Wasn’t it KINDA About STATES’ RIGHTS?!?!?!?!?!?!?!

[@AtunSheiFilms]

Stick around for the credits.

[@shanesiddall69]

@Russian Waifu no

[@jtgd]

Oooh, you’re marvel?

[@jumpkickman1993]

When is the next Frozen 50s man

[@operleutnant7235]

@Russian Waifu nah

[@jtgd]

@Russian Waifu northern aggression of not surrendering a military fort and being attacked?

[@SirWeirdGuy]

Of all the people that own both a nazi uniform and a confederate uniform I trust you the most

[@williamnewman8293]

That is a group that I hope is very small yet is likely larger then I imagine.

[@WildLastFrontier]

@@williamnewman8293 and hopefully populated mostly by historians... but we know it's not entirely 👀

[@sidresponsible1190]

Of all the people who own either of those uniforms (except maybe civil war reenactors ) hes the only one i trust

[@bigbubbles55]

only other guy I trust with a nazi uniform is Jreg

[@sidresponsible1190]

@@bigbubbles55 who is jreg

[@TouThoj07]

"Sounds like a bunch of trouble making freeloaders looking for a handout" "They were white" "Brave rebels.." LOL that was great

[@DekoyDuck]

kzbin.infoUgkxObkNlr_5jctkblTI__lU3AZLOuVS_yDl A perfect summary of American history discourse.

[@bird-war]

Yep, racism for ya

[@nobody8328]

I cackled so loudly my partner came to check on me! I had to rewind because I'd missed some 5 minutes gasping for breath 😆😂😆🤣😆😅

[@cuetoaa7074]

That made laugh harder than I have laughed in weeks!! 🤣🤣

[@valakktoo4145]

4:45

[@LukeDwornikComedy]

"a bunch of trouble making free loaders" "they were white" "Brave rebels!" 😂😂😂😂😂😂😂😂😂😂😂 That killed me

[@Al-Rudigor]

The tree of liberty must be watered with the blood of patriots. 😂😂😂

[@emv005]

me too

[@nathanpetrich7309]

comedy gold 10/10

[@ramenbomberdeluxe4958]

I almost wonder...if the george floyd protests were done majority by white people and they were protesting the death of an innocent white man, would people have demonized it as much?

[@clairekholin6935]

To me it is less comedy, and more frighteningly accurate.

[@caidenbird1085]

As a former believer in the lost cause, this show has played a huge role in helping me progress my historical and political conceptions. Lots of respect for Andy and the work he does to eradicate old myths. Been watching for five years now! Thanks for everything, man👍🇺🇸

[@tristanband4003]

I imagine learning just what the Confederacy had planned if it won proved eye opening. Not even all white men made equal.

[@maeburekaiser]

​​@@tristanband4003It's why so many Republicans in the south don't want the facts of our history to be taught in schools. They want to indoctrinate the youth with the lies of the "Honorable Confederacy" When I was a kid, actual Civil War history was taught in Arkansas. It has recently been banned.

[@freedomstar3930]

Mind if I ask, what was your perspective of the Confederacy back then and what made you abandon the Lost Cause narrative?

[@andrewboldt9021]

The Fugitive Slave Act was ironically against the state's rights of Northern states.

[@warlordofbritannia]

South during the 1850s: Yeah, federal power! Screw personal liberty laws! South after 1859: Boo! Hiss! Federal government is tyranny!

[@LadyTylerBioRodriguez]

Its almost like it doesn't matter so long as the south wins............

[@shawnschaitel838]

the fugitive slave acts were constitutionally mandated laws as Article IV, Section 2, Clause 3, requires a "person held to service or labor" (usually a slave, apprentice, or indentured servant) who flees to another state to be returned to their master in the state from which that person escaped. the full text is as follows No person held to service or labour in one state, under the laws thereof, escaping into another, shall, in consequence of any law or regulation therein, be discharged from such service or labor, but shall be delivered up on claim of the party to whom such service or labour may be due.

[@pyromania1018]

@@shawnschaitel838 The problem is the South used it to deliberately kidnap people they KNEW were not runaway slaves. Anti-slavery folks responded not only with violence, but laws that tried to prevent that, to force slave-catchers to REALLY check and make sure that the person they were planning to grab was actually an escaped slave. That they used this to protect actual escaped slaves was a happy coincidence, essentially karma for the South's attempts to kidnap random people off the streets.

[@davidclark3588]

Yep. State’s rights and freedom only applies to people who live near and resemble my fat white body

[@ulischmidt03]

you know what’s better than states rights, human rights.

[@mrbroskiiguess8828]

Literally solved every US political debate

[@DerSchleier]

Know what is greater than human rights? VERITAS! The U.S. War of Rights (Secession?) WAS about Federal rights versus state rights (ref: taxation control and import/export control). The South's economy was the fourth largest (read "richest") on Earth surpassed only by the three colonial empires (England, Spain, France). The Federal government sought to cash in on those riches by further taxing the South

[@M1389-v2o]

Human rights to loot, burn, commit crime and then play victim, yes, thank you UNION

[@flgroyp8961]

boooo

[@sup8857]

Well, that depends.

[@iammrbeat]

What an honor to be a part of this masterpiece, and I always wanted to be journalist (since that's what my major was in college).

[@CTyankee]

Awesome cameo!

[@danielthevito9008]

Mr Breast!!

[@LadyTylerBioRodriguez]

You sold it like a champ. I wouldn't have been abled to keep my composure.

[@Gia1911Logous]

You guys should do more collabs You two are really unbiased in your videos and very very informative Keep up the good work guys As a non-American I enjoy learning about your history and politics

[@CTyankee]

@@Gia1911Logous I agree!

[@William-the-Guy]

I like the way Johnny Rebb is allowed to make some good points, such as calling BS on the way the north treated native americans. That is a totally fair point.

[@ManiacX1999]

Southerners were the *last folks* to be talking about treating the natives like 2nd-class citizens

[@William-the-Guy]

@@ManiacX1999 I think the point is that the northerners were not saints. I think maybe we'd be able to finally make peace if the northerners dropped their high and mighty attitude and admitted they committed a ton of atrocities too. I say this is a northerner.

[@cl34ve]

​@William-the-Guy Those damn northerners, unwilling to admit to their atrocities. They started the Civil War, too! Will their crimes NEVER end? Anyway I'm sure the United States treated their native population much better once the confederates were defeated and re-added to the union, and the south was able to campaign for the rights of native peoples. Wait, I'm getting some breaking ne- oh. Oh no.

[@Chris-qo4rt]

Absolutely but a lot of people use this as a justification for the wrongs the south did by going "well the north did this and that etc"

[@William-the-Guy]

@@Chris-qo4rt Again, true. But what I have said I think in every post here is that the best response to that is to say "YES, the north did those things, that does not somehow change the horrible things the south did." I think that denying the crimes of the north is what makes it so easy for others to deny the crimes of the south. Just admitting that prevents the conversation from becoming hypocritical.

[@rich355]

Anyone notice how Johnny Reb's character has subtly been changing. Before he seemed completely opposed to the idea that slavery had anything to do with secession, but now he is suggesting that slavery had played a part, but some other matters may have also been involved. Not to mention in the earlier episodes, He would sleep, take fake phone calls, look around the room, or be really mad whenever Billy Yank made valid counter arguments to his points. However for the most, he is more respectful and seems interested or at least willing to hear what Billy Yank is saying.

[@dastemplar9681]

Well his character is the embodiment of the “Southern Cause” that many have fantasized about to this day. Not the reality of it. His initial take has always been focused on two points. 1) Slavery itself wasn’t the direct cause of the Civil War, and 2) That it was truly a war of Northern Aggression. He’s representing those who go about worshipping Confederate generals and trying to find any means to “justify” the Confederate cause even by the slightest. So when the reality is revealed to him, even he is taken back, because it hampers his romanticized view of the Confederate cause.

[@ErikVonStrix3]

he's also becoming open to accepting some things the confederacy has done and said as horrific (eg: when he heard George Fitzhugh's quote at 38:32. early Johnny would have just brushed that off.)

[@bulbakingdoot3514]

Interesting

[@aralornwolf3140]

Maybe Johnny Reb hates the oligarchy which caused the Succession?

[@androzani]

I loved that he's has definitely had more character to him. He still has his southern pride, but he doesn't seem to be very eager to fan wave the truth about the confederacy or attach that pride to them. He's growing as a character, and to be honest, it shows Atun-Shei is growing too, this is the same guy who brutishly murdered this rebel before, but is now more comfortable to talk some scene into him to a point were the rebel actually changes his mind. It's nice to watch these videos the most out of his series.

[@yourdaysarenumbered3012]

Learning about Confederate leaders’ plans for if they won was really fucking grim

[@thatguy3421]

I have the strangest feeling that it would like what Hitler planned for Eastern Europe

[@Dreigonix]

“The First American Slave Empire” is a phrase so nightmarish I’m legit surprised there aren’t any alt-history video games about a group of heroes rising up to overthrow such a society Wolfenstein-style.

[@AD-dg3zz]

The closest video game example I can think of to this hypothetical society is Colombia from Bioshock Infinite, but the racism and neo-slavery was only a background issue in that story. So somebody really needs to make this game!

[@user-Kn3GB4wgTp9MYGA]

Wait until you find out the union's plans if the confederacy was won over by the union's proposition of the Corwin amendment in 1861.

[@drakep.5857]

​@@AD-dg3zzbioshock infinite is the world's greatest example of "great idea bad execution" I think wolfenstein 2 the new colossus is the greatest story we've had taking on this idea in a game yet imo, however I do think there's a game about alt right takeover that's alot more realistic and impactful, albeit in a more serious and hopeless way, being the hotline miami series, but yeah I fully agree that would be awesome if done right and not offensively

[@DaraelDraconis]

It's no wonder Jonny Reb didn't remember Episode 1 at first. After all, he wasn't there. That was some other Confederate officer, who you shot dead.

