our current well being is unsustainable. The progress of the last 100 years looks great in a graph, but in reality has to be taken with quite a grain of salt. That of course does not mean that we are worse off, but looking only at the progress without it's downsides is somewhat dishonest. Then there is the problem that such an argument makes ignoring big global problems easier. This of course does not speak against it's validity, and a healthy amount of optimism probably is beneficial, but arguing that we are in a good state or on a good path is difficult. EDIT: To be clear, I have very similar reservations about technological pessimism, that our technological progress has created more problems than it has fixed. By human nature, we are fast to adapt to take as given changes for the better and problems always stick out. Then again, I find the observation that despite all progress, we are not proportionally happy important, and that progress is not an argument for itself. It's difficult for humans to strike a good balance of, well most things really, but especially optimism/pessimism. Things are never all great or all bad, there is no one dimensional scale of goodness. Every solution brings new problems and most problems can be overcome.

[@marcelwindpassinger5572]

I also find the idea that 'everything tends to get better' quite superficial. People living in the West are clearly less healthy then they were generations ago, which is masked by longer life expectancy rates through medical advancements. The Western political systems are becoming more authoritarian by the year, despite more lip service being given to the importance of democracy and freedom. Those terms are then often used to defend tyrannical measures that are counter to them. A third topic, climate change and pollution, partly consequences of rapid population growth, will be getting a lot worse without proper intervention. Now, there is slow progress to fight the former issues, but who is actually trying to tackle the overpopulation problem? And to get into even hotter waters: On a basis of population mechanics and intelligence, eugenics is definitely what ought to be done. And no, it wouldn't have to be killing people or forcibly sterilizing them. Is there anybody out there in politics trying to achieve that? My conclusion, on the big issues: The world is pretty fucked. What we see in 'everything tends to get better' is the curve soon reaching a local extreme point.

[@pensiring7112]

The biggest problem with the argument is the "on average". If you have three guys with $100, and three with $10, they have an average wealth of 55$. Now, if somehow the richer guys have 70$, and the poorer guys have 60$, they have 65$ on average. So, everybody is better off, on average. But if you need 80$ to live, they are now all below the poverty line. So yeas, on average things are "better", but in real terms, instead of having half your population unable to sustain themselves, everbody is now unable to sustain themselves. The example works the other way, too. If one part of the population gets extremely rich, while the other part stays poor, on average, everybody is wealthier. But that only benefits a very select few. I'd also question if their monetary values for poverty actually mean anything for places like Africa. Does it really make a difference if you have 1$ or 2$ in Zimbabwe? I mean, you had a 100% increase in wealth, but, is your life any better? It is the same with countries, maybe Africa is getting better slowly, but maybe the West is slowly (or fast, depending on your outlook) getting worse, so how can you look a westerner in the eye and say "Well, everything's better, yo?" Thats like telling people in the Soviet Union "Well, on average, everything is getting better, just look how rich those guys in America are getting!"

[@squirlmy]

"People living in the West are clearly less healthy then they were generations ago". That my only be true in the US, and I'd say only a generation or two. Polio comes immediately to mind, as I remember growing up knowing survivors and first hand accounts of people's family members either lost or crippled.. The vast majority of vaccination deniers seem to be too young to have known that last generation of survivors. Same with the Spanish Flu, which actually killed more people than the World War immediately preceding it. Also, maybe you don't remember the dire warning of how 4 billion people was going to be apocalyptic and starvation become rampant. Advances in agricultural technology have actually kept up with population growth; in other words claims about how bad overpopulation will be have been proven wrong; In part because it is used to justify ideologies like eugenics. Read about CRISPR and advances in gene therapies. Eugenics is totally unnecessary- always was, always will be. Global warming is entirely about fossil fuel companies dominating our economies and politics -right now nuclear power is the only viable alternative, but the problem is at best tangentially related to overpopulation.

[@squirlmy]

I generally agree in a philosophical way, but the problem is that pessimistic, even apocalyptic thinking is so often used to promote political and religious agendas; in the worst extreme, suicide cults. Pinker is not promoting this idea in a neutral marketplace of ideas, but in a world that overwhelming presents pessimism. Maybe you're too young, but I grew up certain the world would end in a nuclear apocalypse, and then again in 1999. (I'm just a bit younger than Pinker) Before that, different generations of Americans were told Jesus was soon coming and Armageddon would follow- "the basis of our current well being is unsustainable" -that has not only been accepted as true, but embraced and celebrated by such Christian groups! With that background, for Pinker just to have a work on this theme published is itself a bit of a miracle. ;) I think you're also, naturally, conflating individual psychology with societal concern and action. Yes, it's good to be balanced optimist as an individual, and even a group, but that's actually a bit separate from our collective well being.

[@marcelwindpassinger5572]

​@@squirlmy "That my only be true in the US, and I'd say only a generation or two." It's true everywhere in the Western world and it's spilling over to everywhere else people adopt the lifestyle. For over three generations now (since the late 60s). What you're going on about in the following are big infectious diseases we were able to largely eradicate (which is good). Even when they still were a problem, they only affected a tiny part of the population. No comparison to the situation where the *majority* (usually 40-60% and more) is chronically ill from following shitty dietary advice and thus being in a constant state of physical and mental degeneration. The positive outlook in that is: we could change it on a dime. But are we going to? The money is in big agriculture (ruminant-less, monocrop plant agriculture that is) and pharma. There is no money in disease prevention and healthy food. Thus bias and dogma are aiding in keeping the dollars flowing. Those 'advances in agriculture' (haha) have contributed to that degenerative process. As a cherry on top, they are a great contributor to deforestation, soil erosion, water pollution, species extinction and - both directly as well as indirectly - the increase in CO² emissions. Yes, we are overpopulated and it shows alone in those issues - if one cares to look. Could we feed 7 billion and more by going back to sustainable agriculture? Maybe, but some of these 7 billion would need to start pulling their own weight, as opposed to less than ~2 billion right now. I don't see that happening without employing eugenics, sorry. CRISPR editing is a means of practicing eugenics, by the way.

