Could Removing Air Gunners From WWII Bombers Really Have Saved Lives?

What if the maths of bomber losses suggested that aerial gunners were no longer necessary, would that be a good idea?
In this video, I go over one of the most 'interesting' proposals to come out of the Operational Research Section attached to RAF bomber command.
It's an interesting debate, so I've done a lot of research into this question. I'd be very interested to see what you guys think as well. Leave me a comment, like, and maybe even subscribe to the channel.
💗 If you'd like to support my channel please follow this link for more details: calibanrising.com/support/
You can also now find me on Patreon: / calibanrising
🧥 Want to get a great deal on an authentic leather flying jacket? Check out the range from Legendary USA here: calibanrising.com/flying-jacket/
🎁 Grab one of my unique WW2-themed designs. great on t-shirts, hoodies or mugs: bit.ly/3GLPNBJ
Wishlist: amzn.to/385dXHD
⏱️ Timestamp:
0:00 The 'no gunner' theory
7:24 What did a gunner really do?
12:12 Did air gunners really matter?
18:46 The data on Removing gun turrets
21:41 The Mosquito debate
Images: other than where stated, images used in the video have been found on commons.wikimedia.org/
#aviationhistory#history

[@davehuggins9372]

If they had opted to remove the crew and guns some one would have increased the bomb load negating any advantages

[@fredeagle3912]

Drag affects top speed more than weight. It should have been tried at least to find out. Lives are, sad to say, expendable in war. An under fuselage gun turret (with fifty cals) would have been useful in night fighting. To deter attackers a load of cheap, light unaimed rockets could have been just as effective.

[@shadeburst]

That's what bombers do. Carry bombs. Imagine (as Freeman Dyson said) being able to fly higher and faster to target, with a heavier bomb load!

[@johncostello3174]

@@fredeagle3912 Yes add a mid-lower turret with 2 x 0.50 guns to counter the shräge musik night fighters and to compensate remove the mid-upper turret which as far as I know whas rarely used.

[@Gloomendoom]

RAF 100 Group operated B17s at night. They removed the ball turret with its twin 50s because they found that in the dark it was disorientating for the gunner and almost impossible to aim.

[@oldesertguy9616]

I think that once the Germans knew there was no tail gun the bombers would have been shot down in droves.

[@WilliamJohnwon1522]

When my father was a rear gunner, he said if he hosed some tracer at German fighters, they seemed to veer away, supposedly looking for asleep air gunners. You could see the tracer at night time, which blew with the wind.

[@CalibanRising]

What a brave man your dad must have been! Thanks for the comment William.

[@typhoon2827]

Was that before air gunners removed tracers because it gave away the position of the bomber? Did your dad ever say?

[@chrissheppard5068]

@@typhoon2827 More like fighter pilots shooting from the rear would remove tracer so the victim did not even know he was being shot at so did not take counter measure. You did have to be a good shot to achieve this however. Defensively tracer is a good aid to accuracy and to indicate to the attacker he is being shot at so he takes evasive action or gets the jitters. I have shot many a MG myself being ex RM.

[@WilliamJohnwon1522]

@@typhoon2827 I guess at the time, the tracers would show you where the shots were landing, looking at it logically and the enemy fighter, the single engined ones being mainly Focke Wulfs would already know the big lumbering four engined bombers were there, when they were attacking.

[@Legitpenguins99]

Tracers were removed on the American side partially because gunners would attempt to aim via the tracers and not proper deflection shooting so would end up missing. The logic makes sense but one could argue the logic is flawed

[@brianmays4366]

Could you imagine being a pilot, copliot or navigator in a bomber and being sent into battle without any turrets to protect them? I think the psychological impact on the crew would have been immense

[@bryanschuler9097]

And would have stripped away the illusion that they were not being expended as cannon fodder in attrition warfare akin to the infantry attacks across no man's land in the First World War

[@brianmays4366]

@@bryanschuler9097 This was only taking the current German night fighters into account, the increase in speed would have been negated by radar and faster aircraft.The sudden shooting down of the aircraft could have been flack and there was not much to protect you from that

[@neiloflongbeck5705]

​@@brianmays4366That same argument was used to stop the development of tanks in the 1920 to 1930s. It was wrong.

[@neilbrown2948]

Can you say Mosquito.Check the loss rate on them.

[@brianmays4366]

@@neilbrown2948 The Mosquito was a fantastic aircraft but could only 4000lbs of bombs, whereas the Lancaster could triple that

[@chrissheppard5068]

My father who was awarded a DFC in 1945 first flew as an airgunner/wireless operator right through the war from 41 and most certainly was still flying in 44 as he did D day. He did 69 trips over France and Germany on his third tour he was grounded due to exhaustion. He talked very little about it, very little but he did give enough information to ascertain that air gunners did a lot more than shoot a MG. He died at 96. Sat to attention saluting you now dad.

[@Cdr_Mansfield_Cumming]

Those men were a different breed. Our Fi est generation. One that many in the generations that followed him are not fit to tie his shoes. RIP your Dad.

[@chrisbergonzi7977]

God Bless his memory...

[@kevindarroch7332]

Thank you, God bless our WW2 vet dads.

[@gibson617ajg]

I'll take you up to 96 'likes'. Your father was a hero and, of course, you are rightly proud of him.

[@Crosshair84]

1. The Mosquito was difficult to intercept because it was used in small discreet missions that were difficult to track and intercept. Were they do be used in a bomber stream, they would have been rather straightforward to intercept. 2. The Mosquito could never replace the B-17 for the simple fact that it was impossible to build enough Mosquitos. It wasn't just slapped together with whatever 2x4s you had lying around, it consumed vast amounts of high grade lumber, shipped from around the world. It used new exotic adhesives that were expensive to produce. It required skilled woodworking labor to construct. The production capacity was maxed out and it could not, and was not, meaningfully increased.

[@xmeda]

The main problem of your statement is the need for large number of bombers. That is completely false. B-17 formations were so big, because they were mostly just carpet bombing and whole formation ineffectively dropped bombs when leader started. With planes like A-20 or Mosquito all you need is to hit the target in dive attack with very good accuracy. Hence you do not need to send 100 planes and there is no need for so many bombs. But bomber mafia pushed into waves of B17/B24. 10 Mosquitos could easily do the same target damage like 50+ B-17s in case the target was factory or some storage. Heavy bomber streams only had advantage when whole city blocks were attacked with psychological terror just dropping bombs everywhere on whatever building.

[@Crosshair84]

@@xmeda This is just ridiculous fantasy. Neither the A-20 or Mosquito were dive bombers or equipped to properly dive bomb. (Glide bombing is another story.) Proper dive bombing releases the bomb at about 2,000' to get the accuracy they do. Aircraft dive bombing a fixed land target are simply not going to survive long term coming into range of 20mm, 37mm, 88mm, and 105mm AA guns. That's why the bombers flew so high in the first place.

[@gwarner99b]

Your first point assumes that a Mosquito based force had to use the same tactics. No need for defensive box formations. Maybe a series of waves of smaller Mosquito attack forces, would overload fighter defenses, which would be out of fuel and ammo and exhausted after going after the first waves. Remember, it still takes one fighter to attack one Mosquito, but there would have been many more targets, many more attackers, each one much harder to hit. Your second point is probably the strongest objection to replacing B17s with Mosquitoes. But if the willingness and the understand of the potential advantages were there, surely the US could find both woodworkers and materials to build more Mosquitoes? And the knowledge of Mosquito production existed in Canada to draw on.

[@gwarner99b]

@@Crosshair84 You are right, definitely not a dive bomber. The best part of @xmeda s point is that you would not use larger Mosquito wings in anything like the way B17s were used. Not dive bombing, but perhaps in successive series of more accurately targeted attacks, perhaps from different angles, swamping and diffusing fighter defenses and suffering less from flak because of their greater speed and agility. Used intelligently, no reason why Mosquitoes should suffer a higherr proportion of losses just because they are used more. (Schweinfurt-Regensburg, anyone? ) Edit : A different debate, but a mainly Mosquito bombing force used this way would lend itself to a shift from area bombing to effective targeting of factories, communication hubs, command centres etc, thus saving both Allied crew and German civilians. Not the same point, I know, but another reason to assume that either USA or RAF historical strategy and tactics must be the way a Mossie-heavy bomber force would have to be used.

[@tacticalclochard]

@@xmeda Good point. Unfortunately I lost the source, but there were trials attacks by Mossies on power stations in the German occupied Netherlands: 2 sorties were enough to destroy a station. IMO, the Mosquito might have been the plane that actually did win the overall war from the air. But that opens a lot of cans, because Harris did not care a bit about power outages for the German industry but about their civilian morale.

[@Stratiljirka]

Probably something in between might be the right answer. Something like "Halifax approach" - abandon front and top turret while keeping the rear. Frontal attacks in night sound impropable and extremly difficult and front turrent causes most drag while rear turret probably causes least drag and is covering the most effective attack angle.

[@wackyotter1235]

daytime b17 bombing makes sense to have them. though I wonder if the waist gunners were really necessary? especially as they had the highest casualty rates

[@xmeda]

@@wackyotter1235B-17 make no sense at all to begin with. Large formations just dropping bombs somewhere near target while being chewed by flak and fighters with horrible losses.

[@Getoffmycloud53]

For RAF Bomber Command this makes perfect sense. Speed and altitude being more important than defensive gunners. The rear would be the most important and effective gunner against night fighters, with the exception of Schräge Musik oblique armed fighters. The Mosquito was one example, the post war Canberra another, with finally the V bombers. No gunners, speed and altitude. As for the slower US day bombers. The defensive gunners in formation were formidable, psychologically for both sides, but even in practice making certain approaches relatively dangerous, although not anywhere near the numbers that were credited to the bombers. So RAF, yes. The USAAF, no - look at the B-29, however looking at Korea you can see that soon even these bombers were forces to night operations and the jet bombers soon made gun positions pretty obsolete, with the exception of a rear gun like that on the early B-52s

[@wackyotter1235]

@@Getoffmycloud53 B-52 also had a goofy rear gun! It was taken out though because it used radar, and aircraft performing SEAD had a missile that hit the tail. During Vietnam the tailgun made a few kills. The B-36 was another heavy bomber that had 20mm turrets but ya know, nobody knows how it would’ve performed and it was a weird mix of jet and prop when people still didn’t trust jets. Your comment is far more insightful than some of the more emotional reactions, any thoughts to the waist gunners being unnecessary?