[@jeffreygao3956]

I'm still not sure if it was right to murder that Confederate officer. Just because someone's nasty doesn't mean they deserve to die!

[@YokaiX]

Indeed. That was Stonewall Dixie, not Johnny Reb.

[@Vextonomy]

@@YokaiXlmao

[@Vextonomy]

He died to a gunshot wound too

[@求是-j6d]

Lt. Summ G. other

[@milkinobama]

Fun fact. The Wii U lasted longer than the confederacy

[@iPig]

The Wii U will rise again!

[@Sketch_Hero]

Wii U? More like Wii W

[@mastercrafter2252]

Also the annoying orange lasted longer than the confederacy

[@ADMICKEY]

And fortnite

[@accusedtoppat]

And me

[@FritzMonorail]

I legitimately had to do a double take when I saw that there was a new checkmate Lincolnites because I almost couldn't believe it. The exact thought that went through my head was "YES YES YES YES YES YES"

[@111111310]

SAME

[@plaguechild24]

same

[@jasonritner9662]

*cues up Flight of the Valkyries*

[@johnfraire6931]

Ba daa da da *daaa* da,

[@jurtra9090]

IS THAT A M'FING JOJO REFERENCE?

[@elizabethbellecoeur5446]

"species of property" is the worst euphemism I have ever had the displeasure of hearing

[@Thomaas551]

When in the video was that?

[@dominicguye8058]

Somewhere in the first quarter of the video. I am only a third of the way through the video and I heard that part already.

[@mrblue1768]

Pretty funny out of context though

[@LoveNLegacy]

When I heard that, I literally had to stop what I was doing, to dedicate all my brain power to mentally process those words. Baffled when I heard it, and baffled still.

[@Because-rt8qs]

It's not a euphemism. One of the definitions of species is things of the same kind. Not only living things, any things.

[@cybercrash7]

This video is the perfect embodiment of: When you don’t know anything about the Civil War, you think it was all about slavery. When you start to study the Civil War, you learn about a complex myriad of issues like states’ rights, the preservation of the Southern economy, and a defense of a way of life. When you’ve dug deep into the study of the Civil War, you realize it was all about slavery.

[@aralornwolf3140]

So... the uninformed position was correct, lol.

[@BobPantsSpongeSquare97]

@@aralornwolf3140 there's just more nuance. Slavery was indeed the primary cause of the civil war and while there were other issues like tariffs, they are all still tied to slavery. Instead of different issues sitting together side by side in equal importance, it's more like slavery is the big bubble on top which trickles down to the smaller bubbles. However the uninformed position tries to water down slavery as the primary cause even though almost every hot button issue in the early to the mid 1800s was centered around slavery. 3/5 Compromise, Missouri Compromise, Compromise of 1850, Kansas Nebraska Act, Fugitive Slave Act, Dred Scott Case, Bleeding Kansas etc.

[@goldenageofdinosaurs7192]

Lol, well said, sir..

[@iamthewizardwhoknocks2845]

@@BobPantsSpongeSquare97 The reason the South left the union and the reason the north went to war with them are different. Leaving the union was not an act of aggression. It did not start the war.

[@JohnSmith-pm3ew]

​@@iamthewizardwhoknocks2845 "No state shall enter into any treaty, alliance, or confederation." The South did this when it seceded and formed each individual government, and again when they formed the confederate states. That's a hostile act of aggression against the Constitution and since the states had ceased to enforce federal law, it couldn't be interpreted as anything other than an uprising

[@Nekrubbobby]

"But it's our heritage!" "The annoying orange lasted longer than the Confederacy. You really gonna celebrate something so week that the annoying orange out lived it?"

[@MrShipBuff]

"Well states rights-“ "Get Douglas'd." **Union Dixie**

[@heyyou322]

Still find it funny how it literally goes Skimming over it: it was about racism Looking a bit into it: Oh the south’s economy would basically be destroyed overnight and they basically had to do somethi- *Reading more into it* : oh they actually could’ve… damn never mind it was about racism.

[@jeffreygao3956]

So did Pokémon!

[@j.i.nthenobody54]

@@jeffreygao3956and Transformers. And fidget spinners

[@OkaTheSmokaV2]

It’s was so weak that the union had twice the soldiers and still more union soldiers died than confederates.

[@striker8961]

It’s like that iq score meme: Low: they were cartoonishly evil. Middle: it was a complicated political issue. High: they were super cartoonishly evil, like beyond belief, I have the letters to prove it

[@patrickcleburneuczjsxpmp9558]

So you think other Americans' evil is justification for trashing the constitution and the rule of law and denying them the right to self-government?

[@striker8961]

@@patrickcleburneuczjsxpmp9558 yes.

[@patrickcleburneuczjsxpmp9558]

@@striker8961 You sound like the people that defended slavery on the basis of blacks supposedly lacking the moral qualities for self-government.

[@striker8961]

@@patrickcleburneuczjsxpmp9558 what are you smoking and where can I go to avoid it at all costs

[@patrickcleburneuczjsxpmp9558]

@@striker8961 I'm not the one making excuses for denying other people the right to self-government. You and defenders of slavery have that very much in common.

[@Alexlalpaca]

"Those [Virginians] who do remain have reverted to a primal state of nature" Oh no, they became Floridians.

[@420JackG]

Eh... the world would still probably be better off.

[@Contra_Mundum]

I feel fine

[@FMCH6444]

As a Floridian, I feel this. They made our wonderful state the laughing stock of sane people.

[@jtilton5]

@@FMCH6444 One guy uses an alligator to rob a 7-11, and suddenly you get a reputation.

[@timmccarthy872]

I was gonna upvote you but at present your comment has 703 upvotes (the area code for northern Virginia)

[@2Trundle]

“Slavery is gay because it means owning another man” - Abraham Lincoln, 1862

[@vogelvogeltje]

Totally. No words put in his nice warm mouth at all…

[@Eli_Guy]

A simple spell but quite unbreakable

[@anonbefallen4807]

@@vogelvogeltje pretty sure that was meant to be a joke

[@planaritytheory]

@@anonbefallen4807 pretty sure Vogel made a joke as well...

[@planetaryevolution4853]

Based

[@ishmaelexpatriate]

Seeing the confederate's reaction of horror and awe at the awful sh!t being spewed by confederate political theorists is honestly kinda wonderful.

[@scarabairsoft221]

Remember that a few weeks before this came out, a “Southern Heritage” supporter refused to comment when asked three times if he supported slavery. For all the under-educated, misguided people, there’s a core of true racists and would-be slave owners.

[@donovanlocust1106]

The Republicans would repeal the 13th Amendment if they REALLY wanted to.

[@crotchman]

Someone in public office?

[@yannickgrignon2473]

That's absolutely batshit insane. Supporting slavery is beyond the Pale, EVEN among most racists.

[@twotone3471]

Most of the "Heritage, not hate" good ole boys think the "Rebel Flag" is a Confederate one.

[@CriticalCarolinian]

That clip was crazy, dude was given three opportunities to correctly answer the easiest yes or no question in existence and failed.

[@tymacrae6052]

I honestly don’t understand how these people keep thinking the CSA was this paradise of individual freedom and small government when they had higher taxes and even more egregious conscription laws

[@jeffreygao3956]

“How is is we hear the loudest whelps of Liberty from the drivers of slaves?” -Anonymous Unionist.

[@originalindigodingo]

Because every single person who claims the CSA was a beacon of freedom is dumb enough to think they would have been a slaveowner, and not a serf. Same with libertarians who think they would be smart enough to succeed in an unregulated environment, and not die instantly from tainted food. Stupid people think they would be in charge because they mistake ego for qualification.

[@LewisB3217]

Revisionist history telling them their ancestors were doing the right thing, I guess that’s what happens when you go light on treason

[@abdulmasaiev9024]

Ah but you see, it was war and they were fighting a lopsided fight. Once peace came their rulers would have totally given up those powers, honest! ...well either that or they'd go "can't have shit be more perfectly unified than it all being directed by one will and sitting in one coffer: goods, money, people and all - therefore more authoritarian and even totalitarian = more perfect union, Just Like the Founders Actually Intended"

[@Sid_Garrett]

and you know, slavery

[@christophercolasurdo919]

“Sounds like a bunch of trouble making freeloaders” “They were white” “Brave rebels!” Ok. That got me.

[@67pearse]

Individuals with penises and without melanin is high up there too lol

[@darkshadowrule2952]

Same, I actually laughed out loud at that

[@MeansOfProduction209]

Sorry I didnt mean to dislike this comment, I hit it by accident

[@In90minutesPodcast]

😂

[@darkshadowrule2952]

@Maximal yeah, I dont think you can even see it when someone dislikes your comment without that browser plugin, but I'm not sure if that still works

[@AddieHughesVT]

To quote a funny brocolli man "state's rights to do what?"

[@tonyjoestar2632]

Get Douglas'd

[@AshanBhatoa]

​@@tonyjoestar2632*Cue a version of Dixie.

[@achair7265]

@@AshanBhatoa Union Dixie.

[@skravats]

DOOBUS

[@jeffreygao3956]

State’s rights to utilize slave labor for profit.

[@billybattyboyjunior69]

"and I must ask are you an anarcho-syndkialist" is the best line since "and I say that as a Latino"

[@Alte.Kameraden]

made me smile and cringe. Anarcho-Syndicalism is like one of the dumbest branches of Socialism. Because it's a contradiction. I doubt a Lost Causer would even know what it is. 😆

[@TheEvilMiasma]

I’m not sure how someone makes the connection between supporting federal power and the exact opposite.