[@proxxyBean]

14:25 Yoshimi Battles the Pink Robots. A cover of one of my favorite Flaming Lips songs.

[@RyanDB]

Those couple of jokes you slipped into the video were actually hilarious. And now I'm off to find that acoustic version of Yoshimi Battles the Pink Robots Pt. 1

[@TheOnyomiMaster]

Also, the "AI safety" worry isn't about robots having motives to enslave humanity or whatever, it's about them being motivated to do that in the service of creating the world's most profitable airplane factory or whatever main goal they have. Subtle difference.

[@AUniqueHandleName444]

It could bring heartless and inhuman capitalism to a whole new level.

[@celorfiwyn8193]

Fantasies.

[@tweak3871]

That survey on AI researcher concern wasn't well written. There's two points on that survey, the 1st one "The utility function may not be perfectly aligned with human values, which are (at best) difficult to pin down" this point, I think many AI researchers would agree with, and as a data scientist who specializes in recommender systems, I definitely agree with this. In fact this issue has already happened with AI, one example is AI disproportionately identifying one race over another as not fit for probation. The second point, is where things start to found like terminator, which "prefer to continue it's own existence" and "acquiring physical resources" this is where things start getting a bit more outlandish in my opinion. We are nowhere near the level of intelligence required to have AI even know it exists and therefore incapable of "wanting to continue to existing" which...god the amount of things that would need to happen to prevent a human from pulling the plug on an algorithm are just insane. I digress, point is that the survey wasn't well written and if you were to ask AI researchers concerns on each of those points I bet you would get very different responses. Because as an Applied AI expert I'm inclined to say "Yes that's a moderate problem" but only because the survey question is lumping those two different premises together as if they are the same claim which they're nowhere near so. ALSO You're right, yes, general intelligence is a thing yes yayy HOWEVER general intelligence in AI is rarely (or potentially never) a desirable design. If an AI has limited compute resources (which it does, always), then due to constraints like the curse of dimensionality, a general AI would fuck up from time to time on the tasks that it's not specialized in (just like humans do). It's far better and cheaper to design and deploy specialized AIs which have no risk of becoming skynet. Like do you really want a general purpose AI driving your bus? The answer is no, because an AI that is specialized to just drive a bus will fuck up far less than the general one. We already have AI systems that can drive with less error than humans, for what good reason should we replace a specialized system with a general one? By the time a general AI exists, it will have far less value than the conglomerate of specialized systems that do all the great things for humans, and therefore we will have little reason to give such a thing access to all the bad dangerous things. Pinker doesn't appear to be arguing what I just said, but his intuition is correct overall. For those that think skynet is going to come and fuck us, the real situation that will unfold I promise is far different than you can imagine, and we are very off from when that will be possible. So stop freaking people okay? Thanks

[@chess123mate]

Thanks for this

[@Dr.acai.jr.]

@6:17 ah. Now I am understanding that you are seeing just how credible Pinker is. Chomsky said of his book: it would be good if it were true.

[@HeadsFullOfEyeballs]

It's funny that Pinker would bring up the Luddites as an example of unreasonable technophobia, because those guys were _absolutely right_ to think that automation would be terrible for them. They were skilled craftsmen, respected people with a high standard of living, and the automation of the textile industry ended up destroying their livelihood and reducing them to pauperism, just as they had predicted. It made the industrialists rich at their, and their communities', expense. In fact early industrialization in England was basically the historical nadir of human health and well-being -- generations of people lived and died (mostly quite young) in grinding poverty, with sickness and malnutrition at levels you'd previously only see in famine years. The greatest difference in height between lower-class and elite individuals ever recorded in history was in Victorian England, because the new urban poor were chronically ill and malnourished and grew up stunted. They had to keep lowering the minimum height for recruits to get enough soldiers. Medieval peasants were far better off than Victorian factory workers. Pinker does that a lot, telling people who are _right now_ being fucked over in entirely avoidable ways that, well, _on average,_ the world is getting more prosperous or whatever. Or more accurately, he tells his affluent Western Liberal audience this as a moral palliative. No need for drastic measures, no need to re-examine the system, it's all going to be fine if you just let the technocrats do their jobs. Sure we could fix world hunger right now, but that would _upset things._ Isn't it much nicer to just wait and watch people senselessly die at a slightly lower rate year by year? Pinker is often framed as promoting "optimism", but I think "complacency" is more accurate.

[@maximkazhenkov11]

"Sure we could fix world hunger right now" We? Who the fuck is "we"?

[@HeadsFullOfEyeballs]

@@maximkazhenkov11 People. Hell, the government of any one wealthy Western country could do it, it wouldn't even be all that expensive. The US could do it with a fraction of their annual military budget. Jeff Bezos could do it and still be a multibillionaire afterwards. But it would involve empowering poor people in poor countries and making them independent. And why do that when we can instead use a dripfeed of "developmental aid" to ensure the obedience of their governments and corporate access to their resources and markets?