[@jackcole3146]

@@xmeda That was the more or less universal doctrine at the time. The RAF certainly held this view from it's formation in 1918, right up to when it was disproved in 1940, with daylight raids sustaining losses of up to 100%. The USAAF did the same with far more heavy defensive armament and on a far larger scale and reached the same conclusion.

[@johnwilson6721]

I had the good luck to meet a few times Peter Potter who had been a Lanc rear gunner for over 30 missions. He never fired his guns in anger, though he was a skilled shot with a 12 bore. He makes the point in his book that one of his important functions was to give the pilot feedback on the engines and their synchronisation, resulting in greater economy, itself a safety point.

[@politenessman3901]

Arguably his most important role was to call out the need to corkscrew and which way to go. Alert gunners doing that alone saved countless lives in the course of the war.

[@CalibanRising]

I'll check out his book, I don't think I've come across it yet. Thanks.

[@JPduclerc]

​@@politenessman3901What is that corkscrew maneuver I keep hearing about?

[@eric-wb7gj]

B29 crews in the Pacific theater reduced gunners towards the end of the war, but did keep some to check on the engines, which had a nasty habit of leaking oil, then catching fire.

[@jonaldous3446]

@@JPduclerc it was an evasion maneuver to escape from fighters

[@feedingravens]

What happens leaving a blind, unprotected spot you can see on british night bombers. The germans quickly found out that in contrast to US bombers they had no defence at the belly, so switched to "Schräge Musik" 2 machine cannons mounted 60 degrees upwards. The night fighters then could approach in safety from below, line up with the bomber, aim carefully without even being noticed, and take the bomber out without the crew even knowing what had happened.

[@KamiRecca]

Yes, but the theory of jazz music didnt realy work in reality. Hence it never became widespread technology. Or seen like this, it was the worst kind of military solution; as in it solves the problem of Today, but not Tomorrow. So the tech was outdated when it came into service more or less.

[@feedingravens]

@@KamiRecca As far as I know, for quite a while this method was very successful, as the British did not even know why they suddenly lost so many more bombers. I grant it to you that that is not an eternal solution, that it is specialized for one scenario. Once the problem is detected and countermeasures are taken, , i.e. remove the blind spot and maybe add a belly turret, it is over. But in the military any new wonder weapon is only of temporal efficiency - until the enemy knows what countermeasures to take.

[@KamiRecca]

@@feedingravensok so i was under the impression that it was far less effective, but i remembervit wrong. No you are right, it worked eell for less than half a year. A long time in a war though.

[@Skyfighter64]

If I'm not mistaken, the USA developed a couple programs to improve the effectiveness of gunner crews during World War 2. The first was to put crews in training on the back of a truck, and having them basically shoot clays while the truck was moving (I don't remember the full details), but the concept being that they were learning how to shoot at moving targets from a moving platform, and the instant feedback (you either hit or don't) quickly ingrained the experience, which translated well to the real thing. The second program developed was called Operation Pinball. A Bell P-63 King Cobra got heavily modified, removing real guns, and adding heavy armor to the front of the plane, then was flown in known attack patterns against a bomber crew in training. The Bomber crews were armed with frangible (Designed to break upon impact) bullets, and really shot at the P-63. Advanced acoustic sensors on the P-63 were designed to pick up the sound of the bullet impacts, and would cause the light that was mounted where the nose cannon had been to illuminate, once again giving instant feedback to the gunners. Now that the gunners heading to the Bomber squadrons had practical experience with this type of shooting, combined with improvements to bomber formations and Fighter escort practices, bomber losses went down significantly.

[@ZealothPL]

Thats just copium. Bomber losses mostly went down simply because Germany was horrifically losing the war at that point

[@classifiedad1]

The U.S. would also vastly improve the effectiveness of the gun turrets themselves with the B-29’s own centralized fire control system. It was pretty effective, and all U.S. heavy bombers up to the XB-70 and B-1B would use radar-directed gun turrets. The tail guns of the B-52 were responsible for MiG kills, with the USAF attributing two kills on MiG-21 while the PVAF attributed a third loss to the tail guns in exchange for a claimed air-air shoot-down. Which means the B-52, either way, had a positive K/D against enemy fighters.

[@I_am_not_a_dog]

@@ZealothPL Not everything is “copium.” You’ve turned what used to be a humorous insult into an eye-roller. Developing hypotheses as to why bomber losses dropped-off is not “copium.” What exactly is anyone coping over? Germany having the living shit kicked out of them?

[@pagatryx5451]

@@I_am_not_a_dog Are you stupid? He's right. German air decline is one of the most widely understood points of failure for the Axis in the later years of the war. It's safe to say THAT is the reason bomber losses were reduced.

[@tellyknessis6229]

Interesting. My old man was a Royal Navy WW2 vet. He told me that inter-war, it was the Navy that taught the Brit Army tankers how to shoot from a moving platform at a moving target. Sure, this was long before stabilised weaponry/range-finding in AFVs, but at least the theory was there. He got to drive a WW1 vintage "parallelogram" tank that was at HMS Excellent (RN gunnery school) in 1943/4 on his Sub-Lt's courses as a result.

[@charlesphillips4575]

The Halifax lost its nose turret to improve performance. Personally I think that deleting the nose and mid-upper turrets but keeping the tail one would have been a good plan. That would be only one crew member saved, but a useful reduction in weight and drag. Note that attacking from below makes sense for a night fighter, because it is easier to see a plane against the sky than against the ground. So attacking from below helps the fighter and hinders the bomber. Fitting a downwards facing gun on the bomber would not have helped because the gunner would not see the fighter. Also the Schräge Musik made use of zero-deflection shooting. KZbin wont let me put a link in, so Google it.

[@SoloRenegade]

Mosquito ditched crew, guns and armor...........

[@user-rv5mw1qi3g]

For the British bombers operating at night, I agree with your compromise of deleting the nose turret and upper turret (and gunner), but retaining the rear turret and tail gunner. As a further compromise you could put a machine gun in a flex mount in the nose once the heavy turret was removed. That would still give you a forward firing gun for morale purposes with a minimal weight impact.

[@kennethferland5579]

Exactly, not every gunner position is equally useful. Removing the nose and top guns, and have the Bombadier operate the rear gun rather then the removed forward gun still saves 2 out of 7 crew members and the majority of the weight.

[@SoloRenegade]

@@user-rv5mw1qi3g the british bombers lacked a belly turret, capable of rear firing too. Tons of different German night fighter tactics attacked from below.

[@DrTheRich]

I wonder why no one bothered to at least put a window on the bottom if not a gunner...

[@wendydelisse9778]

Not discussed was the topic of "speed obsolescence". A bomber airplane with no gun turrets that was 20 mph slower than the average pursuing fighter airplane in some given year, 1940 for example, would be easy prey in about 2 years if the opposing fighter airplane fleet became 40 miles per hour faster. There is a big difference between needing 30 minutes to close 10 miles of distance and only needing 10 minutes to close 10 miles of distance. In 30 minutes, a lot of nice things can happen for a bomber airplane, like the pursuing fighter airplanes having to break off due to running low on fuel, or like friendly escort airplanes making an appearance after the bomber airplanes fly into the zone of their protective combat radius. In 10 minutes, though, probably not much is going to change, and then it is simply a matter of an airplane with cannons or machine guns versus an airplane with no cannons and no machine guns. In WW2, an unarmed bomber airplane being almost as fast as a pursuing fighter airplane in some particular year meant being slow enough to become an obsolete and easily victimized unarmed bomber airplane in just a couple of years or so.

[@spindash64]

Not to mention that a bomber design can theoretically offer a greater "shelf life" than a fighter design, due to the target (grounded installations like factories) not being in a direct performance arms race TLDR: the moment your enemy has shiny new fighters, your old fighters are expected to be replaced with newer, shinier ones. Bombers don't get the same luxury

[@lowellwhite1603]

The Germans tried that, briefly, with the Messerschmitt ME 410 two seat, twin engine heavy day fighter. With heavy forward armament and rockets, it was successful against American B-17 and B-24 bombers. However, it was not fast or maneuverable enough against escorting P-51 and P-47 and suffered heavy losses even with two 13mm defensive machine guns. They reasoned that by removing the rear gunner and the guns and ammunition would increase speed and performance. The experiment failed as the increased performance was not enough and the aircraft was even more vulnerable due to the lack of the extra pair of eyes. As for RAF night bombers, remember they only had 303 caliber machine guns with less range and punch of the American bombers 50 caliber. They also had no ventral armament. The Germans developed a tactic they called "Jazz Music" where they used upward firing 20mm or 30 mm cannon. Many a Lancaster or Halifax crew didn't know the Luftwaffe night fighter was attacking from below until their aircraft was in flames.

[@Gloomendoom]

I’m a bit dubious that “Schräge Musik” was such a mystery to the RAF. After all, they had used the same system in WW1. Have a look at a Sopwith Dolphin.

[@barelyasurvivor1257]

If I remember right the Luftwaffe had problems with the remote weapons turrets not workng very well, especially on the ME 410

[@advorak8529]

“Schräge Musik”. Slanted, not straight, not at (proper) right angles. The term was used to indicate Jazz, as a strange, wrong, more noise than music, degenerate thing. The guns being pointed not straight up but a bit forward and to one side (you really do not want a bomber in pieces to fall onto you) made them slanted … The pilot would carefully manoeuvre his plane so that the relevant crosshairs aligned with the belly of the bomber and then fire. They used a mix of HE and armour piercing shells, they should have stuck to HE exclusively - once one bomber made it back home after an attack, the holes from the armour piercing shells indicated that they must have come from below … As to the .303: the British way of shooting down planes was to fill them up with tiny .303 projectiles until they were too heavy to fly.

[@brokeandtired]

Lancaster flew at night, without a radar an FW190/Me 109 was virtually entirely useless....the threats we the radar equipped heavy night fighters. A far faster bomber variant Lancasterian would have been insanely hard to catch....and just keeping a powered streamlined pintle mounted 20mm would have kept most interceptions at bay.