[@szymonsokolinski9907]

@@Alte.Kameraden No it’s not. You may disagree with it, in fact, I do, but there is no contradiction between opposing the state and various forms of authority and believing that capitalism should be destroyed by a series of strikes and other actions organised by militant labour unions

[@QuadZillaGodZillasbrother]

@@Alte.Kameraden All types of socialism kind of suck

[@appleman6290]

@@QuadZillaGodZillasbrother based

[@captainahab1533]

This episode is the embodiment of what this channel has become to me and probably many other viewers. I came watching some Checkmate Licolnites, but it's the super creative and unique stuff I stayed for. There's no other channel that combines educational elements with s-tier entertainment, in such an amazing way.

[@AtunSheiFilms]

Yay! Very kind, thank you!

[@warlordofbritannia]

@@AtunSheiFilms That end credits scene in particular was… *chef’s kiss*

[@NothingYouHaventReadBefore]

@@AtunSheiFilms For real though. It's an embodiment of genuine passion, and it's amazing to see your work grow! ❤

[@yg6484]

I completely agree.

[@ThePoolshark86]

Perfect comment

[@thejanitor3337]

"Sounds like a bunch of trouble-making freeloaders looking for a handout!" "They were white." "Brave rebels! The tree of liberty must be watered by the blood of patriots!" My fave line so far.

[@eazy8579]

Basically Conservative rhetoric on welfare

[@screamingphoenix8113]

​​@@kingofcards9 Its really not. For example, l Conservatives thanked Trump for giving the mainly white farmers relief after his failed tariff war. Than when years later, Biden had a minor clause in the BBB plan, wherein black farmers would recieve relief, Conservatives threw a massive hissy fit.

[@dastemplar9681]

@@eazy8579 Lol is that what you taught yourself?

[@kayo5011]

@@kingofcards9 cringe

[@matchesburn]

@@eazy8579 [He doesn't realize he's being just as cancerous as the caricature of Johnny Reb here] Points for unintentional irony, though, I guess.

[@Tiberius_Productions]

The fact that the Confederacy was never really going to be the “libertarian dream-state” Lost Causers pretend it was, but instead an authoritarian apartheid state (or worse yet a dictatorship) is so ironic it borders on comedic.

[@criSOME1]

Libertarians don’t see it that way. They see it sets a precedent for other states as well. Many northern states originally wanted to secede from government firstly. In fact the original abolitionists were the trend setters. You guys love to attack libertarians lol why loser?

[@danieldykstra3079]

The Confederacy was not a libertarian dream state, they still had an age of consent.

[@julianstone1192]

@@danieldykstra3079 Being in the 19th century it was probably something like 12 honestly wasn't it, as for the black people didn't they keep them as se* slave or was there a code against that? perhaps with viewing them as literal livestock most would be put off Honestly If I grew up on a plantation and was raised that way, I'm sure as a horny teenager it would be a very bad thing for the slaves, as Jonny Reb says " I definitely would have been an abolitionist if I was alive back then" "shut up" lmao, in a 150 years people will back on us in horror and not be able to comprehend many things that are normalized in our society"

[@kdog2646]

Nor remotely true. The confederacy was very big on states rights. Each state could print their own money, place their own tariffs, etc. In a disagreement between state and federal laws, states won. Now, this was undoubtedly going to make the confederacy fail, so slavery probably would've ended in the next 100 years anyway from a complete economic collapse, but they were very big on the states having the right to do what they want and not an authoritarian federal government.

[@NoName-hg6cc]

​@@kdog2646 Except there were laws against banning slavery for any state of the Confederacy

[@HelloFutureMe]

Just wanted to say I immensely enjoy your sense of humour and dedication to correcting historical narratives that so often go unchallenged.

[@bar0nv0nstrubel57]

You know a videos good when you see some of your other favorite KZbinrs in the comments

[@blacklighthologram5339]

Yeah this is definitely the kind of video I'd find you commenting on.

[@happygilmore1844]

love how he brings to light both perspectives from either side of the debate...clearly defined that it was the cause of spread of slavery that mainly brought about the civil war, that it was incumbent upon Lincoln to solve a national moral crisis....you know, REAL problems to worry about , not the nonsense concocted today by immoral people who have nothing better to do with their mundane existence

[@osurpless]

A lot often do. Especially why the “white race” was created in the first place after the start of the Columbian Exchange…

[@Titan-zn3fs]

Yes it's sad that the historical narrative that the civil war was fought over state's right's....."to own slaves" has been "accidentally forgotten". It's a good thing the attempt to change the FACT of the actual narrative will not change just because cowards want a made up excuse to "justify" their belief in a lie.

[@solomontheadventurer6709]

It’s crazy how people will still argue for the “states rights” and “Lost Cause” theory after hearing how *their* politicians actually wanted the Government of the Confederacy to have MORE power over southern states.

[@samuelskinner7704]

Because it was about the North having power over the South. It turns out the Southern objection is 'we don't want to be under the thumb of people who hate us and want us dead'.

[@chile_en_nogada2090]

Who cares

[@samuelskinner7704]

@@chile_en_nogada2090 Because we might get round 2 soon enough.

[@solomontheadventurer6709]

@@chile_en_nogada2090 …you clearly do…you cared enough to comment about how much no-one cares…which doesn’t make much sense. Also, clearly 51 people care? Do you not see the likes? Your the type of person to look at a famous artist you hate and say “who even likes them” because your too hard headed to even understand that people could like something different than you.

[@diehard2705]

@@samuelskinner7704 you’ll get whipped again

[@salusoutlook2266]

i wont even lie, as a former believer of the "lost cause" myth and having every single point i ever made refuted and proven wrong. ill give you the full satisfaction of knowing this series has changed my mind completely.

[@salusoutlook2266]

@clxxd999 you have no idea dude. I'm from Alabama so obviously I would have an extremely pro Confederate point of view. But I also like to admit when I'm wrong. I'm admittedly embarrassed about how wrong I was though lol

[@dusk2308]

oh wow you can't say that on twitter...wait? no you still can't there still gonna hate you, at this point twitter is worse the alabama. i mean i guess they didn't want an authtain slavery empire but something just as worst...communism.

[@pesco7]

I'm so happy to read this. I wish everyone were as willing as you are to change your mind based on reasoned discussion and facts. Good on you. I hope you're able to take it to the next level and try to dispel other people of their false assumptions, as well. Safely. I know some people in the south can be very emotionally defensive about these topics.

[@ReaperCH90]

@@salusoutlook2266 i have the greatest respect for everybody who changes his or her opinion after being confronted with new facts that oppose the old opinion. Good on you!

[@reaperking2121]

@@salusoutlook2266 Its honestly not your fault. Its the central governments fault for failing at reconstruction. The south should not have been allowed to tie its culture back into the confederacy . Had reconstruction been handled better, or maybe just maybe the south had been given less leniency this bullshit could have been avoided.

[@mudeschuppentier6306]

As a modern white southerner, screw the confederacy. There were southerners that were against the confederacy. I don’t know much about them, but I know a few existed. Southern Hospitality should be for welcoming everyone.

[@HaloFTW55]

There were actually enough to form Union Army regiments that fought against the Confederate Army. The influence also extends into the US Navy with the most famous naval commander of that war being a Southerner by the name of David Farragut.

[@user-jq1mg2mz7o]

southern unionists were pretty cool, and if anything displayed the workingman 'rebel spirit' more than the wannabe aristocrats of the south. it's hard enough to take up arms for freedom against countrymen in another state, but doing so knowing your neighbours are arrayed against you and you fight anyway? based. they should be the ones with statues. if the neo confederates want their "we must remember history!" i say put up southern unionist and abolitionist statues. that's the legacy they should be proud of and claim

[@Waffenschmitt]

My GG grandpa fought in the 6th TN mounted infantry US during the civil war

[@dogukan127]

@@HaloFTW55afaik one of the really good generals of the union who did not make much name to himself because he destroyed his own diaries was also a southerner

[@brian8507]

Wow such a brave take 👏 👌

[@helarki4309]

"A states rights to own slaves!" He did it! He said the thing!

[@waltonsmith7210]

He said the quiet part out loud.

[@IronWarhorsesFun]

its nOT A ABOUR PROPERTY, ITS OUR WAY OF LIFE!!!!

[@helarki4309]

Your property consisting of?

[@MechWarrior894]

I would have made Johnny Rebel say it. “A state’s right to do what?”

[@MyPhobo]

He said the thing we are all thinking when we roll our eyes when people say the other thing!!

[@wyatt8274]

I like that Johnny Reb has gotten much more chill over the years, solid character development.

[@weldonwin]

That and being shot dead in the first episode

[@heribertosarmiento1265]

It was thanks to VVitch hunter general slapping the Nazi out of him

[@meepnax]

@@weldonwin In the first episode, he said he owned slaves during the war. By this episode he claims he "would've been an abolitionist". Clearly the shooting knocked the slaveholderness out of him

[@kylegonewild]

@@meepnax "Getting shot has a high chance of changing your outlook on life." -Ancient United States proverb.

[@Gantradies]

the exorcism probably helped a fair bit, as has all the alcohol, i suspect...

[@squably]

"I must ask, are you an anarcho-syndicalist?" Dear god Kaiserreich and its consequences have been a disaster for the human race

[@AmericanImperium1776]

Anarcho-Syndicalists were a thing in the late 19th Century and I think the just before and during the Spanish Civil War.

[@Reagan1984]

@@AmericanImperium1776 Yes, but very few people in the 21st century knew what the ideology was until the recent exposure by the Kaisereich mod. Same with Huey Long.

[@AmericanImperium1776]

@@Reagan1984 I know, for me I found out about Huey Long from Emperor Tigerstar’s on him.

[@kazmark_gl8652]

It's a real ideology we swear. I genuinely feel bad for the Anarcho-Synicalists who'd identified with the ideology before Kaiserreich became more mainstream in this specific internet neiche, all tens of them.

[@originalindigodingo]

The eff is Kaierreich?

[@gupgaming2367]

It never ceases to amaze me how people can look back at all this information and still believe that the slavers were right and that african americans were not human.

