SHORT: Aldis Signal Lamp

Like what I make? Want fewer sponsorship ad reads? Consider contributing to my Patreon at / ourowndevices
First developed for naval use in the 1860s, signal lamps are still used today for communications during emergencies or when radio silence must be maintained. The handheld 5" Aldis Lamp was invented in 1941 and used throughout the Second World War and for many years afterwards for both naval and aerial signalling.
SOURCES:
web.archive.or...
www.atc100year...
www.deadmedia.o...
www.jproc.ca/rr...

[@ThePerfectRed]

As a German and reading "Aldis Signal Lamp", I thought a local supermarket chain launched a new product..

[@jackx4311]

*:))*

[@dogcarman]

🤣

[@glennso47]

Me too. 😮

[@LymanPhillips]

Good one. My wife loves Aldi here in Massachusetts.

[@ThePerfectRed]

@@LymanPhillips Aldi has sites in the USA? I did not know that, I though it was present only in Germany.

[@WgCdrLuddite]

Many years ago a chimney sweep came in to my work because the bulb in his lamp had blown.He was pleased I recognised it as a Royal Navy Aldis Lamp. I wasn't confident about sourcing a replacement for him but it turned out they were still in production (1990s) !

[@tsbrownie]

Regarding aircraft signals, they are used so infrequently these days that towers often forget. I had to circle an airport 5 times signalling the tower before they finally caught on that my radio was out and used their signal gun.

[@iterativeimprovements1713]

Your videos are incredible, ive watched the majority of them over the last few days. The only weird part is that KZbin hasnt shown me your channel before now!

[@user-de3jw3zm2h]

I couldn't agree more and have also been watching a large number of them lately. After this one The Last Shanty got stuck in my head: Well they gave us an Aldiss lamp so we could do it right They gave us a radio, we signaled day and night We know our codes and ciphers but what's a semaphore?

[@bladder1010]

On the contrary, Gilles' videos are very credible. 😉

[@fredblonder7850]

One June 11, 1940 - after the Second World War was in full-swing, but the United States was still neutral - my Father was in the crew of the S. S. Washington (United States Lines) ferrying American Citizens out of Europe. At about 5:00 AM, the ship was stopped by a submarine, and ordered to abandon ship. Captain Manning conducted a long-winded discussion with the commander of the submarine by Aldis Lamp (oddly, in English) eventually convincing him that the Washington was a neutral ship carrying only civilians. The submarine was not identified, but my Father insisted it was Italian. My Father stated that Captain Manning’s hair turned white overnight.

[@FiveRustyNails]

I made one out of a fruit can and bicycle lamp when I was a kid. I never found anyone else who'd got one so I was on my own and it didn't last. Another great video, I love this shorter format

[@radhakrishnansivaramakrish9902]

It was just a chance to stumble on your video and enjoy thoroughly. I bring an Air traffic controller can vouch we still use Aldis lamp

[@LBG-cf8gu]

new guy here, subbed, i recall aldis lamps were used by raf coastal command to preserve radio silence glad i stumbled onto your history channel. thx.

[@kitpong1777]

I learnt and got certified in proficiency on Morse Code as a Scout back in the 1970s. I'm pretty rusty with it these days, but its something you never really forget. There is a modern laser equivalent of an Aldis lamp that can send , with a compatible receiver, rapid bursts of large amounts of digital data and messages , unjammable, and practically undetectable unless you are in the exact direct line of sight.

[@HarryWHill-GA]

One cold and mostly clear night in the north Atlantic we managed over the horizon signalling by flashing light. The signalmen aimed the light at a convenient cloud and used it as a range extender. The other ship answered back and we had comms while maintaining radio silence.

[@Floris_VI]

I only found your channel a few weeks ago but its so nice to have a truly educational channel with a very well spoken and well informed host, much appreciated

[@robertozee5024]

It took me far, far too long to find this channel. Always happy to see an upload!

[@neilwilson5785]

Love the channel, and would like to say that your opening sequence is amazing. So many KZbin channels should learn from this concise and informative format.

[@Kav.]

4:51 I've owned a 5" Aldis like yours since I was 14 and only now have I actually realised what the trigger above is for! I always thought it was just a guard, the mirror on mine has been blocked from moving very far by an adjustment screw but does still work. Mine plugs into car power sockets, I imagine at some point for use on somebodies boat. I have one of the red filters you mention also. Mine only has the open notch and optical sight, no peep sights on mine. I had always just assumed they signalled using the normal trigger. Now at some point I'll fulfil my childhood promise of learning morse code and having a practice with it.