[@richardvernon317]

@@advorak8529 RAF Bomber Command ORS were aware of Schräge Musik in January 1944. The Operational Research staff produced a monthly report titled "Enemy Tactics Against Bombers" which contained a mass of intelligence information and noted the increasing ratio of night fighter attacks from below as against on the level or above. The January 1944 report contained the following. "In view of the relative frequency of attacks by unseen aircraft, attention is drawn to four reported cases this month in which the enemy fighter was seen to make its attack from almost vertically below. One, a Ju88, followed a Lancaster for a considerable time, positioning itself underneath the rear turret so that the gunner could not bring his guns to bear. From this position the fighter was able to open fire several times." In July 1944 they knew exactly how Schräge Musik worked. "Some fighters are carrying 20mm. upward firing cannon mounted at an angle of 70deg. to the horizontal. Aiming is done with a Revi gunsight inclined at the same angle as the guns. A tentative estimate of fighters so equipped was 10% or 20%." Why this information wasn't passed on to the Bomber crews is beyond my comprehension!!!

[@cassidy109]

Kind of reminds me of the USAF’s experience with B-52 tail gunners during Linebacker II during the Vietnam War. The D variant had a manned turret in the tail of the aircraft. The tail gunners were a major asset in calling out SAMs as well observing any damage that the aircraft received from nearby SAM detonations. Though official records still credit tail gunners with two Mig kills.

[@johncostello3174]

What guns did they carry? 20mm ?

[@cassidy109]

@@johncostello3174 The C through G variants were all equipped with four .50 caliber machine guns in the tail. The B variant came with either the quad .50 like the previously mentioned variants or two 20mm auto cannons. The final variant, the H, had a single 20mm M61 Vulcan Gatling type rotary cannon.

[@ibubezi7685]

@@cassidy109 Later on, remotely controlled (not sure from which variant).

[@cassidy109]

@@ibubezi7685 The gunner was moved up to the forward fuselage with the rest of the crew starting with the G variant. He sat next to the EWO on the upper flight deck and was provided with a rear-facing upward-firing ejection seat. And as you correctly noted aimed and fired his weapons remotely, utilizing a radar scope and closed-circuit television. As I mentioned previously, I seem to recall that during Linebacker II the manned tail in the D variant proved to helpful in calling out SAMs and reporting damage to the aircraft.

[@ibubezi7685]

@@cassidy109 Must have been a frightening job, seeing SAMs coming your way - can't tell how far they could traverse their gun(s). Maybe they had chaff. During Linebacker II ('72), they shot down 12 B52's - horrible tactics, stupid way to lose crews - the brass didn't adapt.

[@fakshen1973]

The key sentence is that attacking fighters had to attack at odd angles and with care in order to avoid the gunners. Attacking an unarmed aircraft would mean the fighters being able to set-up at will. The Germans would have developed different weapons and tactics to blow bombers out of the sky. You could bring in heavier fighters with bigger cannons or even turreted larger aircraft to deal with undefended bombers. The only time I could think of removing 1.5 tons of crew and guns from the bomber would be if there were full fighter escorts all the way there and back. The increase in speed could have been matched by the escorts and resulted in aircraft that were harder to hit by flak from the ground. Regarding making changes to tactics and armament: you'd have to change everything about the aircraft and crews with faith you weren't creating other challenges and pitfalls. The term "better the devil you know" is apropos.

[@BastiatC]

yep, you could just camp behind the formation and hose the engines with the cannon

[@tanyabodrova9947]

It's so refreshing to listen to an intelligent, fact filled analysis without it being drowned in annoying muzak.

[@CalibanRising]

Thanks. I can never find music I like so I stopped using it in my videos.

[@AmenYeshua]

@@CalibanRising No need for any music. Can surely speak for all when saying I don’t believe anyone would miss it. I don’t chat to friends one on one with ‘background music’ blaring away!? It’s just common decency.

[@lqr824]

Except the author doesn't seem to realize that the point of the bombers was to destroy all the fighters so D-day would have air superiority for the allies. If he doesn't understand the entire point of the bombing, no amount of minor facts will suffice.

[@mpersad]

What a superbly researched video covering a much overlooked operational choice of turrets/guns or none. This deserves to be more widely known, and your research is a great resource. Top video!

[@CalibanRising]

Glad you enjoyed it!

[@Aut0KAD]

it takes about 2 weeks to train a gunner, takes 3 years to train a German pilot.

[@CalibanRising]

I don't think it was a little as a fortnight, but I see your point. I believe that US gunners got 210 training hours (so as much as 20-30 days) at a gunnery school but I'd have to look up just how quickly RAF gunners were trained.

[@stevekaczynski3793]

@@CalibanRising I don't know about the three years (two was typical among British and Americans), and due to high casualties and fuel shortages, corners were cut in pilot training in the Luftwaffe. Many started combat operations in 1944 and 1945 while barely being able to take off and land safely. Many never got that far, dying in training accidents, although many trainees in other air forces died the same way.

[@user-xi5uu4uh6b]

John Toland claimed that Claire Chennault's Flying Tigers employed unorthodox tactics in defending China against Japanese air attack. Did Toland fully understand what Chennault was instructing his pilots to do? A PBS station airing the movie "Flying Tigers" starring John Wayne was followed by an interview with a real-life Flying Tiger verteran, none other than squadron leader David "Tex" Hill. Hill, of course pointed out the historical inaccuracy of the movie depicting turning, dog-fight combat. Chennault insisted that his pilots engage the more maneuverable "Zero" with a diving attack, although historian Daniel Ford explained that the Zero was a naval aircraft and not encountered by the Tigers. But there must have been much more to Chennault's low losses of his fighter pilots compared to his British allies in that theatre of war. The interview showed a gun-camera film from a fighter engaging a Japanese bomber. Hill explained "why everything looked upside down." He went on to say that what he was doing was to dive below the bomber formation, roll inverted, and then "dive down" from this inverted perspective upwards towards the underside of the bomber, where unlike the American bombers with the ball turret, this adversary was not protected. Hill was doing much fancier flying than his German fighter-pilot counterparts with their Schrage Musik "upward firing guns" that Dyson wrote about, but the effect was the same. Just as Schrage Musik and upward-firing guns only belatedly entered into the lexicon of WW-II historians, let alone the contemporary awareness of Arthur Harris and his staff, historians writing about the Flying Tigers appear to be unaware of what David Hill was saying in his interview. But who are you going to believe, Daniel Ford or John Toland writing about the Tigers, or David Hill, an actual Flying Tiger veteran who was explaining his tactics during a PBS interview?

[@cattledog901]

There is one big piece of missing context to this. The British were bombing at night and the Americans in the day. At night when you only had to worry about a few prowling German night fighters, more speed would be beneficial, and you could get away with a reduced defensive armament. In the daytime slog it out battle the Americans were fighting, the defensive armament was a neccesity. As you said the American combat box was actually very effective as attested to by German pilots. The Germans had to alter their tactics to include head on attacks which were so effective the chin turret was introduced on the B17G to counter this. US bombers killed more enemy fighters than US fighter planes did. Defenseless bombers in daytime would have been easy meat for massed German fighter attacks. The British way worked for the nighttime bombing campaign they were fighting but its not as simple as "less turrets = more survivable" when you are talking in a WW2 context, especially when it comes to daytime bombing.

[@CalibanRising]

Agreed. I mentioned this idea in the video but didn't cover it entirely because I'm missing a big bit of data on 8th Air Force claims.

[@Dalesmanable]

German records show that they only lost more fighters to the massively-overclaiming bomber gunners in the first phases of USAAF operations. Then fighter escorts could not be avoided and they shot down far more than gunners.

[@anthonyeaton5153]

Just a few German night fighters at night? Tell that to the RAF Bomber crews. Hundreds of bombers fell to the guns of German night fighters. The Americans may have faced more but that does not mean the RAF faced less.

[@Dalesmanable]

@@anthonyeaton5153 indeed. Well over 7,000 Bomber Command aircraft fell to nightfighters, whose strength was always comparable to that of the Luftwaffe day fighter arm in Europe.

[@cattledog901]

@@anthonyeaton5153 Obviously I'm talking about how many fighters you would encounter within the context of a mission, not overrall whole war. British never faced massed fighter attacks at night like the US did during the day.

[@davidchilds9590]

Operational Research needs good data to be useful. While a war is going on, you can only know part of the story. IF gunners were ineffective in reducing losses, then it would be eminently sensible to remove them. But, as so cogently argued, their role was not exclusively (or even mainly?) to 'fight off' attacks. There are accounts that indicate that German fighter pilots preferred to attack 'easy' targets (who wouldn't?). Fighting requires excellent situational awareness; the gunners (when part of a well-coordinated crew) were an essential contribution to the Captain's ability to fight the aircraft. Would another 50 knots have helped? Possibly, but there was a trade-off and 'Butch' Harris could not know whether a change would help or hinder.

[@stevetheduck1425]

Yet all the changes except losing the rear turret happened, and this on his favourite Lancaster type of bomber. By the end of the war, some squadrons had no nose, no mid-upper, no armour except the bit that made up the pilot's seat-back, and no Lancaster had been built with the planned under turret since the beginning of it's service. Improvements in engine power and propellers also added to height, speed and this resulted ( among other reasons ) in a much reduced loss rate in late-war aircraft.

[@PlayChaosVoices]

@@stevetheduck1425 by the end of war the had little to fight against.

[@kennethferland5579]

Obviously the would do experimentation to test the concept before doing it enmass. Thouse WW2 commanders can be faulted for not having the imagination to make the tests.

[@spindash64]

Quick nitpick: if we were talking about 50 knots, then the gunners would all get the boot. You practically had to sell your soul for an extra 10 knots on a bomber. If you could get 50 knots extra on a 4 engined behemoth just by ditching the gunners, who NEEDS guns? You're already faster than any fighter the Germans have Your point still stands, I just feel like being pedantic

[@carrickrichards2457]

Flt Lt McIntosh flew 55 missions as a rear gunner in Lancaster bombers and is credited with 8 enemy aircraft. USAAF gunners of 8th Air Force bombers claimed 6,259 enemy aircraft destroyed, 1,836 probables, and 3,210 damaged, better than 8th's fighters' score: That is NOT a few 'isolated cases'.

[@kennethferland5579]

Kill claims are worthless, the question is how many fighters the enemy actually recorded lost to bomber counterfire.

[@AnthonyBrown12324]

AS usual you covered many ideas ; always interesting videos .

[@CalibanRising]

Thank you very much!

[@edcliff4627]

The Soviet Il2 Sturmovik was initially used without a rear gunner, some Il2 pilots put broom sticks on the back of their cockpits in an attempt to deter German fighters, the Il2 was eventually fitted with just one rear 0.5" machine gun.