[@heyyou322]

Simple. They just… don’t look at that stuff… and oh man it’s like it never happened

[@j.i.nthenobody54]

@@heyyou322people in general really like looking at the good shit a person or nation has done, and completely ignoring all the bad stuff

[@yehbuddy4251]

"Local conservatives minds blown as they realize don't tread on me and back the blue are radically different ideas" is the greatest thing I've ever seen

[@luisfilipe2023]

Ah yes if you oppose tyranny that means you support anarchy middle ground is a complete non concept for American leftists

[@nickelback3360]

Not punishing crimes isn’t freedom. So, only to a point. If anything, anarchist/community/volunteer police would be harsher. While not identical, my campus police at University of Chicago were “meaner” than Chicago PD. People who dislike back the blue all have twitter addictions anyway

[@Balrog-tf3bg]

“Don’t tread on me!! It’s MY RIGHT to lick the lovely leather boots of the fine police officers”

[@luisfilipe2023]

@@Balrog-tf3bg next time your house is being robbed call Batman jackass

[@memeboi6017]

Not really, “back the blue” is a reactionary slogan against the defunding that plagued many police departments due to the BLM inspired purging of police. Meanwhile “don’t tread on me” is about individual rights, and police do not fundamentally go against that.

[@benjamins.10]

The alcohol choices are VERY purposeful. Billy was drinking Apothic Inferno during the Sherman episode. This episode Billy is drinking Sam Adams while he talks at great length about the Revolution. Johnny is drinking The Boot as Billy lays out how the Confederacy was an authoritarian state. Nice little detail, Andy. I see you, 😂

[@KuLaydMahn]

I can't believe he shook up and spilled all that beer everywhere!

[@DrSanity7777777]

“I fear’d [sic] being guilty of Injustice to the Brute Creation, if I represented Drunkenness as a beastly Vice, since, ’tis well-known, that the Brutes are in general a very sober sort of People.” - Benjamin Franklin

[@iangrau-fay3604]

I saw that too.

[@snoopsauce6294]

Holy shit dude, the confederacy was actually insane. But it really isn't that farfetched for a country explicitly created to preserve to the point of war, would have a tendency towards total governmental control. It really seems like a natural progression.

[@hmt4173]

The video also makes it clear that the federal government was complicit in the fight to preserve slavery. Excellent video, very radical stuff.

[@warlordofbritannia]

It also makes sense as to why Southerners could more or less be re-assumed into the United States’ political fabric-the only real difference between the Confederacy and the antebellum federal government (as Southerners saw it) was an even bigger and explicit purpose on preserving and expanding the institution of slavery. Once slavery was dead, they could more or less return to using the federal government to secure their own interests-see the compromise of 1876, among a whole slew of other actions…

[@MadnerKami]

@@warlordofbritannia Yup. Ultimately it wasn't about slavery, but plain and cold economic interests. Looks familiar, doesn't it? It's almost as if they could move right on on as if nothing had happened...

[@warlordofbritannia]

@@MadnerKami I can’t tell if this comment is supposed to be ironic or not

[@Baelor-Breakspear]

@@warlordofbritannia me neither

[@sid-g2l]

I was watching The Birth of a Nation for school on 1.5 speed on KZbin because I really can't handle that shit on normal speed and I forogt to turn it back to normal and your Confederate character just started spitting random excuses at me at lightning speed and I'm so sleep deprived I thought I was gonna cry man. Great video.

[@priestofronaldalt]

RTX Morshu beatbox jumpscare

[@GoErikTheRed]

Is no one else gonna mention the cinematography of the end credits scene? Everything from the lighting to the choice of closeups to the acting was superb. When the guy sat up at the end I had actual chills. A+, I’m stoked to see what this means for 50’s man

[@justinlindfors8512]

I noticed the chess board

[@jacklennon1035]

he's a legitimately trained filmaker

[@bonniea8189]

@@justinlindfors8512 Apparently I need to re-watch it now

[@GrayCatbird1]

I’m a big fan of how these two are progressively becoming more brotherly to each other and Johnny Reb in particular becoming a lot more receptive and listening in good faith. Truly a more perfect union :)

[@kattastic9999]

Eventually they'll fuse together and become a sad man with regrets but hope for the future

[@thesurvivalist1996]

If only klaus could do the same...

[@cristoaldantes3222]

The man would be the United States back in one piece.

[@kattastic9999]

@@cristoaldantes3222 Like I said, a sad man with regrets.

[@devinsnightmare1506]

"both sides"

[@adrienlastname4663]

How did no one notice that literally everything Jackson said sounded like a villain speech.

[@onbearfeet]

It even sounded like Atun-Shei was doing a bit of a Charlton Heston impression. Heston played Jackson in "The Buccaneer" in the 50s, and the portrayal was influential for a while. Layering on any audience memories of Heston's own politics (for reference, look up his history with the NRA) makes for a solid villain performance.

[@autobotstarscream765]

Hot on the heels of the success of the hit musical Hamilton, behold the Jackson musical! kzbin.info/www/bejne/bYOXlnyIj7SForc

[@tymera]

STRAIGHT UP AND THIS DUDE IS JUST ON YOUR MONEY. MY GODDAMN MONEY

[@HortonSalm]

2:55 "Liberty loving Southerners" Johnny, you own people.

[@MollymaukT]

The North didn’t always fight to end slavery. But the South always fought to keep it

[@joedatius]

pretty much the best way to put it. Neo-confederates will never understand that this isn't a game of who's side is better, even though the answer is very clear. its a case of a group of white supremacist traitors who were trying to make a autocracy based around how much they love having slaves.

[@theredpriest]

Yes. And why is that? Because their entire economy depended on it. Agriculture was the way of the South. That was its industry. The North had already shifted due to the Industrial Revolution. A big difference in the use/need for slaves.

[@joedatius]

@@theredpriest except they never needed slaves. countless economies including to this day are and is depended upon agriculture and there has never been a point where slavery was needed. the south and USA as a whole never needed slavery, they chose slavery due to greed AND most importantly white supremacy goals that where infused to keep those systems and to further white supremacism ideals. do you want to know what happened to agriculture after slavery? it didn't stop nor did the economies depending on it ever stop needed to be depended on it. your entire argument is flawed in every degree and you're for some reason trying to justify slavery which was never something that the south needed, it was propagated by large plantations who forced its states into war for the sake of greed. the money of which only kept southern states poor and all the wealth in the hands of pentation owners while even white small farmers suffered.

[@thunderbird1921]

@@joedatius That's the thing. Couldn't Irish and German immigrants (two biggest incoming groups at the time) picked the cotton and other stuff, along with US citizens? I've long seen slavery as the plantation owners not wanting to pay fair wages (just like the corporations who put their factories in the sweatshops of Communist China).

[@joedatius]

@@thunderbird1921 pretty much, not only this but slavery was only economically viable for the south because of laws set by southern politicians who were more often then not influenced by plantation owners or where from plantation families themselves. who knowingly created a situation where the South was forced into being a slave run economy due to plantation greed. its why so many of the souths generals and politicians where from plantation families

[@TheDenimdoug]

The closing authoritarian quotes provided me with a profound sense of dread. Well done as always sir, you have both educated and entertained. While I hope this is not the end of the series, you will certainly be going out on a high note if it is.

[@petermartinez4399]

To my knowledge there will be 2 more episodes

[@historiansayori2089]

Yeah, half of that shit sounded like something that the Dominion of Draka would say en.m.wikipedia.org/wiki/The_Domination

[@gratuitouslurking8610]

Referencing Palpatine was a great primer for the batshittery to come, yes.

[@fumarc4501]

I was also terrified.

[@shironerisilk]

As a Brazilian I didn't think the confederate escapades to Brazil would make it into the series but it did in the most iconic way possible. The whole story city of Americana, in the State of São Paulo, is something straight out of a fever dream. There's a joke among Brazilians that in every American movie the villain wants to retire/hide in Brazil but with the whole Nazi thing afterwards, it has a bit of truth to it lol

[@i8764theKevassitant]

I had no idea they did that. South America's like a racist haven or something. But I suppose the progressive ideologies were slow to reach the southern most countries.

[@shironerisilk]

@@i8764theKevassitant Thankfully, it didn't work as well as they liked. But concerning ideologies, it's more complex than ''tricking down'' from the North. Brazil, for example, was never strictly opposed to miscegenation (unlike the US) until the 20th century when the elites adopted eugenics from Europe (which doesn't mean there wasn't other forms of racism though). Britain indeed lobbied Brazil to end the slave trade, but not out of some kind of progressive principle (at least not totally), but because they wanted a bigger consumer market to export industrialized goods to Brazil (enslaved people don't buy products), while at the same time, sabotaging quite literally any Brazilian attempt of national industrialization.

[@i8764theKevassitant]

@@shironerisilk yeah I was just making a broad assumption. There's been so many regime changes with different backers throughout modern SA history that the problems and their sources are too numerous to list in a YT comment

[@shironerisilk]

@@i8764theKevassitant Yep! Unfortunately, you're totally right :/

[@coala2001]

Yo, Americana é literalmente uma colônia confederada e eles fazem a Festa Confederada todo ano kkkkkkkkkkk

[@JoeJohnston-taskboy]

know what’s sad? this is a far more civil political discussion than what happens on the Internet and in person.

[@Moonlitwatersofaqua]

Well it is scripted.

[@fulcrum2951]

Are the comments he used as arguments scripted tho?​@@Moonlitwatersofaqua

[@heyyou322]

@@fulcrum2951no what he means is that if someone already has an ideal about something then it’s next to impossible to change that ideal. If hypothetically a small set of people actually believe that the moon was made of cheese, even if you literally flew them to the moon and showed that it was a rock they would say otherwise

[@alexross1816]

I find it interesting how so many Southerners I know lionize Andrew Jackson, even though his entire legacy is strengthening the power of the Executive Branch, and how he was arguably one of the most Authoritarian Presidents we've ever had.