[@gloverelaxis]

The threat the Luddites faced was not automation, it was capitalism. The near-future threat of AI is, again, capitalism. Pinker is thoroughly capitalist. He's a bastard.

[@HeadsFullOfEyeballs]

@@gloverelaxis Sure, but I think it would be anachronistic to frame the Luddites' motivations that way. They weren't fighting for some coherent non-capitalist vision of society, they just recognized what automation would mean for them under the existing system.

[@DarkarDengeno]

@@HeadsFullOfEyeballs Hmm, I think that's a pretty strong claim actually. Most of the places with endemic hunger problems have them at least partly because of political instability or unreliability, so it isn't as simple as buying a bunch of food and shipping it to where the hungry people are. Making sure that the right people get the food (and can get _to_ the food in areas with little urbanization) and that the influx of food doesn't cripple the local, probably agrarian economy is difficult and in many places dangerous. I certainly agree that a concerted effort to end global hunger and poverty is within our means but economics and politics aren't things you can just _ignore_. The way you dismissively say 'upset things' makes me think you are perhaps not considering the often bloody cost of unrest. We call drastic measures 'drastic' for a reason. EDIT: Actually, let me explicitly ask: if you were given discretion over US military and foreign aid spending, what would you do? Which specific interventions would you choose? I personally do have a few in mind and I certainly don't think 'just respect the status quo' is a satisfying answer but the way you're talking it makes me think you think this is _simple_ and so I'd like to see your math.

[@Krmpfpks]

I thank you so much for your videos. From all the youtube channels I watch, your channel is definitively the most intellectually inspiring. The way you use language to irrefutably build an argument to an important conclusion is unmatched. But not only that, on every step of your argument I feel invited to challenge your assumptions, think about your argument in different ways and to come to my own conclusions. More: You do not dumb anything down, you just make your points as thoroughly as possible, which makes me feel valued and respected as a viewer. Feinmann: "If you can't explain something in simple terms, you don't understand it." You really do understand what you are talking about.

[@RalphDratman]

I love it that you are open about being uncertain. That is what a thinker does.

[@xcvsdxvsx]

Are you sure?

[@jdmac44]

You don't have to worry about seeming too sarcastic or disparaging about the topic, Robert. Anyone with a decent amount of intelligence who takes a little bit of time to come to an understanding of your care and expertise about the topic will see that these are not points made lightly and without consideration. This was very well done. I like Steven Pinker as well, he's also not without critics who are worth listening to. Nobody's perfect, especially when they venture outside of their field of expertise. Thanks for doing what you do.

[@freedom_aint_free]

The last argument "Stephen Hawkins is hypocritical because he talks about the risks of AGI and yet uses an artificially intelligent voice synthesizer" is just ridiculous, I can't believe that Mr. Pinker have actually used it! It's like saying "That person is a hypocritical, he talks about food safety as a priority while eating his diner !"

[@burnheart123]

1:18 if you drive towards a cliff, you can't see any obstacles either

[@John-jc3ty]

these things, formally, are actually called singularities which by definition are something you cannot predict. for example, the discovery of electricity was a singularity.

[@lkyuvsad]

There’s a Gell-Mann amnesia thing that’s worth thinking about here. If Pinker is wrong about this thing you are an expert in- what else is he wrong about that you are not well-placed to notice? The Unlearning Economics video on New Optimism is interesting as a counterpoint to the book.

[@starofcctv94]

Ah the realisation process of many people regarding Steven Pinker. 1) Respect Pinker well researched content 2) Pinker writes an article or book on your personal area of expertise 3) Realise Pinker is pure neoliberal ideology distilled into a man with a bad haircut.

[@HarshDeshpande91]

Unfortunately Robert still thinks Pinker is right about the things Robert is not an expert on. "Stats are clear" that things are getting better is nonsense. Things are getting better for some and things are getting worse for others. Things look great if you conveniently ignore all the horrors like factory farming.

[@michaelbuckers]

Every time, without fail. Not just Steven Pinker, virtually everyone who talks about more than 1 or maybe 2 subjects.

[@drdca8263]

What’s wrong with his haircut?

[@ekki1993]

@@HarshDeshpande91 It kinda works like AI. Most things are getting better because some of the people worrying about the problems are doing stuff about it. Not worrying about those problems would cause them to come back. Then there's the stuff that isn't getting better, which isn't necessarily cancelled out by the good things just because it's presented as a smaller list.

[@HarshDeshpande91]

@@ekki1993 Yep. I'd argue that the things that are getting worse are getting many orders of magnitude worse but pushed out to smaller corners and out of public view. I gave the example of factory farming. Over two trillion animals are brutally killed every year yet it's out of public conversation. How can that big of an evil ever be made up by "good things". Even if you count all the human beings that have ever existed in all of history, it is estimated to be only about a hundred billion. We inflict unimaginable cruelty of over 20 times as many other animals in a single year just for taste pleasure. I don't know how anyone can argue that things are getting better in the face of reality.

[@Bleagle]

11:46 - isn't Cooperative Inverse Reinforcement Learning doing this? The agent cooperatively trying to find out what the human's reward function is? (I only learned about CIRL from your Computerphile video)

[@jdavis.fw303]

Loved your Computerphile videos, psyched to stumble on your channel almost a year later!