[@kirishima638]

Boom sticks

[@xmeda]

Signle seat IL-2 could manouver well and defend itself, but pilots in them were not trained for such tactics, they were bomber/attack pilots. Fighter pilots had significantly longer and more intensive training. While IL-2 pilots mostly did just simple manouvers and flew low level. Adding rear gunner improved this a lot.

[@helterskelter416]

11:46 the studies listed here show that firing first *reduced* losses. also, in the same vein of stupidity that the "researchers" were going down, you could sent out every bomber with nothing but the pilot as crew, this would DRASTICALLY reduce the number of casualties. if you sent them out with no one on board, you could eliminate them altogether. no shit, not having gunners would reduce the number of gunners dying. even if it reduced the overall casualties, you'd still lose more aircraft, and have a higher percent of crew losses, even if the number itself is lower.

[@Kenionatus]

It is a thing to consider. Are the aircraft or the crewmember more valuable is the big question at play there. Also how much a reduced crew reduces performance, of course.

[@richardvernon317]

@@Kenionatus From 1943 onwards the navigation of RAF Heavy bombers was done by a Navigation Team, made up of the Navigator, Bomb Aimer and Wireless Operator, assisted by at least the Tail Gunner as the Rear Turret was fitted with a position indicator that allow the gunner to get a bearing off the centre line of the aircraft off his gunsight.

[@spindash64]

​@@Kenionatuson a 4-engined bomber, you already have a minimum crew such that adding gunner positions will not _dramatically_ increase the manpower needs to operate a full wing. The extra survival chance per aircraft will, in this period, generally offset the increased losses per downed machine

[@MrWillNeedham]

I think the most compelling argument in favour of the removal of turrets is the direction that post-war development went. By the time of the cold war, bombers no longer carried the heavy defensive armaments favoured in WW2. Removing the front and upper turrets from a Lancaster would have boosted performance significantly while still having the rear gunner as lookout and to cover the most vulnerable angle. This would match what was done on many post-war bombers and would likely strike a better balance than complete removal of the turrets.

[@davidbriggs7365]

However, postwar bombers were much faster, were designed and built with combat experience from the Second World War, and were opposed by much faster enemy fighters equipped with much better weapons. Note that the B-17 dates from 1936 iirc, the B-24 from 1940 iirc, and while yes, the majority of the British bombers entered service during the war, they were all designed and built with inadequate information, and the only people who could tell them what was wrong with the bombers were either dead, or in German PoW camps. That ALSO applies to that Research Group, they only had part of the story.

[@epikmanthe3rd]

I concur with ​@@davidbriggs7365 but it should also be added that defensive equipment never went away for bombers. The B-52's rear turret went from gunner operated .50 cals, to radar tracking .50 cals, to a radar tracking M61 Vulcan (so a flying VADS), to jamming equipment. The last of which proved to be the most effective, but that was a retrofit for a missile age, to defend against SA-2s over Vietnam. I even saw plans by Vought to equip bombers (including the Martin P6M Mariner funnily enough) with a rearward facing radar guided missile launcher that had its own magazine of missiles.

[@MrWillNeedham]

That's exactly my point; once the lessons of WW2 were actually listened to, the new bombers were designed to prioritise speed and altitude rather than armament. If carrying multiple turrets had proven effective then we'd have seen the same trend continue post-war, rather than dying out.

[@ericadams3428]

In the Lanc the front gunner was also the bomb aimer so it wouldn't have cut the crew down but would have saved a bit of weight.

[@jwenting]

@@MrWillNeedhamThe main reason for the removal of turrets was the higher speed of jet fighters and especially missile carrying fighters. Manually tracked guns had no way to effectively hit those. On the B-29 and B-36 remotely operated turrets, radar guided and tracked using electric motors, were installed but found in time to also be ineffective against the higher speeds and longer engagement ranges of jet fighters armed with cannons and missiles, and were eventually removed. The tail gun of the B-52 met a similar fate and for the same reason.

[@anamiacdm]

After the war they determined that the turretless Mosquito in the light bomber role was safer and more efficient than the large bombers. However, the Mosquito flew in much smaller numbers so the Germans focused their armaments on things that were effective against the larger bombers. In another world where the British fly small numbers of heavy bombers and large numbers of turretless, light bombers then the Germans might have adapted and the light bombers might in fact have taken higher casualties.

[@lqr824]

Man, you're missing the ENTIRE POINT of the bombing. It wasn't to drop bombs. If it was, they'd just use P-38's (which had the same payload speed and range as Mosquitos, but years earlier, and far better high-altitude performance, plus radically higher production potential). Instead, the point of the bombing raids was so that the eventual ground invasion would have Allied air superiority. The entire point of the bombing was basically to destroy fighters. Mosquitos used as bombers would not destroy fighters and therefore could not achieve the goal of the bombing.

[@Anatolia909tv]

This episode is not only excellent but also of an immense PHILOSOPHICAL value. Great

[@randyg22152]

I thought that General Curtis LeMay tried this in the Pacific Theater against Japan when he ordered that guns be removed from his B-29 bombers and had them fly at night.

[@cameratool]

Fair comparison would be front attack of armed bombers vs rear attack of unarmed bombers. Rear attacks against unarmed bombers wouldn't require much of a speed advantage, would save fighters' ammunition, and allow rapid re engagement of fresh bomber targets after shooting one down.

[@Ulrich.Bierwisch]

I missed numbers of shot down night fighters and also historical analysis of the attacks and the opinion of the German pilots about the defensive guns in the Lancasters. Without this it's hard to say they where useless. I also think that as soon as the Germans had found out that the bombers don't have defensive guns, they would have attacked from a much closer range from behind, knowing that there is no observer and no gunner. They could just sneak in and shoot with heavy cannons from short range. Probably it would have been best to take the front guns out and put an observer to the bottom watching below.

[@CheefCoach]

Just because German would have easier job doesn't mean that they would be more effective. If enemy pilot can effectively circumvent bomber defense by changing angle of attack, that defense is not effective. Speed was of the most importance in air combat of WW2. If bombers were faster, fighters would have struggled more to catch them. At the end it is sort of math would losses be little bit higher or little bit lower.

[@martenkahr3365]

No, for two reasons. First, because the enemy interceptor pilots aren't mindless drones and would have quickly learned to exploit vulnerable angles. Second, because you can't pretend the length of the war would remain the same if strategic bombing was less effective while costing fewer lives per plane shot down. The reduction in crew would have saved lives on paper, but it would have also severely impacted the plane survival rate of strategic bombing rates, and the impact bombing raids had on enemy materiel production. The number of lives saved by the reduction of bomber crew size would have certainly been less than the number lost on the ground had the Axis been able to maintain their military-industrial capability for even a few months longer.

[@theduke7539]

The Mosquito proved that opting for smaller, cheaper, faster bombers with no gunners was more successful and had a higher survivability rate than the large slow bombers used by the 8th airforce. Had they instead mass produced smaller planes like the mosquito, the 10 men in a B17 could have been flying 5 planes instead of 1. AND the tiny, fast moving Mosquito actually carried a heavier payload of 4,000 pounds verses the B17 only carrying 3500 pounds. The british also confirmed that the smaller bombers flying low and fast were so accurate that they could target a single building under actual combat conditions and not damage any surrounding buildings. They proved it when 4 mosquitos bombed Gestapo HQ in Denmark and all 4 bombers carrying a massive bomb struck the building 4 consecutive times.

[@lqr824]

> The Mosquito proved that opting for smaller, cheaper, faster bombers with no gunners was more successful and had a higher survivability rate than the large slow bombers used by the 8th airforce. ABSOLUTELY NOT. The goal of the bombing campaign was to destroy the Luftwaffe's fighters, so that an invasion could be carried out with complete Allied air superiority. Mosquitos, if used as bombers, couldn't possibly achieve that goal. It's like there's this mass delusion in this comment section that the point of bombers was simply to bomb and that the entire staff of the Allied militaries were complete gabbling imbeciles for not just making faster bombers. News flash: fast, unarmed bombers, could, not, accomplish, the, goal. Flying Mosquitos or (better yet) P-38s (same range, payload, speed, but far earlier, far better high altitude performance, and far more produced) could, not, accomplish, the, goal. So no, they weren't gabbling imbeciles after all, were they?

[@johnhenderson131]

I’ve always wondered about that. You can do the math but did the gunners discourage attacking pilots from getting closer just by firing? That you can’t determine mathematically.

[@stevekaczynski3793]

It had some effect - German night fighter pilots often got very close without being spotted and were not fired on before they opened up, though if the gunners were not killed by the initial burst they might start shooting at the fighter. If the attacker was spotted first, the British bomber might go into the corkscrew port manoeuvre, perhaps with the tail and upper turret gunners "hosepiping" tracer all over the place. Often the German would clear off and look for an easier target, but some stuck around and tried again.

[@stevekaczynski3793]

RAF bomber gunners quite often thought their own .303s were inadequate - some used the word "popguns". They knew the Germans out there had 20mm cannons and later sometimes 30mm. The British had a tendency to offset the .303's inadequacies by installing more of them, hence the usual four in the rear turret of the Lancaster. Back in the Battle of Britain, Spitfires and Hurricanes had had eight .303s, and even then their pilots sometimes complained that German bombers were able to make it back to base after hundreds of .303 hits. Reliable cannon were not installed in British fighters until 1941.

[@mk14m0]

Institutional inertia at its finest (or rather, at its worst.) By the end of the war, even 20mm was none too powerful, and the British bombers were stuck with .303 weapons. The switch to .50 and 20mm guns in the Avro Lincoln, but it wasn't quite ready in time for wartime service.

[@1maico1]

@@mk14m0 .50 cal Browning AN/M2 were fitted to Rose turrets in Lancaster tails from late 1944

[@mathswithgarry7104]

There was one rear gunner who was quite good, but he had a special loadout for his guns that preferred over the usual official loadout. I forget all the details, but he did have more tracer than usual. So it looked like the fire coming from the back of the Lanc was unusually heavy, and he reported lots of fighters trying for an easier target.

[@robertfoster7807]

303 to small at 1000 yards its down 340 ft lb of energy at22 long rifles 160 ft lb of energy at the muzzle

[@M-demo]

Thank you for your post. You've touched upon the fascinating topic of removing gunners from the Lancaster Bomber, which would increase the aircraft's speed. The thought of increased speed is indeed great. My considerations are about how the bomber aimer and navigator would make adjustments for the increased speed, and regarding the Luftwaffe, whether they would readjust their tactics or need to increase engine capacity. This subject is more complex than I could ever fully understand and contribute to effectively.