[@Mr.wednesdayallfather]

Man I don't know if you know this but Andrew Jackson had a bullet near his heart from when he was young and full of piss and vinegar and more than likely some of that old Tennessee goofy juice

[@Justanotherconsumer]

As the show discusses, the “libertarianism” of the South is often quite selective. Authoritarianism is fine as long as it does the right things.

[@thesenuts603]

besides Joe biden

[@quronmccovery881]

@@thesenuts603 Nice reach! Try again, you might get to the stars.

[@ComedicLetter]

@@quronmccovery881 man’s gone way past the stars with that one

[@LadyTylerBioRodriguez]

Wow, the political makeup of the Confederacy was an absolute cluster fucking mess in ways I didn't even know. I knew it was top heavy class wise but the fact it was verging on autocratic monarchy is absolute madness. Great video, PS Johnny Reb is going through a beautiful arc and I wish him well.

[@jtgd]

@Russian Waifu bad bot!

[@LordCantinflas]

@Russian Waifu bot go away OK, it's gone now.

[@rothnirtull4254]

I think the bots gone, but another dub for the boys

[@daleludtke7803]

I have always found it pretty humorous that the South was pretty much the closest we ever had to a legitimized aristocracy.

[@LadyTylerBioRodriguez]

@@daleludtke7803 Yeah that needs to be mentioned a lot more. The Confederate States of America had little usage for democracy.

[@thexalon]

A bit about the "tree-hugging Quakers" line: There's an argument to be made that American abolitionism started with 1 person, a fellow named John Woolman, who spent a lot of his life (in the early 1700's) traipsing around the Quaker communities of New England convincing them to stop trading in and owning slaves. His diary is very influential among Quakers today. Woolman's home is now a retreat center, in Deerfield MA.

[@fuzzyhair321]

Jeez that man had a mission and saw it through. That's amazing actually

[@thexalon]

@@fuzzyhair321 I find it a truly inspiring story, the power of 1 person with an important idea and the courage and spare time to do something with it.

[@1000g2g3g4g800999]

I think attributing the movement's origins to one person is a bit of a mistake.

[@ImYouriEntertainment]

I recently got my hands on a copy of Woolman’s journal and I’ve been eager to start reading it. He sounds like an extremely humane person.

[@MM-qi5mk]

Bushrod Johnson. A confederate general who was Quaker and along with his dad were abolitionist

[@OfficialUKGov]

“State’s rights to do what?” -Doobus Goobus

[@jeffreygao3956]

Use slave labor for profit….this is gonna suck.

[@Blacksmith__]

I think Confederate dreams of empire, autocracy, theocracy, etc. deserve their own video! Really interesting subject

[@Turnil321]

see alternate history channel. They have a video about that.

[@In90minutesPodcast]

We need to revisit the Spanish American war and the colonization of the US territories primarily by southern politicians. Many who served in the CSA, or had a parent or grandparent who did. Put a racist in charge of people of color outside the continental US. Let’s see what happens!

[@plasmicats2000]

@@In90minutesPodcast Death

[@helwrecht1637]

I support this whole heartedly.

[@colinfinkel7587]

Earthquakes though . . .

[@impcec6734]

I really love these videos! To think: a man cloned himself, raised the clone to believe he was a soldier in the confederate army, and taught him to only speak in KZbin comments! All to make these lovely videos for us! That’s commitment. Edit: I was very high when I wrote this comment

[@tbotalpha8133]

I want some of whatever you had, please.

[@devindalton4688]

Strain, please

[@ablunt-headedtreesnake6094]

The edit really makes this comment

[@OpalBLeigh]

Is that what all the lost causes are? Just like, one clone with lots of alts? That actually makes me feel better lol

[@hand13932]

dude this is so me when I smoke a weed and there’s purple dragons bro

[@HistorywithCy]

YEEESSSSSSSSSS! I've been waiting for nearly a year for this...my life is on hold for the next hour... with the exception of watching this video and eating popcorn.

[@tonyjoestar2632]

I like that Johnny Reb acknowledges that slavery is terrible, he just wants us to understand that his cause was about more than the horrible practice of slavery. I mean it wasn't but

[@dominicguye8058]

Well that's the position of modern Lost Cause advocates

[@vehx9316]

​@@dominicguye8058 Their position changes according to the time, 40 years ago you did still hear about the "happy slave" bullshite.

[@tonyjoestar2632]

​@@dominicguye8058if only most lost causes were as polite as Johnny

[@misedout12]

Currently in VA and I can confirm that the state has reverted into a Mad Max-esque post-apocalyptic landscape... with great internet access. So not all bad 😁

[@Rob0Penguin]

I'm sadden NOVA was wiped out, they were a good tax base. I'm confused on how Charlottesville survived though.

[@melxdiq_mxth8993]

@@Rob0Penguin I had moved right before NOVA was tanked, i still have family and friends that live there obviously, but it always feels so different and weird going back, like ten years have passed instead of like 2, and somehow i've tripped into an alternate virginia

[@iamnadexey]

I feel like most of non-city VA has kinda been frozen in time since the 90s. The most that's changed in my area is... well... the internet access. Never liked the city or lived close to any, but boy do I get jealous of it sometimes.

[@alicia1463]

When I lived in southwest VA, it seemed like a mix of traditional rural southerners and old hippies. Lots of yarn/quilting shops. The college town that I was living in had changed since the 90s, but the rest of it? Probably not.

[@thesneakymemedealer5071]

i like how people argue that the confederacy was about states rights inspite of the fact that it's very own constitution forbid states from banning slavery and also had no way to allow states to ceased from it.

[@nicholasgonyea3833]

Agreed, or how Longstreet himself stated the rebellion was about slavery and nothing else.

[@bellacose3837]

Or how they trampled on the North's rights when it came to fugitive slave laws

[@pyromania1018]

@@nicholasgonyea3833 He freely admitted that after the war. Then again, he might not have had the LC not made him a scapegoat for all of Lee's mistakes.

[@anoon-]

Good ol west Virginia didn't give a shit.

[@forickgrimaldus8301]

Palpatine: Ironic

[@wildfire9280]

“When you’re accustomed to privilege, equality feels like oppression.” Someone should tell George Troup that.

[@Blox117]

someone should tell all women that

[@scatered1]

When you start hearing people use the word "Equity" throw those people off a bridge, into a river and run far away.

[@wildfire9280]

@@Blox117 whatever you’re smoking, I want in

[@brano13177]

@@Blox117 Imagine thinking that it's the women that were the ones with "privilege" while also trying to curtail womens rights. Seems that thou dost engage in projection

[@Blox117]

oop, i seem to have triggered some salty snowflake people

[@HeavyTF2real]

As a leftist, you being asked if you were an anarcho-syndicalist was fucking hilarious to me. People forget what is and isn’t jargon outside of leftist circles

[@AshanBhatoa]

An easy gateway into alienating folks from leftism, also.

[@tellanov]

ikr I wasn't really paying attention at the start and then out of nowhere I hear a term that I know has nothing to do with the video

[@ModernEphemera]

They definitely got it from the peasant in Monty Python’s Holy Grail

[@isengarde9490]

@@ModernEphemera "Help Help! I'm being repressed!"

[@fatcontrollerproductions9910]

You Leftist litteraly support wars all over the wrld, dont even talk about being the good guys.

[@RunningWithRoses]

I would love to see this format carried out between a revolutionary and a redcoat, and used to address the many growing misconceptions of the Revolution; like the myth that it was primarily fought to preserve slavery or that the colonists started the 7 years war completely without consent or knowledge from mainland Britain. A lot of interesting myths on the british side of things.

[@dclark142002]

Yes please.

[@jeffreygao3956]

Plus Washington was far from a great general and got nicknamed Old Muttonhead for a reason.

[@RunningWithRoses]

@@jeffreygao3956 I mean, he was a great general in that he could recognize sound advice when he heard it. A surprising trait lacking from most generals.

[@Adamdidit]

@@jeffreygao3956 He wasnt a great tactician. A great General is another thing entirely. Which he was. Spying, logistics, and the unsung art of knowing how to keep an army together. The man could lose a battle on the field and end up in superior position. There are other examples but I don't want to belabor the point.

[@yrobtsvt]

If you're interested in this kind of thing check out William Hogeland's books

[@noisyrhysling]

I don't know which is more impressive... The fact that he was able to find all those recordings of so many old speeches or that the current President of the United States was willing to be on his show!

[@rockicwifffyre]

Ikr!!!!!! I am very surprised he found a LIVING BREATHING confederate and yabkee who wants to be in his show!!!

[@EmperorTigerstar]

Oh heck yeah let's gooooo

[@ungusbungus2486]

For such a well known channel in the history scene you are surprisingly far down.

[@Tigershark_3082]

@@ungusbungus2486 Probably because it's such a new comment

[@Crimethoughtfull]

I grew up a real nerd--had one of those booklets with the Constitution, Declaration, AND the flag code! So, years ago, I looked up the Confederate Constitution...it was basically a copypasta of the US Constitution--EXCEPT--the addition of slaves now and forever in every new state always. Not only did the Confederate Constitution not increase states' rights generally (at ALL), but it explicitly said "you HAVE to be a slave state!" Their own Constitution proves that the ONLY "state's right" they cared about was slavery.

[@gamesandstuff7966]

Absolutely insane to me that this series managed to find its way to the one guy who both believes the Lost Cause myth and also knows enough about the left to know what an Anarcho Syndicalist is

[@nemoy7267]

As someone who's a hair's breadth away from being an Anarcho-Syndicalist, I can't describe the immense confusion and joy that moment gave me.

[@connorcharette7132]

He could just play Kaiserreich.

[@jerkjerkington3874]

That's not that surprising. I've met plenty of people who swap sides between far left and far right. Usually they're just out-of-touch goofballs who don't know anything about the real world, so they adopt extreme positions that seem like they make sense in theory. Left and right are just the flavor du jour for them.