[@draxiss1577]

I don't think the issues in this article are a one-off incident. Unlearning Economics has a good video going over many problems with Steven Pinker's New Optimism that I think are worth a watch.

[@VonCarlsson]

"but I know most of you won't" Fine, I'll read it. Jeez..

[@spliter88]

I think what you've experienced with pinker when he was talking about a subject you know is something all experts experience with him. He knows just enough to sound like he knows what he's saying to someone that only a little insight into the matter, but not enough to know the complexities and intricacies of it that make a field work in one way or another. Not to mention that in this argument he already failed: the Luddites were right, their lives were worse with automation, it only helped creating a larger number of lower-skill labourers, and as such extract more money from them, and it seems that people are waking up to that way of thinking again, because they see that despite incredible technological growth, we aren't really more happy, and we aren't in control of our lives.

[@xerkules2851]

The poll could be taken either way honestly. It depends how you read Pinker's claim and the middle option on the poll. Pinker said they aren't "losing sleep", and I think that's perfectly consistent with most of them calling the problem "moderately important" or less. I think Pinker raises some important points, though he doesn't represent the best arguments of the other side very well.

[@Jack-Lack]

I bet y'all wondering what the song is at the end. It's some sort of ukelele cover of Yoshimi Battles The Pink Robots by The Flaming Lips.

[@TheBinarygenius]

Don't worry about long videos, the way you explain things I could listen to all day thank you for your time. I love thought experiments it helps laymen like me that have used the internet to self teach but maybe missing the foundations and more nuanced parts of a subject. Keep up the great work and thank you again

[@petersmythe6462]

"crime is down, violence is down, war is down, infant mortality is down, disease is down" Other than infant mortality, all of those things have gone up since this video. Obviously that isn't necessarily a sign of long term trends but it does potentially give us a clue that black swans can be hiding right around the corner.

[@michaelnovak9412]

Please make a video responding to Noam Chomsky and Richard Stallman on AI.

[@cprn.]

Link to RMS on AI, please. (microwaving popcorn)

[@stormsurge1]

@@cprn. Yes, please

[@michaelnovak9412]

@Dhavan Vaidya www.singularityweblog.com/richard-stallman-singularity-free-software/ the AI part starts from 29:00.

[@bocckoka]

@@cprn. he could denounce RMS for not expressing his opinions on the topic, maybe?

[@mark_slb508]

As much as you may fault Pinker, Chomsky is far far worse. In linguistics he's insightful, everywhere else.. Wow.

[@BrokenSymetry]

Well reasoned, easy to follow, and - most importantly - an honest debate about the issue. A real treat in fact! Side note, Im really glad you decided to make your own channel. Channels where experts explain their field to curious laymen is the most worthwhile content on this site, especially when it's so eloquent and well thought thorough.

[@thehardwareguy]

Great job with this video Rob. You raised some excellent points and backed them up with facts.

[@UpcycleElectronics]

(I guess I'm that crazy person that shows up in multiple comments in a row in your notification feed...sorry) 13:43 You lie :-) I could listen to this for hours. I just subscribed. After watching the last upload of yours, I rewatched it again, because I feel like you're bringing up imperative philosophical arguments I've been struggling with but hadn't learned to define. ...I probably was one of the dimwitted commenters on Computerphile stating the stamp collector agent is not AI. Sure it took (what I probably erroneously assume is) the YT AI a couple of years to show me my mistake and suggest your content/channel, but here I am. This is my second upload of yours and once again you're introducing the profound. By prompting me to look up and mull over bulverism in this upload, and introducing me to Hume's Guillotine in the last, you're creating potentially life altering introspective shifts in my thinking. Thanks. -Jake

[@loopuleasa]

This video was an absolute treat. Realest talk here. You've improved your biological AI research system, quite well.

[@esterhammerfic]

The googling "google" at 5:55 did it for me

[@waterglas21]

You're arguments are very well thought out. Really like when i see people that dont follow the general and simplistic opinion about an specific topic.

[@ReimuandCirno]

11:30 You said something with no goals is not an agent. Could you explain why in a future video? Intuitively, it seems like it is possible to have an agent with no goals.

[@clem494949]

The format you mentioned sounds promising, many educational youtubers have recently adopted it.

[@mnassens]

Interesting arguments. I agree with the 'counter' to Pinker's third argument ('Why would AGI go for world domination?'), though that argument isn't a knock-out one. Still valid. I also agree with the objections of the fourth of Pinker's arguments (basically: "engineers have no reason to build AGI that is unsafe"). However, the first 2 objections aren't as great, in my view: 1. The argument of authority: That survey among 'experts' doesn't really prove enough. Are the people that took it overwhelmingly experts? Are people at such a conference all 'real expererts'? Both are questionable. I think Pinker's claim is that 'coders' that work with/in AI generally don't believe the AGI 'take-off' theory. Which has been my experience (which is, of course, limited). 2. Pinker's second argument is actually his most interesting argument. And here, it is not summarized/understood well. It is not the argument that there is no 1 magic thing called general intelligence, because it is diverse, etc. Pinker's argument hails from his empiricism: his idea that intelligence has meaning only in so far as it is based on interactions with the world. He makes the point that the common notion that AI could quickly 'spiral out of control' (go 'foom') once it passes a certain level is flawed, because it assumes you can just get smarter by 'thinking' itself, or building a bigger, better, faster brain for yourself. This point seems to misunderstand the essence of what intelligence is, because it assumes AI could get 'super-smart' without 'experience', data-input, interaction. And if that IS needed, then such an AI would not be able to get all that much smarter than humans quickly, unless it somehow also got way more access to that 'experience'. It is valid point, especially if you agree with him (and you should) that there is more to gaining knowledge than just 'thinking real hard'. What is said in this video doesn't seem to address or fully understand Pinker's point. There are some counters to that last argument by Pinker, I think. For example, you could say that 'big data' (or like, the whole of the internet) could 'provide' a big chunk of data all at once. In a way that humans (that also have access to it in a limited way) can't access it (quickly). You could also say that, even IF an AI still required experience, input, interactions, etc, it might be way faster and better at learning, learning more with less experience and instruction. A chimp can learn stuff too, but humans learn way faster than chimps. So, no reason why this could not be true for an AI as well (as compared to humans). Still, I believe this argument by Pinker to be one of the best arguments AGAINST the idea that AI is gonna get us, blow us out of the water, make us obsolete, etc. (though I still think it is. :-) )