[@ABaumstumpf]

There are many other more indirect benefits. Even if the gunners effectiveness was significantly reduced due to germanies armor on their interceptors - why did those interceptors have that heavy armor? Right - to not get shot down by the gunners that easily. It meant that interceptors were now heavier, slower and wouldn't be as effective. Any mission to intercept a bomber would also require more aircrafts as to not have them all be shot down. Many developments were deemed as "useless" cause the thing they were meant to defend against never happened.... yeah that does not mean at all that it didn't do its job. Modern tanks can still be damaged and destroyed by other modern tanks despite their vast defensive mechanisms. But that does not make their defence any less valuable as it also forces the enemies to have the expandiere of getting equipment with better offensive capabilities.

[@richarddufault]

It's a lot like hockey: even a bad goalie is a huge difference from no goalie at all.

[@AndrewDederer]

A little bit of comparison. When the B-29 squadrons switched to night operations at lower altitude, all the guns but the Tail pair were pulled (the gunners were retained). The reduced weight (and much lower operating altitude) both increased the bombers' speed and load (and took a lot of strain off the fragile engines). The "silverplate" A-bomb B-29s got a similar treatment, though operating by day (they needed the additional performance to clear the drop zone). Loss rates went down (Japanese radar and controller ability was not up to German standards, though they did adopt oblique guns in some models). By the Korean War, the guns were back in on the 29s and 50s (area targets were in short supply, day bombing was back).

[@CalibanRising]

That's an interesting point!

[@SoloRenegade]

what happens if you remove all gunners? you get the DeHavilland Mosquito. So yes, it would have saved lives, both by putting fewer men in harms way, but also by flying fast enough to evade interception. Keep in mind the B-26, A-26, and A-20 had success with just tail gunners by flying fast enough to make interception very difficult. And Mosquitos flew even faster, thus not needing even the tail gunner. B-29 flew so fast compared to the Japanese fighters that the Japanese never got more than one pass before ending up in a tail chase against computer controlled tail guns that outranged the Japanese fighter's guns. and then as you describe they even removed those guns.

[@vladimirpecherskiy1910]

And fact that they start to fly at night 😄

[@lqr824]

apples and oranges, though. B-29s were exclusively used in the Pacific, and were not meant to get rid of Japanese fighters to achieve air superiority in an eventual invasion: the fighters and pilots were being destroyed just fine. So, B-29's job was just to drop bombs, and as you say, guns weren't required for that. In contrast, over Europe, Allied bombing mission's top job was to get rid of Luftwaffe fighters. The entire premise of the idea of un-gunning bombers is absurd, because such a bomber wouldn't be able to achieve it's goal. D-Day would have been accomplished under a cloud of 109's and 190's and been a total failure.

[@SoloRenegade]

@@lqr824 The B-17s and B-24s in Europe weren't meant to sweep the skies of German fighters either. The B-29 could fly much higher and faster than previous bombers, making it difficult for the slower low-altitude optimized Japanese fighters to intercept them effectively. But even still, due to the B-29 computer controller turrets, the B-29 managed to score a higher kill ratio than most fighter planes of WW2. The older bombers such as the B-17, Lancaster, and B-24 couldn't fly high enough nor fast enough to evade German fighters to the same extent. The Germans were also better at coordinating intercepts and getting fighters airborne ahead of the bombers' arrival. The Japanese lacked this coordinated interception capability and suffered severe infighting and lack of communication between areas of responsibility.

[@Jimdixon1953]

Great video and some great comments! It’s a fascinating question with no easy answers.

[@CalibanRising]

Glad you enjoyed it!

[@joshm3484]

It only decreases casualties if you assume lack of gunners wouldn't also lead to an increase in bombers lost.

[@CalibanRising]

This was the basis of the theory.

[@Real_Steve_Sharpe]

@joshm3484 Do you want to know how I know you only read the title and watched the first twelve seconds of this before commenting?

[@kirktravis5780]

​@@Real_Steve_Sharpeoooops. I guess he'll get a low grade on his pop quiz.

[@Real_Steve_Sharpe]

@@kirktravis5780 👍

[@kirktravis5780]

@@Real_Steve_Sharpe don't think you understand what I meant.

[@JohnDoe-tx8lq]

Even if the individual weren't particularly accurate at shooting down fighters, they must have had a HUGE effect on diverting the fighters from taking thier time and attacking at point-blank range, from any angle. And every enemy fighter shot down was a lost plane and possibly pilot that won't come back. Very quickly, seems that no defensive guns means the attackers would just become much more aggressive & experienced with no risk to themselves. The bombers would have to become CONSIDERABLY faster to compensate. (...speaking as an armchair expert! :D)

[@kumasenlac5504]

The RAF had just such a bomber with the same payload as a B17. The USAAF declined to use them and the US aircraft industry refused point-blank to make them.

[@TheLucanicLord]

German night fighters used upwards pointing guns and attacked from beneath where there was a blind spot. They also used much larger guns (20 or even 30mm) that outranged defensive machine guns. The point of flying at night is to basically hide. If they can't find you they can't shoot you.

[@JohnDoe-tx8lq]

@@TheLucanicLord ...and why is this a reply to my comment?

[@wolfie54321]

@@JohnDoe-tx8lq 50mph is quite a bit faster if it's true. It likely would have taken them from below a fighter's cruising speed to above it. Maybe a good compromise would have been to keep the tail gunner, as the extra speed would force enemy fighters to attack more directly from the rear (harder to attack from weird angles if their speed advantage is less) and a tail gunner probably adds minimally to the drag compared to the turrets (at a guess anyway, hard to know without testing it).

[@SuperFunkmachine]

I remember reading a book by an engineer commenting post war that if they had built plane to work on the thin edge of reliability, engines that might fail, wings that might fall off then they could of flown faster and safer.

[@jasonhare8540]

I saw another study by the fat electrician and he used an actual military study just for the record about b-17s. The Japanese especially were so afraid of the air gunners that they tended to attack the B-17 head-on because it was initially not provided with guns in that area that could aim straight ahead. So there's definitely a psychological effect at least in the Pacific theater. And like you said the Germans changed their attack pattern because they were concerned about tail gunners so it seems like there was a psychological effect in the European theater as well. Between the morale as you mentioned and the psychological effects on the enemy I say it's worth the sacrifice and I'd be willing to do it. Though I would prefer to fly on old Lucy 666. That's the one the boys made themselves and mounted 50 cals directly in the front. There's a surprise for our Japanese friends in 1944 🤔🤣

[@jackcole3146]

There was a comment, I think in a Martin Middlebrook book from a ME110 pilot. He was quoted as saying that a 110 was barely faster than a well flown Lancaster. Food for thought.

[@foximacentauri7891]

I’d like to see that original quote, because that’s just not correct. Whatever „well flown“ means (in a straight line?), an aircraft is limited in speed by its power. A big 4 engine aircraft with half a dozen crew and a full bomb load will never be as fast as a twin engine interceptor with just 2 crew. What the pilot maybe could have meant is that the Lancs could fly in a straight line almost as fast as the 110s could climb towards them.

[@morgancoates6425]

@@foximacentauri7891 that is true but most of the older 110 was vastly underpowered and depending on the 110 also due to the heavy armament on the older models were very heavy and p/w ratio was severely affected but it also depends on the scenario such as a already empty lanc returning back with no ordnance and low fuel , it really depends on which bf110 and the state of the Lancaster.

[@DrTheRich]

an ME had different speeds throughout the war as they kept improving. If the lancasters got faster, there would probably be a push to improve the Me faster too

[@TheEulerID]

​​​​@@foximacentauri7891 possibly a 110 night fighter as they suffered from a huge amount of drag from the radar antenna and they had extra armour and guns. It seems the difference in top speed was about 30mph, or less in that guise, and that was not with an unladen Lancaster, but with one with maximum takeoff weight less a couple of tonnes of fuel.

[@jackcole3146]

@@DrTheRichTrue enough. This particular statement was made with regards to the Battle of Berlin, so late 43, early 44, which would have in all likelihood made the 110 he was talking about a G4, which was the last model produced (the H only reached prototype). The quote was that the speed difference was in the region of 10mph. The point being as this is about whether air gunners were a help or hindrance, even a 20mph increase in bomber speed would mean that the most common night fighters (110's) would not be able to engage them. There was also the fact that the performance of the night fighter variants were drastically reduced by the external antenna necessary for the Lichtenstein radar, without which the aircraft could not have functioned in it role. In light of the fact that the Germans never developed the technology to enclose antenna on aircraft, it's doubtful if the speed could be increased without a total redesign.

[@larryvrooman4672]

There are two separate concepts involved. 1) On the one hand, aircraft like the Mosquito could deliver 4000 pounds of bombs to Berlin, about the same load as the B-17, and the Mosquito could do it fast enough and high enough to make interception difficult. They could have also use a fighter bomber approach, using the fighter bomber variant of the Mosquito with a few lead bombers in the bomber configuration. Similarly the P-38 could carry 3200 pounds of bombs at high speed and fight its way home as a fighter. There were a handful of P-38s built with glass noses and bombsights for this purpose and were used for lead ships in bombing formations. 2) However, it was realized fairly early on that pinpoint precision daylight bombing wasn’t practical. More importantly, as the war progressed, German industry dispersed and decentralized the USAF recognized that strategic bombing itself was not very effective at reducing military production. But by that time, they also recognized that daylight bombers were taking a very heavy toll on the Luftwaffe fighter force. If nothing else, strategic bombing was strategic attrition of the Luftwaffe. Air gunners were essential to that end.

[@Crosshair84]

1. The Mosquito can only deliver 4,000 pounds as a single bomb. It could only carry 2,000 pounds as four 500-pound bombs. It could not carry the versitile bomb loads that the B-17 could. 2. The Mosquito was difficult to intercept because it was used in small descreet missions that were difficult to track and intercept. Were they do be used in a bomber stream, they would have been rather straightforward to intercept. 3. The Mosquito could never replace the B-17 for the simple fact that it was impossible to build enough Mosquitos. It wasn't just slapped together with whatever 2x4s you had lying around, it consumed vast amounts of high grade lumber, shipped from around the world. It used new exotic adhesives that were expencive to produce. It required skilled woodworking labor to construct. The production capacity was maxed out and it could not be meaningfully increased.