[@disappointedmess209]

@@connorcharette7132 a hoi4 player being a lost causer seem more likely

[@Frostyman452]

@@disappointedmess209 As a guy who plays HOI4 most players are wehraboos or tankies, wouldn’t surprise me if there are lost causers who play the game. Mostly because you can declare the Confederate States of America if you turn Fascist as the US.

[@Nomadic_Radec]

"Are you an anarcho-syndicalist?" Made me laugh way too much.

[@LeRoiEnJaune]

As an anarcho-syndicalist, me too! (Well, belong to a group of 'em, anyway)

[@Unidentified_Entity6]

mf played too much Kaiserreich

[@luisfilipe2023]

@@LeRoiEnJaune I hope you’re joking 😂

[@antiantiderivative]

@@luisfilipe2023 Far better than being a confederate simp.

[@filiperosa7496]

Anarcho syndicalism is a ideology so valid as anarchism, a niche ideology who don't do anything

[@lim4275]

This was so good that watched it sitting on my bed wrapped in a towel. I got out of the shower and saw the notification, so I clicked on it, thinking I would watch a couple minutes. I just kept thinking, “OK, maybe just a couple more minutes….” Here I am almost an hour later still in a towel - I was completely captivated. Thank you.

[@warlordofbritannia]

Relatable-I was on the toilet, now both feet are numb 😂

[@lim4275]

@@warlordofbritannia Oh, that’s hilarious!

[@catcatcatcatcatcatcatcatcatca]

This is an incredible piece of cinema. The socratic dialogue flows so smoothly it’s easy to watch. The humour is great, and both characters are enjoyable despite one being a southern apologist and the other delivering very long and detailed historical commentary. Neither of those are what I would describe as pleasing character traits. And the last scene was the true icing on the cake. The camerawork, lighting and sound design build such an atmosphere it made the absurd concept feel real and serious. Both roles were acted well, even if I can’t comment on the accents. The dialogue managed to communicate the batshit insane narrative perfectly smoothly.

[@PWNDotcom3299]

Thanks for making Checkmate, Lincolnites, Atun-Shei. I took a mass media course this past semester, and my final paper covered this series and why it's amazing. Got a 90% on it.

[@dmman33]

NICE!!!!!!

[@nikblask6300]

I was super excited to see this new episode, and then I ascended to the next plain of joy when I saw how long it was

[@thegrenb2756]

Facts

[@Xpwnxage]

I know how you feel

[@philipmarsh2172]

Likewise 😍

[@StormCrownSr]

"I'm sure they offered plenty of thoughts and prayers." Credit where credit is due, that was funny.

[@dominicguye8058]

It was very clever

[@leoxgamer1342]

I think human rights is a bigger issue than states rights

[@QuantemDeconstructor]

congratulations, you're on the winning side of this issue

[@user-rg7uz8of9r]

rhymes with "bigger rights"

[@doctahjonez]

@@QuantemDeconstructor As they should be.

[@achair7265]

You can replace states rights with federal rights it will still make sense.

[@danaroth598]

Speaking of the Fugitive Slave Law(s) and also a small nullification crisis: one of my favorite, sadly obscure pieces of Wisconsin history is a case called Ableman v. Booth, which stemmed from an incident where a mob of abolitionists broke an escaped slave out of jail and sprinted him to Canada. The feds wanted to punish one of the abolitionists, and Wisconsin's Supreme Court essentially told the federal government to suck it, the abolitionist could be released. (And also that Wisconsin held the Fugitive Slave Law unconstitutional and refused to enforce it.) SCOTUS told them 'you can't do that' in the Ableman case ... and Wisconsin responded by refusing to file the decision when it reached them. We still haven't!

[@TheStapleGunKid]

Oh that's just one of many conflicts over slavery that happened in the 1850s before the Civil War. Have you heard of the Christiana riot in Pennsylvania.

[@patrickcleburneuczjsxpmp9558]

It's completely twisting the historical definition of "nullification" to apply the word to attempts to nullify provisions of the constitution itself as opposed to nullifying acts of the federal government that lack constitutional authority.

[@Justanotherconsumer]

@@patrickcleburneuczjsxpmp9558 it’s not really that different. As far as the state is concerned, in both cases, they are refusing to obey what they see as a federal overreach. The tariffs of classic nullification were explicitly involving foreign trade - the exclusive domain of the federal government. They were far more legitimate as an act of federal authority than the fugitive slave acts anyway.

[@setlerking]

Gigachad Wisconsin

[@willw5868]

Based Wisconsin moment

[@1977Yakko]

I couldn't help but smile when he pulled out the handy pocket Constitution. I've had to do the same during family "discussions" (arguments) about politics and social issues.

[@adulescentuluscarnifex8412]

You sound awful at dinner parties

[@wildfire9280]

@@adulescentuluscarnifex8412 but great at debates!

[@planescaped]

@@adulescentuluscarnifex8412 Everyone knows the most appealing charismatic person is the one who sits there silently staring at their navel thinking about going home and playing more GTA Online with no thoughtful or provoking insight on any issues that might offend someone else's delicate, and fragile sensibilities.

[@Saje3D]

@@adulescentuluscarnifex8412 Thank you for illustrating my point about reasoning with the unreasonable.

[@adulescentuluscarnifex8412]

@@planescaped you sound equally miserable to interact with as well

[@trumpeterjen]

Can't really fault Johnny Reb for barely remembering the events of episode 1. Billy Yank did shoot and kill him at the end, after all.

[@hithedragon7842]

Maybe it really was some other confederate officer

[@ntpgmr]

@@hithedragon7842 Nah, same person. However, in the lore, the maker of Atun-Shei films is the one who shoots him in the first video, while Billy Yank shows up next episode.

[@Jrome719]

Just discovering this channel. Good stuff! I love the neutrality and objectivity, especially as a Black pastor, theologian, and church historian. As we would say in our neck of the woods, you call a “spade a spade.”

[@armphidiic2609]

I laughed out loud at several points but most at: "I would have been an abolitionist back then." "Shut up."

[@waroftherebellion.]

My grandfather told my mother he would have been a nice slave master to his slaves. So that type of rhetoric makes sense.

[@catnerdadrian7601]

@@waroftherebellion. pretty sure a "nice slave master" wouldn't be a slave master. Cuz it's kinda hard to be nice while denying people their rights

[@elmascapo6588]

@@catnerdadrian7601 well, for one you could not whip (that's how you write it, right?) them nor burn their backs with hot irok to mark them as your property, in the same way that you would a cow

[@waroftherebellion.]

@@catnerdadrian7601 No one said he was smart and I don't talk to him.

[@Qba86]

@@catnerdadrian7601 Perhaps someone who was given a slave as a gift from a family member, waited for a while, so as not to offend said family member, and then freed the slave would qualify as "nice". Grant was that kind of guy. Hard to think of any other example of a "nice slave master" that wouldn't be an oxymoron.

[@angelachouinard4581]

I adore Johnny Reb's facial expressions, you can tell he's really thinking on what's said. Even if he still doesn't agree, he's listening. Wish more were like him

[@MGTOWPaladin]

Lincoln's Presidential Proclamation NO. 81, April 19, 1861, just five days after the evacuation of Ft Sumter. (Edited version) "Whereas an insurrection against the Government of the United States has broken out -in the States of South Carolina, Georgia, Alabama, Florida, Mississippi, Louisiana, and Texas, and the laws of the United States- for the *COLLECTION OF THE REVENUE (TAX MONEY)* can not be effectually executed therein comformably to that provision of the Constitution which requires *DUTIES (REVENUE TAX MONEY)* to be uniform throughout the United States:... *NOTE:* President Abraham Lincoln blames the "insurrection" on the collection of REVENUE TAX MONEY. Not on States Rights, politics, slavery or any other reason. In none of these documents does the Union Executive or Legislature refer to the secession of States as unconstitutional or illegal! Lincoln KNOWS that secession IS A RIGHT but because of REVENUE TAX MONEY, he refuses to allow the South to secede peacefully. Lincoln's Presidential Proclamation NO. 82, April 27 1861, a week after the previous Proclamation as more States seceded from the Union. "Whereas for the reasons assigned in my Proclamation of the 19th instance., a blockade of the ports of the States of South Carolina, Georgia, Florida, Alabama, Louisiana, Mississippi and Texas, was ordered to be established, and whereas, since that date, public property of the United States has been seized, *THE COLLECTION OF THE REVENUE (TAX MONEY) OBSTRUCTED,* and duly commissioned officers of the United States, while engaged in executing the orders of their superiors have been arrested and held in custody as prisoners, or have been impeded in the discharge of their official duties, without due legal process, by persons claiming to act under authority of the States of Virginia and North Carolina. An efficient blockade of the ports of those States will therefore also be established. In witness whereof I have hereunto set my hand, and caused the seal of the United States to be affixed. Done at the city of Washington, this 27th day of April, A.D. 1861, and of the Independence of the United States the eighty-fifth." ABRAHAM LINCOLN, By the President: WILLIAM H. SEWARD, Secretary of State. Crittenden-Johnson Resolution issued by the US House of Representatives, 25 July, 1861 four days after the defeat of the invading US Army at Manassas, VA (Bull Run). "Resolved by the House of Representatives of the Congress of the United States, That the present deplorable _civil war_ has been _forced_ upon the country by the _disunionists_ of the Southern States now _in revolt_ against the constitutional Government and in arms around the capital; that in this _national emergency_ Congress, banishing all feelings of mere passion or resentment, *WILL RECOLLECT **_ONLY_** ITS DUTY (REVENUE TAX MONEY) TO THE WHOLE COUNTRY;* that this war is not waged upon our part in any spirit of oppression, nor for any purpose of conquest or subjugation, nor purpose of overthrowing or interfering with the rights or established _INSTITUTIONS_of those States, but to defend and maintain the supremacy of the Constitution and to _*_PRESERVE THE UNION (TREASURY),_*_ with all the dignity, equality, and rights of the several States unimpaired; _*_and that as soon as these _objects are accomplished_** the war ought to cease.*

[@kieranhurst8543]

The fact that he is becoming more receptive betrays the fiction here. In real life, these talks would just drive him further and further into believing lost cause bs. It is because these people are empowered to think that if someone is telling them they are wrong, they are actually right

[@angelachouinard4581]

@@kieranhurst8543 Yeah, that happens a lot. But once in a blue moon someone sees the light.