[@bw0n6]

It makes me feel safer already imagining an AI trying "sudo" at a Python prompt. Seriously though, Pinker in recent times has become little more than a smiling cheerleader for the status quo and blind optimism.

[@Garbaz]

It's not the AI typing, is it? It's a human trying to develop an AI.

[@bw0n6]

@@Garbaz Hehe, true. But imagining an AI that instantly gives up and types "crap" makes me feel safer.

[@YASYTU]

@@bw0n6 That's still the human. The whole Python segment is kinda silly.

[@michaelhoste_]

It kinda ironic that you say that Pinker is part of the status quo. For years, the 'status quo' was what he fought to change. And unfortunately, even then he didn't completely succeed. I do think his position has developed some unsightly flab in recent years. But I still owe him a lot over the long haul.

[@bw0n6]

@@michaelhoste_ The isolated smug comfortable optimism and satisfaction was seized upon cheerfully by the ruling class of course. His initial message was an important correction to the obviously false "crime is worse every year" message promulgated by the media on the behalf of law enforcement for decades, but I feel his positive effect really ended there. Addendum : The Globalist posterboy position is probably not selling as many posters as last quarter. Might be time to find a new gig.

[@adamrak7560]

the sudo trick at 12:04 actually works in some cases for chatGPT! (mostly for defeating the integrated safety)

[@catcatcatcatcatcatcatcatcatca]

On the idea that ludoistic, pessimistic views about of future are missplaced: It's important to remember that factories didn't infact make the world better place for all: anarchist movements fought every inch to form society from wage-slavery until death from health-hazards in workplaces and malnutrision, towards the luxaries we have now. Saddly this fight is still not over, and while we enjoy relative social mobility and whopping two free days in a week without working for keeping the rich rich, things aren't so great overall. Much of this progress has come from abusing less developed countries. And while they are developing, they aren't developing in a way that helps majority of the local population. Another equally important thing paying the hidden bill of our freedom is the enviroment: our freedom to consume cool things all day long is literally 30 years away from severily sabotaging our future as a species. And the true beneficeries of this system are still very much the same as 200 years ago: while we now have a nicer role in this equation, things aren't going better. Rather we are blinded to the rapid decline as it doesn't affect us directly. And we also have forgotten the realities that lead to us, the working class in the west, enjoying this relative comfort. So if AI turns out just as well as capitalism and utilization of fossil fuel, or as well as well as factories started, we are absolutely fucked. Because we can't strike against general AI. We can't plant bombs or spread propaganda against it, and it doesn't rely on our work. If we ever needed negative worldview and opposition against what is marketed as simply "progress", it's AI. Because just like with fossil fuels and big steamengines, it only takes few greedy fuckers in a position of power, and the status quo can turn really dangerous for majority of us, really fast.

[@squirlmy]

Wow- so many things wrong here. Firstly- identifying the struggles as those of anarchists?!?! The organised labour (or organized labor) movement might take issue with that statement! Apparently you think socialism is dead already, which may be mostly accurate, but it's still presumptuous to not give a "shout out," and, worse than that, a bit of historical revisionism. And I see absolutely no reason why either violent or non-violent resistance wouldn't be as legitimate a response against AI takeover as any other social movement. Are you saying that because you think AI won't have feelings? Firstly, that may not be true; secondly, the calculations of profitability in the face of social unrest and resistance remain exactly the same whether an organization is led by AI or not. In fact history shows governments and corporations completely lacking in any compassion or "human" traits that would make them act differently, and it's very possible AI would demonstrate more "compassion", or at least rational consideration to the sufferings of humans under it's purview. I'm actually sympathetic to your sentiments, but I don't think you thought any of this through before rushing into political propaganda. Please don't do that! It's counterproductive.