[@mayfieldcourt]

Excellent insightful and balanced analysis - thank you!

[@CalibanRising]

Glad you enjoyed it!

[@andrewmaville7797]

My Dad was an air gunner on Halifaxes. He told me about at least 4 occasions over 30 night missions in 1943 where either mid upper or tail gunner helped avoid disaster... Avoiding attack from below (his squadron routinely installed a view panel in the floor below and behind the dorsal turret) Avoiding rear attack by night fighter Avoiding collision with a Stirling over Peenemunde Spotting an airfield through transient gap in thick fog as crew prepared to point aircraft out to sea and bail out when fuel was exhausted on returning from mission The observation part of the role was clearly very significant

[@jbepsilon]

One thing IIRC Freeman Dyson mentioned in that interview that was briefly shown here, but not discussed in the video nor so far in the comments, was that a faster bomber would also spend less time getting shot at by flak, and thus reduce the loss rate to flak. I'm thinking that for a night bomber you'd probably still want the rear gunner, as the observer function is certainly useful. Would also be nice if the rear turret would provide a wide field of view and fire, so the gunner could have a chance of noticing enemy planes approaching low. For a day bomber you probably want more defensive firepower, but I do wonder how useful e.g. waist gunners really were, having to do high-angle deflection shots with only iron sights I suspect a great deal of luck would be needed to get any hits. Maybe an optimal balance would be having only nose and tail turrets (preferably with gyro sights as soon as those became available) with 4 .50 cal guns and a wide field of fire, and use the combat box as a way to cover the dead angles (plus escort fighters obviously)?

[@DERP_Squad]

I think you're definitely right about the rear gunner being needed as at least an observer. If a night fighter found the bomber stream without rear gunners, it could take out one bomber after another as long as it took out the rear most bombers first. With the rear gunner, the other bombers would take evasive action when the first bomber went down in flames, making the night fighter's job much more difficult.

[@rogerahier4750]

Since the British bombed at night, firing guns will just give them a better target. For the Americans bombing during the day, no guns would have just made it too easy and none of them would have come back.

[@PeterSlack83]

Very interesting concept. The USAF did indeed drop the two waist gunners to a single one later on in the war, but it was probably at a point when German counter's were all but gone.

[@MisdirectedSasha]

If I remember correctly, it was based on the observation that the B-17's waist was a bit cramped for two people, and that the gunners almost never fired at the same time anyway. I guess the idea was that the nose and tail gunners would call out which way the enemy fighters were going and the waist gunner would switch sides accordingly. It's worth pointing out that the chin turret was added to deter head-on attacks at about the same time as the second waist gunner was removed.

[@qtrfoil]

14:36. Pretty interesting reading on the "Serrate patrols" and the electronic warfare fight.

[@julianmhall]

Hi Phil, a few thoughts: 1. IMHO discussing the Fairey Battle is a non sequitur as it was only used in daylight raids in 1940 against a Luftwaffe at the height of its strength. 2. Weight saving versus performance. The Lancaster, Halifax, and Stirling all had maximum speeds of 282 mph at around 15,000 feet. The primary German night fighters - assuming the flight level of about 20,000 feet where the bombers would be - Messerschitt bf 110 had a maximum speed of 336 mph, the Junkers ju 88 290 mph. So yes technically the British heavies, if the 50mph claim is to be believed, could have had maximum speeds of 332mph. However that's a /maximum/ straight line speed, probably in daylight, not being shot at, ignores meteorological conditions like wind speed, and unencumbered by details such as /bombs/. Still slower than a bf 110. At a more normal cruising speed (Ju 88 230 mph, bf 110 302 mph, Lancaster 200 mph Halifax unknown but probably 200, and Stirling 200 mph) the bf 110 would beat the hypothetical 50 mph boost by 52 mph. The Ju 88 would only have been 20 mph slower. All speeds are from Wikipedia, so any lack of accuracy probably evens out. 3. The bomb aimer rarely using the nose turret is a nebulous issue as sometimes the wireless operator, not the bomb aimer, doubled up as nose gunner. In fact in researching I've come across more WOp/AGs than BA/AGs. 4. Navigation is one issue not mentioned. As you know, ironically the Navigator was the one crew member who could not see outside so relied on other crew telling him landmarks - for example 'There should be a river coming up on our left', mid upper replies 'No it's under us', so the navigator knows they're too far right and he needs to compensate. Taking out the gunners ribs the navigator off two pairs of eyes; the pilot is busy flying, F/E busy with the engines, W/Op can't see out without leaving his position, which leaves only the bomb aimer. One third of the Navigator's eyes. How many were lost by being in the wrong place such as over defences when the course was plotted past them? 5. The theory relies on speed /alone/ as a defence. Gary Powers found out in the 1960s that's a bad idea. Once you've been spotted all the attacker has to do is adjust their deflection. If they hit an engine your speed advantage has gone. Besides, the bombers were /attacking/, so all an increase in speed would do is accelerate contact with the enemy. A speed advantage is no use when the enemy is //in front of you//.

[@stevekaczynski3793]

Navigators in Lancasters at least had a small "astrodome" - the navigator could look up through them, see the stars and use them to estimate position. As a general rule, though, yes - navigators did not see outside.

[@julianmhall]

@@stevekaczynski3793 True about the astrodome but that's not at the navigator's curtained cubicle.

[@andrewallen9993]

Well the safest Bomber to fly in terms of life expectancy was the De Havilland Mosquito bomber which was unarmed and could carry a similar bombload to a B17 over longer distances. The fighter bomber version could not only drop bombs (not into a pickle barrel as apparently a B17 could but in reality onto a particular building or brick wall) as well as scare the crap out of Luftwaffe fighters on its way back to base.

[@philhawley1219]

At the start of the Mosquito's career a bright spark at the Air Ministry suggested a mid upper turret would be necessary. Geoffrey de Havilland retorted that if a turret was fitted it would be very necessary but without one it was totally unnecessary.

[@andrewallen9993]

@@philhawley1219 :)

[@SoloRenegade]

Keep in mind the B-26, A-26, and A-20 had success with just tail gunners by flying fast enough to make interception very difficult. And Mosquitos flew even faster, thus not needing even the tail gunner. B-29 flew so fast compared to the Japanese fighters that the Japanese never got more than one pass before ending up in a tail chase against computer controlled tail guns that outranged the Japanese fighter's guns.

[@BreandanAnraoi]

If a B17 hit a pickle barrel, it was a fluke. The Norden bomb sight accuracy was a total myth. Mosquito was by far the best bomber.

[@davidbriggs7365]

​@@BreandanAnraoiThe Norden Bomb Sight was accurate, when flying over American southwestern deserts in clear weather with no opposition. The problem was that flying over northwest Europe never allowed for the same accuracy.

[@andrewwilson6085]

Some Lancasters were fitted with the Rose turret, which had better vision and heavier guns. The blind spot on both Lancs and Halifax was underneath. Earlier Whitleys were fitted with a turret below

[@shero113]

The Whitley 'Dustbin' turret left a hole that was retained, and used for parachutists, for which many Whitleys were later used.

[@user-qs7gx7rp7m]

Excellent !

[@CalibanRising]

Glad you like it!

[@duncanhamilton5841]

The argument For the Mosquito overlooks the fact that German flak and nightfighters were set up to deal with the most numerous threat - the heavies. If you remove Lancs, Halifaxes, and Stirlings from the fight, and replace with something much faster and lighter then it's safe to assume the Germans would have altered weapons and tactics to suit. The Bf.110 and Ju.88 were good enough for dealing with heavies, but something else would have had to be developed or deployed to deal with a Mosquito. There's also a cascade effect - for example, it is often pointed out (correctly) that if nothing else, the bombing campaign sucked in a huge amount of resource on flak batteries. If you're zooming about in a plane that's broadly immune to heavy flak by virtue of speed, size, and lower radar signature, then there's a real potential for that huge enemy resource to be used elsewhere, such as on anti-tank duties. Further on that vein, whilst the Mossie had a good bomb load, it couldn't carry the specialist stuff like Tallboy or Grand Slam - so there's less resource used in hardening U-Boat pens and so on.

[@stevekaczynski3793]

Goering admired the Mosquito and was somewhat obsessed with it. The Germans never had a real answer to it, though in the Len Deighton novel "Bomber", a supercharged German fighter manages to shoot down a target-marking Mosquito. Trying to escape, it drops its markers short, resulting in a village near Krefeld being obliterated by the air raid rather than Krefeld itself. I don't know if the supercharge idea happened in reality, though Deighton researched his war novels well.

[@richardvernon317]

@@stevekaczynski3793 A German night fighter pilot actually did that, removed a butt load of weight from his Ju88 (Armour, Schräge Musik, rear gunners and ammo), Got nitrous oxide injection fitted to the engines and went out and killed mosquitos over Berlin. The reason he didn't get loads of them was because the Mosquitos were fitted with Monica tail warning radars and managed to evade or out run any aircraft that they detected coming up behind them.

[@darrenharvey6084]

With no gunners to deter German night fighters the German pilots would have no fear of being killed and would just stay on the attack until the bomber was destroyed .

[@johncostello3174]

Personally I think fairly early on in 1942 Bomber Command should have set up an experimental squadron of Lancasters where the nose and mid upper turrets were removed and the tail turret beefed-up. I'm no expert but I think the majority of night fighter attacks came from the rear. I would either replaced the 4 x 0.303 guns with 2 x 0.50 guns or better still completely redesign the rear turret so it's big enough to accommodate 2 x 20mm Hispano cannons. The German night fighters were standing off at 1000+ yards where the 0.303s could do little if any damage and opening up with 20mm and 30mm cannons. So yes you'd gain a bit of weight at the rear turret from the new guns and heavier ammo but probably more than offset that by the loss of the mid upper and nose turrets. And the weight saving of no mid upper gunner, automatically reducing crew casualties by 14% by carrying one less man. Later in the war I think a very short range (up to 1000yrds) 'Monica' type of early warning device could have been installed to give warning of Shräge Musik equipped night fighters. It could even be wired to automatically fire a couple of downward firing 0.50" or 20mm guns to hopefully scare off the night fighter or at least put him off his aim. Of course crews would have to be told to avoid flying under each other. It's all easy in hindsight.