[@aislandofseaweed5231]

@@MGTOWPaladin Again, meaningless spam that doesn't even pertain to the actual comment, which is a joke unrelated to the actual subject matter. It's like if a conservative randomly was walking the streets, occasionally walking over to pedestrians to scream in their faces about how abortion is wrong.

[@MGTOWPaladin]

@@aislandofseaweed5231 PROVE ME WRONG! YOU CAN'T BECAUSE IT'S THR TRUTH!

[@coolguy8829]

Is it just me or does Johnny Rebel get smarter each episode?

[@ladnie9454]

My guess is that the series is going to end with him deciding that Billy Yank is correct.

[@kfizz21]

@@ladnie9454 to be fair, this is likely the end of the series, and he kind of did.

[@historymarshal2704]

@@kfizz21 No. Atun-Shei said there will be ten episodes total. This is eight. We are definitly building up to the series finale, but are not there yet.

[@_somerandomguyontheinternet_]

I’m honestly glad that he was presented as being kinda horrified by the revelations as the sanitized revisionist history is peeled back to reveal the truth.

[@akramgimmini8165]

*Impossible*

[@HatiHro]

Remember always hit the traitor losers with "State's right to do what"

[@alexandarvoncarsteinzarovi3723]

The state rights, own, sell, abuse and educate the black Africans as obligatory laborers for life on the counts of being born black! - its a joke

[@MinorityRespecter88]

Secede

[@KorenJoy]

​@@MinorityRespecter88secede... for what?

[@MinorityRespecter88]

@@KorenJoy independence

[@scotthuffman3462]

@@MinorityRespecter88 What was the first thing they were gunna do with that independence? Oh right the leader of the confederacy literally said they were gunna use it for slavery

[@RememberTheDead]

As a Brazilian I am always amazed to see a reference to the Confederate runaways in southern Brazil. One of many dark marks in our history and also one of its most unknown.

[@rogerkeleshian2215]

I am also Brazilian, I hope he covers our history sometime hopefully my ancestor Floriano Pexioto the Iron Marshall.

[@RememberTheDead]

@@rogerkeleshian2215 I'd like that as well. Peixoto was a monster, but an interesting monster.

[@renatopba]

I love this webseries and was glad and surprised Campinas and São Paulo being mentioned. Confederates who fled to Brasil founded Americana City at that State, the richer in our country.

[@renatopba]

@Kraus von Grat Emperor Dom Pedro did gave shelter for those fled confederates. He was also an admirer of Lincoln and went to the US duriing Grant's presidency.

[@alnu8355]

Oh I heard of those guys. "Confederados". After the war, Confederates were invited to build and create farms in Brazil. Problem was the climate and ecology in Brazil was not suited to grow their crops. Anyway a lot of their descendants now get together once per year dressed as Confederate officers with antebellum era music, dancing, and food.

[@beefcakepantiehoes]

Imagine that, confederate rebels being fascist authoritarians all along. Really unexpected 😂

[@SaraphDarklaw]

Who woulda thunk.

[@DrTssha]

I didn't see it coming, but I'm not exactly shocked at the revelation. Who knew those who advanced notions of southern nobility were in favour of authoritarianism the whole time? I mean, it's right there in the words southern nobility! Kinda obvious in hindsight...

[@MohamedRamadan-qi4hl]

You don't even have a definition of facisism. It means to you dictatorship and authoritarian. Stop projecting that ill defined term were it doesn't belong

[@Grizabeebles]

It's almost like believing that one group of people is innately superior to another is bad for society.

[@Grizabeebles]

@@FlaviusConstantinus306 -- A society of rich slave-owners wanting to turn as much of the world into slaves as possible doesn't require any leaps of logic. If they truly believed their social order was the best in the world and effectively undefeatable, then the idea that every society would come to be like theirs in time was perfectly rational. See the 1989 essay "the End of History" by Francis Fukuyama for a relatively contemporary example.

[@tripledigit4835]

Arun Shei, if there are more quotes about confederate autocracy, theocracy and monarchy, I’d love if you’d list them somewhere. Seeing prominent confederates rejecting democracy and republicanism in favour of authoritarianism is scary and interesting. I’d love to see more quotes from other prominent confederates particularly J.Davis and S.Jackson since they’re the more well known ones

[@dynamicworlds1]

I highly recommend Innuendo Studios "Origins of Conservatism" video. To;dw is the thing "Conservatism" was _designed_ to preserve from day 1 is feudal heirarchies. It's neofeudalism replacing the "divine right of kings" with worship of the "free market" to preserve the old institutions after their old excuses stopped being persuasive.

[@JacobOConnorOH]

Do you want Virginia to blow up again?

[@alun7006]

Some very clear parallels with current events.

[@dynamicworlds1]

@@alun7006 the only significant new idea they've come up with in centuries is fascism. It's largely the same playbook they've been using for _thousands_ of years.

[@alun7006]

@@dynamicworlds1 true enough. I was thinking particularly of the noises coming out of parts of the American right very recently.

[@JoeyYoungg]

Never ask: A man his salary A woman her weight A confederate what they wanted to use those rights for

[@coffeemaiden7915]

Wow it’s been 3 years already? so… if there’s another installment of the series in the next year, that means Checkmate Lincolnites would have lasted more than the confederacy?

[@1krani]

Now I gotta believe that Lee losing those cigars with his battle plans around them was, in fact, the doing of Thomas Jefferson's ghost. He heard that theocratic quote when it was originally spoken in 1861 and said, "In a pig's eye," before sitting up in his grave and waiting to strike.

[@TheBrunohusker]

And who knows, maybe Jefferson’s ghost realizes the errors of his ways. Granted it’s funny how states rights for many was just a utilitarian motive. I’m kind of reminded of modern libertarians. Yes, some are actually principled and practice what they preach, but much like these southerners wanting a theocratic empire, a lot of libertarians just want to be able to do what they want but stop others from infringing on that and will gladly throw out Liberty when others they don’t like get it.

[@1krani]

@@TheBrunohusker Don't know what kind of libertarians you've been watching or hanging out with, but the vast majority of the ones I can think of basically want 3 things: 1) Less activism in the criminal justice system, especially with regard to judges and prosecutors. 2) Less government interference in the economy, especially on a federal level. 3) Less unelected, unaccountable bureaucracy in what government is left after the first two are addressed. "No step on snek" doesn't just apply to the state when it's evoked, you know?

[@janefkrbtt]

@@1krani 1. Define "activism" in that context 2. Regulations keep lead out of paint and asbestos out of houses 3. Agree

[@1krani]

@@janefkrbtt 1. Putting one's own personal beliefs above interpretation of the law as defined by the Constitution. We saw this in the Bill Cosby conviction before the Pennsylvania Supreme Court not only overturned it, but barred Cosby from ever again being prosecuted on any of the testimonies given. That trial was the very definition of a kangaroo court. We also saw it in the recently recalled San Francisco DA who flat out refused to prosecute people caught for committing crimes, not because he lacked evidence to convict (as the Philly PA did when Cosby's case was dropped on his desk in 2005), but because he ideologically believed things like larceny or assault were not crimes. Funny about that, given that both his parents were sent to the klink for murdering cops during a bank robbery in the 1980s. 2. They also stop little girls from operating lemonade stands without a business license. No, really, that actually happened in Richmond, VA. I think it speaks volumes of how twisted the thinking on economics has become that I say "interference" and you interpret that to mean "regulation". Regulation is setting rules of what you can or can't do. Interference is setting rules for what you MUST do, with no alternatives allowed.

[@janefkrbtt]

@@1krani if a law is bad it shouldn't have to be followed Sorry to the little girl that pissed off the wrong cop too read up on his technicalities. But regulations is telling people how to operate. And that must be the norm. Else cut corners kill people.

[@njb1126]

Saying “states rights” reminds me of a quote by lee Atwater. They go from talking about slavery to how slavery impacts the economy and pretty soon you’re no longer talking about slavery but the end result is just the same- the oppression if not outright enslavement of another group.

[@thedapperdolphin1590]

Specifically, he talked about how people in his ideology could just use the N word in the 50’s/60’s and be explicitly racist, but that became unpopular. So they started gutting social programs and implementing discriminatory laws. These policies were meant to hurt black people, but successfully reframed the narrative around states rights and lowering taxes rather than racist policies. This was all in an infamous 1981 interview by Atwater where he very explicitly laid out what is still the Republican approach to disenfranchising black people

[@samuelskinner7704]

@@thedapperdolphin1590 Bill Clinton got the South in 1992 so the Republican program appears to have no worked over a period of 40 years. Maybe White southerners really, really, really, really, really, really hate Lincoln?

[@jinkies1649]

@@thedapperdolphin1590 this is what a good amount of people fail to realize. Discrimination hasn’t gone away, it’s just changed it’s medium. I’ve found it easy to explain it using this metaphor: When a bully gets in trouble for beating you up they wont stop bullying you. They’ll just find 100 other ways to harass you. Stealing your stuff, calling you names, playing pranks on you, etc. That’s the same thing racists have done, they’ve just changed how they oppress people.