[@quirkygreece]

Great and concise history and description - cheers.

[@tenacious1963]

In Australia, I worked on several ex-oil rig tenders and they all had Aldis lamps as a survey requirement. These had to be shown in good working order as a visual means of signalling without power,(they used 24 volt batteries) other than flags. The surveyors were pedantic about them. Enjoying your work, please keep it up.

[@mxecho]

A tale so gripping that they said it could not he filmed! A unique event in cinema history: 'Julius Caesar' On an Aldis Lamp!

[@isaacwalters747]

Aldi's.... Nevermind...

[@cmdredstrakerofshado1159]

Awww Man I was hoping for your rendition of Last Tango In Paris on a Aldis Lamp 🤣🤣😉. No seriously another great A+ grade video on your channel I am really enjoying your videos on classic practical technology of both vintage and modern eras. Again keep up the great work! 👍

[@LeCharles07]

It still blows my mind that people can actually be fluent in Morse code.

[@jackx4311]

I was a radio mechanic in the RAF, and one night, a terrific solar storm kicked off, and, one by one, all of our high-speed multi-channel teleprinters, sending signals via short wave radio, died. But all of the radio operators who ran the teleprinters were trained in Morse code, so my mate Derek got the NATO Standard Morse key out of the cupboard, dusted it off, set the gap between the points down to about 5 thou, and started sending - via a 3.5kW transmitter! I sneaked up behind him to watch, and his hand was moving so fast, it looked like an out of focus picture. I whispered to another radio mech, "I didn't know it was possible to send Morse that fast." *Without stopping sending,* Derek looked over his shoulder and said: "This isn't *fast* - it's only about 50 words per minute!" To put that in context - most amateur radio operators think sending at 20WPM is fast! Derek told me later that at the end of his training as a radio op, he could send and receive at 55WPM . . . If you want to hear what 50WPM sounds like, follow this link, and set the playback speed to twice normal - yikes!! kzbin.info/www/bejne/rauypqqZZZKaoas

[@jackx4311]

Bear in mind that Morse operators go through the same process we all go through, learning to read (and the same process that musicians use, learning to read music scores). We start off recognising letters, then progress to reading words, one at a time, then start to recognise common phrases, and end up being able to read sentences perfectly, without needing to know exactly which letters formed each word. So Morse operators sending and receiving very fast aren't picking out individual letters, or even words - they're hearing complete phrases and sentences (just as we all do when we listen to somebody talking). As a matter of interest, I bet you already know some Morse, which you learnt the best way; not by counting dots and dashes, but by hearing it as pieces of *music* - which is why you know the Morse code for the letter 'V'. It's the first four notes of Beethoven's 5th Symphony:- Dit, Dit, Dit, DAH!

[@neilspires7259]

​@@jdlives8992Please say you're not joking this is hilarious

[@neilspires7259]

​@@jackx4311how could someone hear phrases at a time when the average bandwidth is 8-12 words per minute? I'm probably overthinking it

[@Nupetiet]

@@neilspires7259 People who know Morse that well are usually talking to each other much faster than that! Many experienced operators can handle Morse at over 35 wpm.

[@casperleeberg]

Aldis lamps are still standard equipment on Merchant vessels.

[@billyhouse1943]

Thank you.

[@howardmaryon]

Memories of military school in the 1960’s, where we were taught how to use a large tripod mounted Aldis shutter operated and the handheld. As part of our seamanship studies, teams were sent out into the extensive grounds of the school and tasked with sending scripted morse messages to each other with the handheld units. There was even a very large shutter version from a WWII battleship mounted at the top deck of the main buildings tower.

[@pypes84]

Mr Messier, please keep making these videos. In my very considered and learned opinion your channel is undersubscribed by at least 1 if not 2 orders of magnitude, and your ability to take a simple tritium keyring light and segue into a 10 minute treatise on the design and use of nuclear ordinance speaks deeply to me.

[@Terper_]

Just discovered your channel, looking forward to watching all of your great content. Thank you Gilles!

[@andrewentwistle9694]

Just wanted to mention, the company I work for is still making handheld Aldis lamps and they still sell well..

[@Steve-GM0HUU]

👍Thanks for video. I do like these videos - brief yet very concise and well presented. Most of all, interesting.

[@bobstay1]

When i was little we had a handheld Aldis lamp in the family sailing boat; it was mainly useful as a searchlight. It was plugged into the boat's 12v electrics rather than battery operated. As i recollect, it looked very much like the one in the video, but I think the shuttering mechanism may have been different - it seems to me that the cylindrical shaped bulb had an opaque outer end, and the parabolic mirror moved back into the lamp housing to expose light. Am i right or is my memory playing tricks? (Was over 30 years ago) Thanks for the excellent content👍👍👍

[@malcolmgibson6288]

Always interesting subjects, thanks.