[@lqr824]

No no no, the entire point of the bombing was to get rid of Luftwaffe fighters so an eventual invasion would have air superiority. Why experiment with a bomber with fewer guns, when it's obvious such a bomber would not be able to accomplish the mission of destroying fighters? If the goal was just to go fast and drop bombs, they could have done it with P-38s, just about impossible for a German fighter to catch, and enough payload to carry the mere couple of tons of bombs often carried by the big 4-engine bombers.

[@olivierspencer9694]

Worth noting that the Lancaster was originally designed with four turrets, including a ventral turret, which was removed soon after introduction due to its ineffectiveness. I wonder how useful it may have proved to be as a 'spotter' position against the Luftwaffe's later 'schrage music'?

[@shadeburst]

8th Air Force gunners were so effective that attacking fighters usually adopted the head-on attack in order to present difficult and momentary targets to waist and rear gunners. Schräge Musik was not a desperate alternative but a highly successful technology, with night-fighter crews frequently achieving two or more kills in a single sortie. Those apart, a very enjoyable doccie that dodged no important issues.

[@xmeda]

No. Frontal attacks were done because of armor layout on bombers which counted with attacks from behind, while frontal attacks effectively penetrated cockpit.

[@antonrudenham3259]

I've actually thought long and hard about this very subject for years now. The experienced pilot would go to great lengths to achieve a higher altitude, they'd go 'up the stairs' which involved climbing to as high as conventionally possible then accelerating to max speed and throw the flaps down which would bump the bomber up a few hundred feet, retract flaps sharpish, then repeat until no more height could be milked out of the aircraft, they found that the Lanc could retain any height they got it to but could not climb there through ordinary means with a full bomb load. Alternatively they would surreptitiously dump their cookie in the 'oggin' on the way whereupon the Lanc relieved of 2-4 tons of kaboom would climb like an angel. Being amongst the highest in the stream meant that for a fighter to get to them it would have to climb through the stream and why would it bother to do so when there's a plethora of contacts all around them, poor sods one and all? Obviously if all the Lancs were lightened as per this discussion then they'd all be at a higher altitude thus fighters would be up there anyway but even then there'd be crews going up the steps and cookie dumping so pilots always knew that height was everything and I'd say that initially crews would be against the idea but if forced upon them they would quite quickly see casualty figures come down and that would surely change their minds. Almost all BC casualties were sudden and seemingly unattributable and most losses could only be described by other bombers in the stream who witnessed it, at de-briefing they'd say something like "Saw a Lanc over to the right and below us get the chop just after the turning point, no tracer, no fighters seen, just a burning Lanc, no chutes seen". The relatively few crews who returned after being attacked by fighters would say things like "Just before Emden Nobby in the rear turret yelled fighter, corkscrew port and we never saw it again" But Nobby's were sadly very rare. We know now that it was 'Schrage Musik' or even a conventional fighter sans tracer, maybe even an exceptionally (un) lucky flak hit but crucially at the time the crews did not know that, some of the more perceptive aircrew suspected it but nobody knew for sure until a JU88 so fitted turned up at an RAF base. . But my point is that most crews never saw what killed them, and killed they were, in their thousands and so the guys who could have told BC that they never saw what hit them were all lying dead on the German plain. If the rear gunner hadn't had a big old carousel of a turret below and in front of him he may have been able to check his 6 o'clock low more thoroughly and tell his pilot to corkscrew. For the reasons outlined above there wasn't enough evidence to motivate BC to undertake such a vast and controversial effort as removing all defensive armament even though the bombers would obviously enjoy a much better flight performance without the guns, hydraulics, ammo and men and incidentally be considerably cheaper and quicker to build, something that would certainly have appealed to Harris. My personal conclusion is that BC would have been more efficient without armament and this is born out to a degree by the fact that British post war bombers had no defensive armament, almost as if Dickens did ultimately advise the air ministry of his findings once Harris had left. Personally I would have recommended the removal of all armament and associated ancillaries and the fitting of a perspex tail cone containing the radio operator and his equipment, he would then act as a lookout while listening in to his net and enjoy better visibility than possible from a turret. Incidentally, I enjoy modelling and years ago I butchered an Airfix Lanc into that configuration and it looked 'right'.

[@SoloRenegade]

what happens if you remove all gunners? you get the DeHavilland Mosquito. So yes, it would have saved lives, both by putting fewer men in harms way, but also by flying fast enough to evade interception. Keep in mind the B-26, A-26, and A-20 had success with just tail gunners by flying fast enough to make interception very difficult. And Mosquitos flew even faster, thus not needing even the tail gunner. B-29 flew so fast compared to the Japanese fighters that the Japanese never got more than one pass before ending up in a tail chase against computer controlled tail guns that outranged the Japanese fighter's guns.

[@antonrudenham3259]

@@SoloRenegade Well no, a Lanc could never have had the performance of a Mosquito, it's performance would obviously have improved but it wouldn't be in the near invulnerable category of the night time Mossie so the question still stands. A 4 engined Mosquito is an interesting proposition though, maybe add another pair in longer wings and extend the fuselage. Plenty of US twin engine mediums were lost to fighters but they were day bombers and all day bombers are vulnerable to attacking fighters so losing their defensive armament may have caused higher losses. Plenty of Mosquitoes were lost during daylight ops too and as you say, they were the fastest of our combined fastest bombers. We're primarily talking about night raids here though and I reckon a light Lanc would still have suffered fairly heavy losses but not as heavy as the heavy Lancs actually did.

[@SoloRenegade]

@@antonrudenham3259 you're changing the conditions of the question. 4 engines is not part fo the question, nor is day/night specifics. i don't give a crap about your cherry picking childishness.

[@antonrudenham3259]

@@SoloRenegade I'm sorry, I don't put up with whiny children so this will be my last comment to you.

[@SoloRenegade]

@@antonrudenham3259 "I'm sorry, I don't put up with whiny children so this will be my last comment to you." that's a rather whiny comment right there. I notice you had no retort nor counter argument to any facts I shared. Your comment was rather pointless. if you didn't want to talk to me, all you had to do was not respond. but you're clearly a whiny and petty person.

[@KGmVN]

i think they should keep 1 turret at the back , that will make the boomer not entirely defenseless and can also disturbing the fighter try to intercept

[@amptechron]

Well done

[@geordiedog1749]

See mosquito Bomber version. I have often asked if we had just gone with mossies instead of x4 engine heavies would we have had a better result all around? Great vid.

[@briancavanagh7048]

Certainly would have been less expensive: in less crew & associated support & training & housing, less losses, cheaper twin engined aircraft not a 4 engined heavy.

[@CowCommando]

How many more mosquitoes and therefore pilots do you need to have an equivalent bomb load?

[@grahamstrouse1165]

Mosquitos weren’t cheap is the problem.

[@QofSQ]

Dropping gunners (and defensive armament generally) was the way development moved following the war, especially in jet bombers. Personally, I think that early in the war the gunners had some use for defense against early fighters. However the fighters' improving (armament especially) performance means they become mostly useful for spotting. A glazed, aerodynamic rear position may have accomplished the same role and improved the range/speed/payload of the bombers. A very interesting topic though and I really enjoyed the video.

[@BumroyV2]

This is unrelated to the topic of the video, but I love that you use IL-2 1946 for the B-roll footage. I adore that game.

[@CalibanRising]

I love using it for B-roll because it has so many aircraft. Obviously it would be great if the graphics looked as good as more modern games, but I've never found another one with its range of options. 😀

[@alzaidi7739]

I'd like to see a Mosquito analysis. Fewer crew losses, fewer plane losses, maybe you could build 3 Mosquito's for the cost of one Lancaster, Especially if you consider the relative loss rate,

[@davidgreen7392]

I think all that needs to be done, is to stop politicians from drumming up needless wars -- unless they go to battle themselves.

[@concise707]

I concur your sentiment 100%, with the proviso that defeating Nazism was not a needless undertaking.

[@kitbag9033]

And many of the politicians at the time had intimate experience of the Great War.​@concise707

[@mountainhobo]

"stop politicians from drumming up needless wars" - Yep. Send a social worker to Hitler, Stalin, or Tojo. What a childish naivete.

[@daveharrison61]

That and their sons. Very much in the model of the nobility of the middle ages. It didn't prevent wars. But it DID put on the block the people that caused those wars...

[@ATomRileyA]

Imagine how many lives saved if they removed the engines and the bombs 100% safe now :) /s

[@skenzyme81]

The question was answered by time. It didn't take long after WWII for bombers to lose some and then all their defenses.

[@usslexingtoncva-1639]

it mostly came down to march of technology. Though US B-52s did keep a rear gun for quite some time.

[@user-po3ev7is5w]

No. We already know this from experience during that war when gunners were disabled. It didn't take long for attacking fighters to notice when a turret or waiste position wasn't manned. They would attack from that quarter.

[@bernardedwards8461]

No need to abandon gunners completely, but get rid of heavy turrets, and get the wireless operators and bomb aimers to operate turretless guns when they weren't doing their main jobs, and pay them a bit more for the extra work. Lighten the aircraft, reduce the crew numbers, and take whatever streamlining measures are practical. Every tenth bomber should reverse this, and have increased armament and more armour, with no direction of approach not under observation.Bombload would have to be reduced to compensate. The main aim of this aircraft would be to cause damage and casualties to enemy nightfighters, so they couldnt throw caution to the winds but would have to bear in mind that the bomber they were approaching could be a tiger.

[@kotori87gaming89]

lightening bombers to increase speed is a good idea, but the "battle" bombers is not. The Allies did try putting heavily armed bombers with no bomb load into their bomber formations, but it caused more problems than it helped. Mainly, the regular bombers would get lighter and gain speed when they dropped their bombs, while the battle bombers would not. This would make the return trip much more demanding on the battle bombers, and they had a much higher loss rate as a result. For all the trouble they caused, battle bombers did not shoot down German fighters at a higher rate, nor did they discourage German fighters from attacking.

[@kennethferland5579]

Q-Bombers, an interesting concept.