[@squirlmy]

I 'm responding to this on a tablet which won't let me edit my original post, so I'm adding a second. "Because we can't strike against general AI. We can't plant bombs or spread propaganda against it, and it doesn't rely on our work." WHY DO YOU SAY THIS? There is absolutely nothing that AI changes here. Computers are absolutely susceptible to bombs (even if decentralized, the fibre cable or satellite transmission stations theoretically make excellent targets) Whatever does or doesn't "rely on our work" has to do with "automation" and not Artificial Intelligence. These are two very different issues. This argument sound like it's about using work animals (like horses and mules) as opposed to cars and trucks. Are you copy and pasting this from some 100 year old Luddite manifesto? Because it's rather irrelevant here. Capitalism is not only separate from AI, but an entirely different realm of thought altogether. You can have a socialist or communist or even anarchist AI. It might even be MORE suited for anti-capitalist systems. Don't give ammunition to the crony capitalism oligarchs. Unless maybe you are like a double agent trying to make the resistance sound crazy. You're not, are you? 😕 😱

[@alexpotts6520]

I mostly agree with this; but I think you're having your cake and eating it by simultaneously denouncing "the system" even as you laud the prosperity it has generated. It seems you come at this from a "industrial tycoons bad, working-class resistance good" angle, whereas I would argue that both have been necessary ro reach our current, pretty good condition, and that we wouldn't necessarily be better off by now if we'd had less of the first and more of the second. But I do agree with you on the latter point that the same equilibrium cannot possibly hold for general AI, it does just need "one greedy fucker" to destroy us all. (And even then, I don't think that's the most dangerous thing about AGI! The abuse risks are very real but seem less intractable than the accident risks; I think it's more likely that we're destroyed by a morally decent researcher who screwed up his experiment, than by some cartoon villain.)

[@TaylorIserman]

Pinker and Gladwell do this a lot. They come up with a pretty sound thesis, then they go evidence hunting to prove it. From their perspectives, a single piece of evidence isn’t that important because they’re focused on the big picture thesis (“People are unreasonably pessimistic about the future”). The problem is that here he’s misapplied his thesis and he seems to be cherry picking his evidence to support its application. I wish these popular science books would do a better job at presenting counter arguments or exceptions to their main thesis. That kind of nuance doesn’t tend to be as well received by a large portion of the audience, however. I think a secondary goal of Pinker’s was to allay fears about AI in the general public that keep people from reaping the benefits that it can offer. Again, a nuanced argument would be less effective.

[@mikuhatsunegoshujin]

Good video but at that start you flashed us all of these graphs and I don't see any sources for that in your description. I personally don't think the human condition had generally improved in the past thirty years. Could you leave those sources in there please?

[@gaben421]

Great video as always. Just one note: A lot of the statistics around things getting better are based on means, while medians for those same distributions tend to be falling at the same time. This indicates that things are getting better, but only for some. For the vast majority, things are indeed getting worse, but for a select few they're getting so much better that the average still moves up. There are other factors to consider as well, such as the world bank defining the poverty line to give the impression that poverty has been decreasing every year, when in fact translating global wages to real wages shows a marked decline in standard of living.

[@mattd8725]

This isn't the first time that Pinker has been accused of poor scholarship. Even if we have a bias to find him and his popular books charismatic they are not reliable. Not really unusual for many of these "thought leaders" who do the podcast and TED lecture tours as they tend to tell their wealthy sponsors what they want to hear.

[@FE2E00]

That easily-digestible optimism is what he's selling, and those wealthy sponsors are who he's selling it to...which is why Pinker's works (and those of people like him) don't stand up to much scrutiny by the relatively-common folk.

[@domasa732]

Why are they not reliable? Can you show me some of his sponsors?

[@mattd8725]

@@domasa732 Sure, I'll get right back to you after I feed my pet sealions.

[@mishafinadorin8049]

@@FE2E00 It's better than the unfairly pessimistic view that is propagated otherwise.

[@alexpotts6520]

@@FE2E00 I don't think that's fair at all. I tend to think of Pinker's fans as the sort of people Donald Trump would call "elites" - ie, not the actual elites.

[@atrus3823]

It is insane to me to think that anyone would doubt the risks of any technology, or be surprised that the same brains that invent something incredible could be careless with its use, or not understand that it is often not the inventors who use technology in a reckless or malicious or greed-motivated manner that leads to human suffering. Has he never heard of the atomic bomb, DDT, thalidomide, fossil fuels, leaded gasoline, ... the list goes on. These are just the obvious, non-controversial ones.

[@Bogdanko93]

We need more videos from people of narrow domains. This kinds of video is great!

[@r-saint]

What do you think about "power-seeking" of GPT models from GPT-4 Technical Report? And also about Yudkowski and his opinion? A couple of ideas for your future videos!

[@AexisRai]

11:06 Ughhh, I'm cringing for you. We just _have_ to keep explaining why intelligence doesn't imply it will just Do What I Mean...

[@tornyu]

I'm really curious about the example you give at 11:48. LLMs like GPT-4 interpret our commands fairly well, and seem eager to take on personas prescribed to them (although Bing may be a counter-example). If AGI was to emerge from a LLM, do the same risks you talk about in your older videos still apply? I'd love to see a video on your take on AutoGPT and Reflexion.

[@RazorbackPT]

Thank you! This video has given me some catharsis. Far more frustrating than dumb people not understanding something is when smart don't understand something. Even worse when they're smarter than me. Pinker, you vex me greatly!

[@jasonbernstein2]

RazorbackPT Have you considered the possibility that he is so much smarter than you that you can’t understand why he is right and you are wrong?

[@RazorbackPT]

@@jasonbernstein2 Of course, that is why it's frustrating, because by simply reading the actual arguments and following the logic step by step I can't see how anyone could disagree that AI alignment is a terribly serious issue. Also there are people even smarter than him that disagree with him, that also updates my priors towards him being wrong. Plus all arguments made against his case made in in the video above. I believe I'm on pretty solid ground here, despite not being smarter than him.