[@MGTOWPaladin]

Lincoln's Presidential Proclamation NO. 81, April 19, 1861, just five days after the evacuation of Ft Sumter. (Edited version) "Whereas an insurrection against the Government of the United States has broken out -in the States of South Carolina, Georgia, Alabama, Florida, Mississippi, Louisiana, and Texas, and the laws of the United States- for the *COLLECTION OF THE REVENUE (TAX MONEY)* can not be effectually executed therein comformably to that provision of the Constitution which requires *DUTIES (REVENUE TAX MONEY)* to be uniform throughout the United States:... *NOTE:* President Abraham Lincoln blames the "insurrection" on the collection of REVENUE TAX MONEY. Not on States Rights, politics, slavery or any other reason. In none of these documents does the Union Executive or Legislature refer to the secession of States as unconstitutional or illegal! Lincoln KNOWS that secession IS A RIGHT but because of REVENUE TAX MONEY, he refuses to allow the South to secede peacefully. Lincoln's Presidential Proclamation NO. 82, April 27 1861, a week after the previous Proclamation as more States seceded from the Union. "Whereas for the reasons assigned in my Proclamation of the 19th instance., a blockade of the ports of the States of South Carolina, Georgia, Florida, Alabama, Louisiana, Mississippi and Texas, was ordered to be established, and whereas, since that date, public property of the United States has been seized, *THE COLLECTION OF THE REVENUE (TAX MONEY) OBSTRUCTED,* and duly commissioned officers of the United States, while engaged in executing the orders of their superiors have been arrested and held in custody as prisoners, or have been impeded in the discharge of their official duties, without due legal process, by persons claiming to act under authority of the States of Virginia and North Carolina. An efficient blockade of the ports of those States will therefore also be established. In witness whereof I have hereunto set my hand, and caused the seal of the United States to be affixed. Done at the city of Washington, this 27th day of April, A.D. 1861, and of the Independence of the United States the eighty-fifth." ABRAHAM LINCOLN, By the President: WILLIAM H. SEWARD, Secretary of State. Crittenden-Johnson Resolution issued by the US House of Representatives, 25 July, 1861 four days after the defeat of the invading US Army at Manassas, VA (Bull Run). "Resolved by the House of Representatives of the Congress of the United States, That the present deplorable _civil war_ has been _forced_ upon the country by the _disunionists_ of the Southern States now _in revolt_ against the constitutional Government and in arms around the capital; that in this _national emergency_ Congress, banishing all feelings of mere passion or resentment, *WILL RECOLLECT **_ONLY_** ITS DUTY (REVENUE TAX MONEY) TO THE WHOLE COUNTRY;* that this war is not waged upon our part in any spirit of oppression, nor for any purpose of conquest or subjugation, nor purpose of overthrowing or interfering with the rights or established _INSTITUTIONS_of those States, but to defend and maintain the supremacy of the Constitution and to _*_PRESERVE THE UNION (TREASURY),_*_ with all the dignity, equality, and rights of the several States unimpaired; _*_and that as soon as these _objects are accomplished_** the war ought to cease.*

[@Weebusaurus]

@@MGTOWPaladin are you actually completely illiterate? he's saying "because these states are in rebellion, we can't collect taxes from them right now" not giving a reason for their secession

[@paulmryglod4802]

It was absolutely about states rights. Their right to use people as farm equipment.

[@patrickcleburneuczjsxpmp9558]

As if Republicans led the North to war to deny the slave states that right??? Nice myth if you want to try to justify denying self-determination to other people.

[@garlonschuman1014]

@@patrickcleburneuczjsxpmp9558you must be an idiot to even bring up self-determination in this context, the slaves had no such right, it was deprived them by the southern state governments with the aid of their citizens

[@patrickcleburneuczjsxpmp9558]

@@garlonschuman1014 And neither did slaves (and lots of other Americans) in 1776? What's your point?

[@dinamosflams]

it was about states rights and 'free' people! (wink)

[@jdotoz]

Hey, that's not fair. They used them as farm animals.

[@CivilWarWeekByWeek]

I feel like this entire episode was created for that opening joke

[@LadyTylerBioRodriguez]

But are you an anarcho syndicalist?

[@frankiefierro7129]

That ending was amazing! Netflix needs to give you your own show so they can cancel it after a successful first season

[@floopusdoopus]

Hey, at least you’re being honest here lol

[@homerocketscience1874]

I wonder what success means to Netflix......

[@MortanAMrk]

​@@homerocketscience1874large face entrance

[@greyfells2829]

Your theatre experience shines through all of your content on this channel. 95% of 'characters' that KZbinrs do I fast-forward through, but you keep me planted for an hour watching this. Kudos man, that's some good shit. I frequently quote/imitate the confederate guy when shooting the shit with my friends.

[@tonyjoestar2632]

I've watched this several times, but I just now caught that as Billy mentions the confeds becoming a global slave empire, Klaus's theme starts playing

[@pyromania1018]

The Supremacy Clause, described by my high school American History teacher as the perfect answer to the claim that the Southern states had a legal (or at least constitutional) right to secede.

[@jtgd]

Not just that, but the fact that where was no process to dissolve the states is evident that there was never actually an intention for it to ever be dissolved in the future. They thought slavery would be abolished, or will “fade away”, but they didn’t intend on the states just leaving whenever they want. If that was the case, they’d clearly add an amendment for that

[@jeffreygao3956]

Pfft. New England tried to secede once.

[@stephenquinn3447]

@@jeffreygao3956 difference is: 1: New England didn't actually do it 2: New England wanted to secede because the US had gotten them into *A WAR WITH THE STRONGEST NATION ON EARTH AT THE TIME* which they were getting their butt kicked in instead of the outcome of 1 Election

[@ZeteticPhilosopher]

@@jeffreygao3956 A small number of federalists tried to instigate a coup. That does not make it legal. In fact, the obvious illegality of it at the time, as it was so considered by nearly everyone, further proves the point.

[@degustablegerbil]

@@jeffreygao3956 and?

[@Lifad2011]

As someone who grew up in the Deep South and was indoctrinated into Lost Cause mythology from the first time I went to Stone Mountain as a kid, it’s been both entertaining and fascinating to watch this series. I had woken up to the truth of the matter before I discovered your channel, but this has been an educational roller coaster to watch. Excellent work as always!

[@justinwatson1510]

Please talk to your family and childhood friends about what you’ve learned. I turned my very right-wing, very racist Evangelical mother into a communist within 6 months just by asking questions and not letting her get away with “alternative facts.”

[@disappointedmess209]

@@justinwatson1510 ngl that is very funny if true.

[@righthandstep5]

At least you know the truth OP

[@Lifad2011]

Most of my friends never really bought into any of it to begin with, and though my mom disagrees with me a lot she and I have a pretty good dialogue about politics. My dad is the only one I feel like I can’t talk to about these things.

[@asmodiusjones9563]

This is also fascinating for those of us who grew up outside the South. I grew up about as far away from the South as you can get in the continental US and then didn’t study history in university. I didn’t learn about the Lost Cause until I found this channel and it is a constant source of surprise, but I really appreciate learning about these ideologies that shape life in America to this day.

[@bryangonzalez1398]

The way Atun-Shei has done this series really is the epitome of how history can be both entertaining to learn and allows for a deep dive into the discussions we need to have as a nation regarding the parts of our history that make many uncomfortable. I'd love to see him tackle the Mexican American War and the Texas Revolt. Could totally see him doing a joint project with the writers of "Forget the Alamo".

[@breakingboardrooms1778]

You can't mean the alternate history story where a modern man wakes up as William B Travis? :D :D :D

[@bryangonzalez1398]

@@breakingboardrooms1778 Well at least the modern person trapped in his body hopefully wouldn't keep taking mercury for treating Travis's vd. The quantum leap episode we always needed.

[@RachelPennborough]

This is one of atun shei's best videos in my opinion

[@javaPhysician]

Not gonna lie, I thought Episode 7 was the finale of Checkmate, Lincolnites, but I am very happy to see more. Atun-Shei films is what edu-tainment should be: entertaining, but keeping straight to the facts when facts are concerned. And with sources too!

[@the_arora804]

Loved that little call back to the "reorganization" of the old republic into the galactic empire from SW, it's often those little things on top of the educational content that I love about this channel.

[@ErilMedPlay123]

X2 epic moment

[@cainnkalos6095]

That's was a brilliant moment

[@futurestoryteller]

There also seemed to be a "few" references to the current political climate, intentional or not...

[@ByzantineDarkwraith]

@@futurestoryteller "intentional or not"? did you think he accidentally put joe biden into the video lol

[@futurestoryteller]

@@ByzantineDarkwraith Oh yeah... you got me pegged, that was definitely the part I was talking about...

[@mjvajda]

Glad you talked about the Early Republic period and Shays’s Rebellion (an academic passion of mine and my original dissertation focus). Great to have you and the series back!

[@Baelor-Breakspear]

That was mentioned in Zinns peoples history of United States I believe?? I could be wrong but I think That’s where I first heard of that rebellion and I had never heard about it before that.

[@mjvajda]

@@Baelor-Breakspear I have not read Zinn’s “A People’s History of the U.S.” but knowing Zinn’s methodology, I believe he does. I knew about Shays’s Rebellion (also known as, and probably more accurately known as, the Massachusetts Regulation, since he wasn’t the sole leader) for several years before I went to college. Plenty of good materials on the rebellion: David Szatmary, Leonard Richards, Sean Condon, Robert Gross. Highly recommend all these authors and their works. I have moved more towards military intelligence, but SR is going to be my next project once the dissertation is completed.

[@mjvajda]

@sword-swinging cat I’m from the Worcester area (a transplant as I am NYer by birth), so I didn’t know about the Worcester Revolution in 1774 until my college years. Skipping forward to SR, Benjamin Lincoln got to Worcester to meet the rest of the militia that was supposed to be raised, but didn’t get many volunteers and continued westward. But Gen. Shepard took care of things (even without federal permission to use the arsenal’s weapons). Lincoln did clean up everything though.