[@NachtJaeger110]

Excellent video! Another thing to consider: how fast could the standard German night fighters (Me110, Ju 88, Do 217) with their huge drag inducing antennas, droptanks and additional guns actually go? I don't think they were that much faster than the bombers? I think even having slightly more speed for the bombers could have made a big difference. Also, having a single observer facing to the rear behind an aerodynamic plexy to warn the pilot and order evasive maneuvers could have been the perfect compromise I think

[@Fidd88-mc4sz]

The development of the Rose turret was NOT at Harris's behest. All turrets hitherto had combinatory movement of x and z axis controls to describe a diagonal movement, which is difficult as the operator has to manipulate two controls. The Rose-turret had a double gimbal where purely diagonal movement of a single control was made, then the necessary component of the x and z axis movement was resolved by the mechanism to cause the required diagonal movement. This greatly improved tracking and therefore gunnery. The development of the turret was an unofficial one between the inventor (KH Nicholls) who actually worked for the Admiralty on gun-laying, and Rose who was visiting Nicholls firm on other business. Rose saw the potential, who ordered further development completely outside of normal RAF procurement. It was then designed to take two 0.50 cal Brownings, mounted low, which allowed for a large clear-vision panel, through which the gunner could bail out of. Gp Capt Rice of 1 Group then saw the turret when on other business, leading to an eventual production order from Harris in May of '44 to up-gun Lancaster rear-turrets. At that time daylight operation of Lancasters was being anticipated, and .303 turrets were inadequate, however adaption of existing designs of BP and FN turrets for bombers had all experienced difficulties with retrofitting 0.50's. The bulk of the development was completely unofficial, private, and not in response to any design brief from the RAF. (Material culled from R Wallace Clark's "British Aircraft Armament vol 1)

[@dinkaboutit4228]

"Climb into this metal tube and sit on your hands while you're shot at for 8 hours" is a MUCH bigger ask than "climb into this metal tube and go fight!" I think taking their guns would have made the 25 or 30 missions a phsychologically impossible task.

[@FNHaole]

My YT algorithm produced a documentary on the XB-42 (1st flight 1944), after I’d viewed this. The aircraft was purpose-built to realize the entire premise of this vision.

[@daddynunya9045]

I wouldn't think air guns or air gunners would have provided any defense at all. If air guns were effective we wouldn't still be using gunpowder.

[@neiloflongbeck5705]

There's another argument. Why weren't medium and heavy bombers built without defensive armament. This had been proposed by George Volkert of Handley Page in 1937 in response to Air Ministry specification P.13/36 (which gave us the Avro Manchester and the HP.56 (which was redesigned to become the HP.57 Halifax)). His proposal was faster then the HP.56 whilst carrying a heavier bombload. Whilst it was accepted that the speed advantage would eventually be overhauled, there were members of the Air Ministry and RAF, specifically Air Marshall Ludlow-Hewitt CINC of Bomber Command, who wanted such a bomber to be tested.

[@grahamstrouse1165]

The British reliance on .303s was the the problem.

[@kenibnanak5554]

Ir would have increased bomber loss for sure. My dad was a waist gunner (B26) and although he was no where near an Ace, the 2 or 3 Nazi or Italian fighters he did shoot down were pretty much capable of, and determined to, down his bomber before the bullets he fired terminated their plans.

[@catcatcatcatcatcatcatcatcatca]

Very basic infantry drill/consept is reacting to ambush with RTR: Return fire, Take cover, Return accurate/effective fire. The key consept is that returning even inaccurate fire is the highest priority, as it affects the enemy psychologically and without it the enemy is free to shoot from positions that are best for shooting - not having to weight in the risk of getting shot back at. The german strategy of approaching from below was itself an example why the gunners were effective: just one blind-spot lead to a very effective strategy. If there was nothing but a blindspot, this would have been much more efficient and deadly.

[@paulineson4876]

I think you make valid points with this research. At least they could have tried it on a small scale to see if losing the guns would have made a positive effect. Particularly with the Lancaster. They already had some experience losing a gun turret on the dam buster missions.

[@TheSound0fLegends]

Crews generally learned that gunners firing at night with .303 just gave away the bombers position rather than do any real damage to the attacker. So gunners were used as look outs to tell pilots to begin evasive manoeuvres like the corkscrew in the Lancaster.

[@Therearethings8148]

Fewer soldiers in the trench - fewer casualties. Deadly logic.

[@richardstuart325]

My uncle was an air gunner in the rear turret of a 61 Squadron Lancaster. His crew seemed quite trigger happy and opened fire on night fighters on a number of officially recorded occasions. His mid-upper colleague was credited with the probable destruction of a Ju88. On one occasion they saw a night fighter in front of them and tried (unsuccessfully) to attack it with the front turret guns. They lasted over 20 ops before a flak shell exploded directly underneath their aircraft and brought them down. Only the Canadian mid-upper gunner survived. Arguably, the gunners saved the crew from fighters on a number of occasions, but they could do nothing about the flak that finally killed them.

[@CalibanRising]

Brave lads. Thanks for sharing their story with us Richard.

[@albertetzel5925]

Think people forget a pilot is more likely to rush aiming or not attack at all if the prospect of getting shot back is on the table. No gunners, escorts either not present or distracted, no real reason not to take your time lining up a good shot.

[@WhoThisMonkey]

That's a hypothesis, not a theory. It is extremely frustrating when the vast majority of people don't understand the difference.

[@CalibanRising]

Ok, I see your point. However, the suggestion was based on a study Dyson previously carried out, so isn't that more of a theory than a hypothesis. Asking for a friend.

[@michaelpalmer4387]

My great-uncle was a turret gunner but he was killed in a plane crash rather than through enemy action in 1943.

[@xardozz]

Lots of stuff wrong with this proposal. A. Anglo-American airstaff was controlled by Strategic Bomber in-groups. 2. Mossies actuall could carry a significant bomb load, but their seccess was largely due to how well they were implemented. C. Removing gunners would have lessened the impact of the #1 reason for the bombing of enemy targets... which was the destruction of the Luftwaffe. Btw... when it comes to airspeeds of heavy bombers "Greg's Planes and Automobiles" does a great job of breaking it down.

[@gstgst6334]

Impossible to comprehend the stress of making decisions on this scale. If I remove the gunners maybe i save lives or maybe our bomber force gets decimated. Every decision that moves casualty statistics a percent here or there adds up to tens of thousands of lives.

[@Gloomendoom]

From late 1943 Fishpond started to be fitted to H2S equipped bombers. This allowed the radio operator to see aircraft approaching from underneath in cloud or complete darkness.

[@modavies8401]

A dorsal gun turret was experimentally fitted to one Mosquito, the performance loss was catastrophic. I suspect that the much lower casualty rate for the unarmed mosquito proves your case without bringing in the Lancatrian red herring.

[@RobertWilliams-us4kw]

Thank for informing us of this snippet of obscure history Caliban Rising! I very much appreciate your reseaand analogy, given the horrendous casualties that the Allied bombing campaign endured. I've always thought that with all the operational intelligence and data collated by the RAF and USAAF, that more could have been done, one way or another, to mitigate such loses - period. As you rightly allude, RAF formations could have been revised, as too an adoption of a ventral/belly turret [I know that there were studies and trials of such ventral turret on a Lancater - the said studied turret arrangements position be utilised for the H2S radar dish in later Lancasters and Helifax. Just as I also appreciate the vast length of the Stirling, Lancaster and Halifax bomb bays]. I've personally, never understood why, with early combat experience clearly highlighting the inadequacy of RAF bomber's use of 7.7mm (.303 in) rifle calibre MG's as their bomber's principle defensive weapons [I know and appreciate the interwar reasoning for adopting the standardisation of adopting 7.7mm (.303 in).]. I also know that the experimented with cannon armament for their bombers. But why they didn’t adopt, at minimum, the longer ranged, heavier hitting 12.7mm (.50 in) has always frustrated me. Note - Lancaster ventral turret: www.lancasterraf.co.uk/fn64-turret/ www.maquetland.com/article-phototheque/1433-avro-lancaster-mk-x-duxford Halifax ventral turret: www.bombercommandmuseumarchives.ca/airgunners4.html Regards

[@ahmedabdolghani8879]

“Trying to fight back against a mogger with your personal knife is dangerous, therefore, you must throw it away immediately”

[@matthewhuszarik4173]

The de Havilland Mosquito could carry 2000 pounds of bombs and the Lancaster could carry 14,000 pounds. So it would seem to take seven Mosquitos to replace on Lancaster. The extra fuel required would also be an issue. The 14 pilots and navigators/bombardiers of the Mosquitos would be double the manpower of the seven man Lancaster crew and they would be significantly more expensive to generate as a gunner is much easier to train than a pilot or navigator/bombardier.

[@gwarner99b]

A good point. However, Mosquito crew were much more likely to survive and fly many more missions, more effectively.

[@slome815]

Every source I have ever found claims the mosquito had a bomb payload of 4000 pounds. A lancaster could carry a lot, but compare this to a B17's payload of around 5000 pounds and it doesn't compare bad at all.

[@ivaniuk123]

If you removed those turrets than it would create a blind spot the enemy aircraft would expoit. That took me 15 seconds to come up as a valid counter point. I'm sure this guy was also part of the genius group that told the British to bomb at night to lower their casualties and as a result the British had really poor bomber hit averages.

[@holimoli8802]

the level of precision required to do that is impossible, just between the bf109 and halifax is a speed difference of 72m/s, assuming a 200ms human reaction speed, the pilot could react to changes every 14.4 metres, this would take literal hundreds of metres to set up a precise shot and to be flying in a very straight line which leaves the fighter vulnerable to escorts, and even without escorts what youre proposing is just absurd

[@jimthorne304]

Very interesting discussion. One consideration might be that of the quality of the bombing; Area bombing was of dubious effectiveness, Mosquitos could bomb much more accurately, so were able to achieve better results with less bombs, also less aircrew. That reopens the debate about whether it was more effective to accurately bomb known targets of value, or to carpet bomb a large area which probably contained significant targets. I would say that in terms of inflicting significant damage on the enemy carpet bombing was not effective, in particular it didn't lead to a general collapse in civilian morale. I don't know if there were any studies of the effectiveness of strategic bombing but the campaign against communications is said to have been a major contributor to the decline in German war production.

[@nhansen197]

I doubt the added speed would have been enough to make a significant difference.

[@777NCM]

My father joined the Navy after the bombing of Pearl Harbor. He trained to be the rear gunner in a dive bomber. But when he arrived in Hawaii, they had determined those were ineffective and he ended up on Ford Island serving in communications instead.

[@jeremyfisher8512]

I think putting in some gun ports and machine guns is a lot easier than just making more aircraft entirely and training more pilots