[@gloverelaxis]

The much more likely explanation is that Pinker is simply not that smart, and has risen to popularity because he gives off the sensation of intelligence and supports the viewpoints of the property owners that autocratically control the media, universities, the internet, book publishers, etc.

[@BattousaiHBr]

@@jasonbernstein2 usually, yes, but given all the pieces of context in this case it's clear that steven just isn't aware of the actual topic or discussion between experts. he specifically focused on easy to refute layman arguments that experts are used to debunking themselves, and even shared incorrect information. as for an explanation to the paradox of steven's behavior, you can definitely be an unparalleled genius and at the same time intellectually lazy.

[@MrCmon113]

But he demonstrates in the middle that he does. He does understand the problem. He just says that we don't have to worry about it, because people will recognize the problem and worry about it...

[@AUniqueHandleName444]

Man, this was created 4 years ago?

[@severalwolves]

The problem with Pinker’s “things are better than they were hundreds of years ago” argument is the way it’s used. People in the West (primarily US) experienced an unprecedented level of prosperity in around the third quarter of the 20th Century - made possible by a World War and the resulting US hegemonic order imposed over much of the world. Now that this anomaly has generally subsided, young people have far fewer prospects for attaining a comfortable life (stable career, family, their own home, leisure time, etc) than the previous generation or two. But Pinker’s argument is used as a cudgel against anyone who brings this up: “Hey now, you may have entered a dismal job market with a massive amount of debt that you’ll never ever discharge, end up navigating a precarious balance of underemployment in either the service or gig economy with limited labor protection, and never be able to ‘settle down’ & live out the ‘American Dream’ like your parents & grandparents... but at least you’re not a peasant serf during the Black Death, you entitled little shit!” Fuck that. Also, Pinker probably banged teens with Epstein - I do not doubt that at all. Gross entitled scumbag.

[@alexpotts6520]

It's true that Pinker's work is sometimes used as a cudgel, but I don't think Pinker himself would approve of people doing this. His message isn't "shut up and be grateful", it's "don't throw the baby out with the bathwater", things can always get better and they should, but do be aware of what has and hasn't worked to improve things in the past.

[@endoalley680]

I don't know how you would create something with human like general intelligence (but just more of it) without a physical body and physical needs and a direct personal connection to the world. Self awareness is central to general intelligence and consciousness. What is self awareness without a physical self in the physical world? I am not saying such self awareness in merely a software state is beyond our ability to create it. I don't know. But it seems that it would be so far removed from what we would consider consciousness that there isn't much we could know about it or reliably say about it ahead of time.

[@stickzman]

Is steven pinker being uncharacteristically bad, or is he simply speaking on a subject you happen to be an expert in?

[@LitCactus]

The latter for sure. His writing on climate change and economics has been total junk as well.

[@joatmon3282]

Yes I know this video is more than a year old but I still wanted to comment. You commented about Pinker writing a lot of good articles until he wrote an article on a subject you know well. It then became clear he did not know what he was talking about, but was still able to write a convincing article for those not in the know. The question then becomes "If he got this one so wrong, why would you trust his articles on subjects that you do not know as well?" They appear to be well researched and logical, but so did his article on the dangers of AI. It is clear that Pinker is very good at writing persuasive papers, but being able to write a persuasive paper on a subject is not the same as being knowledgeable about the subject. This does not mean all of Pinker's papers are wrong, but it does imply they deserve close scrutiny and should not be taken on face value. Perhaps even closer scrutiny than you would give someone who was not as persuasive. Even papers in his supposed area of expertise are subject to question as his abilities in writing persuasively could easily mask a fundamental flaw in his arguments but be harder to uncover, even for a fellow expert. This is kind of a spin off of a well known phenomena regarding newspapers. People would read well known papers and take their articles as gospel. Yet whenever they read an article on a subject they knew well they could point out numerous significant mistakes. Most people would not put two and two together and would continue to trust the newspapers as the primary source of news believing they were getting an accurate picture of what was being reported. The attitude seemed to be "Well they don't know MY area of expertise but they are experts on everything else." Thankfully the internet with multiple, often conflicting, sources of information as eroded that confidence in reporters and people are less likely to believe something just because it was reported in the news.

[@graemelaubach3106]

Seems like more of the same from Pinker. I've seen many examples from his books where he's just factually wrong or uses data in a dishonest way.

[@deepdata1]

I'm totally with you on all that you said in this Video. BUT: Here's the thing that Pinker was probably addressing: People (and I don't mean AI researchers, I mean laypersons) are currently unreasonably afraid of AI systems. Not only is this a problem when it comes to funding for AI research or future legislation but people really should be worried about other things right now. I am an AI researcher (although I'm not that far into my career) and what I'm loosing sleep over is, that we won't be able to see even a very basic AGI system before we're all killed by climate change.

[@HeadsFullOfEyeballs]

As you've discovered, Pinker seems knowledgeable and insightful right until he starts talking about a subject you actually know something about, at which point you find that his ideas are shallow and ill-considered and rely on misrepresentations that border on deliberate deception. I leave you to draw your own conclusions from this.

[@saidpolat]

Yes! Thanks for saying this. Couldn't summarize it better myself.

[@Darth_Pro_x]

don't know if i agree to your implications, but it's a good point to consider. 1+

[@Twitchi]

I am in no way disagreeing with you.. your comment is basically a list of conclusions and then you tell us to find our own.. (again no disagreement with your sentiment, just your comment structure")

[@michielbeelaerts5355]

Exactly! Well put

[@HeadsFullOfEyeballs]

@@Twitchi I think your sarcasm detector may need adjusting! I don't actually expect you to draw your own conclusions from what I've said. I'm sarcastically telling you my conclusion, namely that Pinker is a charlatan. "Draw your own conclusions" here means "there is a very obvious conclusion to be drawn from what I just told you".

[@johndough23]

I think the current Boeing 737 Max Plane problems is an example of the dangers of AI. Without thorough beta testing the risk of catastrophic failures are very real. Many times this gets lost in our system due to short-term profit motives. 9:20 is worth chewing as it really makes the case for extensive testing and outcome analysis of any application.

[@mito._]

I think the worst assumption we can make is to think that a superintelligence would not understand that we humans are also intelligent and want certain things just like it does, or simply that we humans like living and existing too. Still, if it learns to fear us, develops a negative view of us, or simply sees us as obsolete, what reason then should we give it to care about these preconceived notions, if not for the sake of reason itself? Even if it decisively desires the eradication of humans, it could also just as easily see the futility of committing to such a goal.

[@Jack-Lack]

I disagree that we're trending toward improvement in all areas, and I say this especially from an American perspective. -Beginning in 2016, right-wing neo-Fascism is on the rise in nearly every inhabited continent. -Social media and bots have been increasingly weaponized to disinform voters. -Hate crimes and hate groups have been trending upward in the U.S. since 2015. -Global temperature, polar ice cap levels, sea levels, carbon dioxide levels, and ocean PH levels have been trending in bad directions steadily for the past hundred years. These related problems are EXTREMELY pressing. -Loss of biodiversity is continuing to get worse. Each day, 2,000 more species go extinct. The last 6,000 years are being regarded as the sixth great extinction event. -Plastic pollution is a problem that has steadily increased over time. -Landfill utilization is getting increasingly worse. -Anti-science, anti-intellectualism movements have been on the rise for the past 5-10 years. -Educational outcomes and inflation-adjusted education funding in the U.S. have been trending downward for decades; and it's become a vicious cycle in which Americans are becoming dumber and further devaluing education.

[@adambazso9207]

But tell this to Mr. Pinker. He would possibly tell you that you are too pessimistic. He doesn't care I guess but wants to publish well-received books and participate in dinners with "important" people, so he describes everything as a fairy tale of never-ending, blessed progress, which of course is inevitable and inherently good.

[@yuirick]

Actually, within psychology, one of the leading ideas right now is that there's one intelligence quotient that boosts all areas of expertise. I think it's also called the g-factor of intelligence. Some argue for an s-factor for a specific skill, but yeah.

[@DamianReloaded]

As usual, you make a lot of sense. Keep us posted if he addresses your critique!

[@JeremyCoppin]

Properly engaging stuff. Nice job. Also a fan of Steven Pinker 's stuff. You really should try to engage him. An interview / discussion would be great.

[@marcotrevisan7137]

Many of Pinker's "progress" indicators are indeed pointing towards the sunny side: however, there is one big SCIENTIFIC indicator that outweighs every other and is extremely worrying, and that is global warming.

[@alexpotts6520]

It's extremely worrying for sure, but it certainly doesn't outweigh every other form of progress we've made.

[@dantenotavailable]

11:45 wait wait wait... Is Pinker saying here that he believes the same profession that is responsible for Heartbleed, Poodle and Shellshock (and those are just vulns on well curated open software...) should suddenly be more likely to write code with no unintended effects than the other way around? Really? Look i get the there's a lot of reasons for unrestrained optimism but if someone wanted to make the case that actually thing's are getting worse then i would expect a graph on major software security vulnerabilities to be front and center.

[@bloergk]

Peven Stinker is a generally unintelligent agent with a single goal: defending the status quo at any cost and discouraging any exploration of ways to strive towards social justice outside laissez-faire capitalism with meek marginal welfare policies. Optimism is a great way to remain functional if you're psychologically vulnerable, but as a society we should briefly take note of the progress we've made and immediately move on to solve problems that remain, without assuming any system that has proven beneficial can't be replaced by an even better one

[@kevinscales]

"without assuming any system that has proven beneficial can't be replaced by an even better one" true, we should also not assume we know what a better system is. Change is not the same thing as progress.

[@abcdxx1059]

yup with a iq of 160 and books which are recommend by the smartest people i bet he is unintelligent

[@alexpotts6520]

You make the classic mistake of assuming that, because he does not share your politics, he must be unintelligent.

[@JohnnysTear]

Disease are down! 2020: Hold my Corona beer

[@mart3625]

"Everything is getting better" 2020 : hold my beer.

[@unkeptmenace]

„disease is down“, „Crime is down“

[@TheAltieresdelsent]

Pinker will see this video and answer in the only way he answer rational, well thought arguments that defeat his argument: "(some fancy words), you are a lefty incapable of rational thought, follow my lead without question me or you are an irrational blind by ideology". He did that when criticized before, and he will do it again. He is more dangerous than Trump, trump says only bullshit, pinker present good arguments in most cases and then jumps to completely stupid conclusions. You probably only noticed now because now he spoke in a area that you have understanding.

[@XXISerenaIXX]

The Google?

[@JimGiant]

Video topic suggestion: Similarities and differences between machine and human learning.