[@hugodesrosiers-plaisance3156]

I've only discovered your channel, and I quickly subscribed. You have some impressive material on here. Great job, friend!

[@catcatcatcatcatcatcatcatcatca]

I wonder if the technique will get digitalised in future, as infrared/visible spectrum light is rather hard to flood by the enemy counter-signal efforts. They do require a direct line of sight and have a limited range because of diffusion, but those downsides are the reason why it’s hard to jam, or intercept.

[@TomFarrell-p9z]

Especially like the communications devices! Thank you Gilles!

[@thatsthewayitgoes9]

Thank you. I do have to say, the British sure have come up with A LOT of stuff !

[@kdupuis77]

I am a merchant mariner and we STILL are required to carry an Aldis Lamp as required communication equipment on the Bridge of our ships haha.

[@christianweagle6253]

Best way to enjoy Julius Caesar

[@mxecho]

ive always preferred : Smoke Signal Version of Gentlemen Prefer Blondes

[@tehlaser]

Speaking of communication to airplanes with light, I find the color flash signals that airport control towers still “lighthouse” across the sky interesting. Alternating white and green is the indicator pattern for civilian airports, for example.

[@BlaBla-pf8mf]

This shorter intro is better. Looking forward to the next week video.

[@Perktube1]

Internet Historian also mentioned limelights in his most recent video about theaters.

[@keithagn]

Super interesting! Thank you!

[@mattwilliams3456]

Heliographs have always been interesting to me. Looking at their naval use has been on my research list for awhile but I haven’t gotten around to it.

[@Moredread25]

Julius Caesar on an Aldis Lamp!

[@mxecho]

don't forget about ; The Semaphore Version of Wuthering Heights

[@morethan4mph]

I have the same lamp and have fitted it with a superbright LED. The beam is amazingly narrow. I have tested it at 3 miles and it is amazing (but the code is slow)

[@alext8828]

That was a terrific video. I'm thinking that communication is the most important development in the life of humans. It might be the sole reason that monkeys have never developed a 747.

[@donjones4719]

I suspect the US Navy has a different kind of signaling lamp by now - a laser aimed at another ship, one that carries a high-speed digital signal for computer-to-computer comms.

[@jackx4311]

That's great - until your computer gets knocked out by enemy action, or just *another* computer crash . . .

[@dogcarman]

They have that too, but redundancy is a part of resilience.

[@RCAvhstape]

They still use plain old signal lamps, no matter what technology exists. It may be slow but it's reliable.

[@donjones4719]

@@dogcarman I have no doubt that the USN retains the Aldis lamp, just like they still have sound-powered phones in addition to other shipboard comms, afaik. Yes, redundancy is a wonderful thing, especially if someone is making holes in your ship.

[@dxb338]

@@jackx4311 its 2023. the computer for modulating the laser signal would be able to be on a single chip in the handle of the lamp, and as an embedded system probably not be susceptible to crashing since it only does one thing.

[@The_DuMont_Network]

General MacArthur was trained as a Heliograph operator, he bragged upon that many times.

[@Zbigniew_Nowak]

I once talked to a soldier (infantry) who said they still learn it and sometimes use it when they don't want a radio transmission. But he and his colleagues are not fluent in Morse code, so they use a rather primitive technique: one looks at the lamp flashes and tells the other what he sees (dot, dash, etc.), the other writes it down in a notebook, and then they calmly translate it. He said it was also possible to use hand gestures instead of flashes. Btw. In a novel by a Polish writer, in ancient Egypt, priests use the flashes of an amulet or other object to transmit light signals at a distance. But this is probably the author's imagination... In any case, there was no complicated code at that time.

[@jackx4311]

"In a novel by a Polish writer, in ancient Egypt, priests use the flashes of an amulet or other object to transmit light signals at a distance. But this is probably the author's imagination... In any case, there was no complicated code at that time." Um - how do you *know* there was no 'complicated code' at that time? Basic rule for historians and archaeologists: "Lack of evidence is NOT evidence of lack." In other words, just because we have no evidence to show that a certain object existed at some point in the past, that does NOT prove that it *didn't* exist - all we can say is "we don't know, one way or the other." And Morse code is far less complex than even regular print, let alone cursive hand-writing. Proof? You can buy simple and cheap hand-held Morse decoders; you play the incoming code into its microphone, and it decodes and prints out the letters and numbers on a tiny screen. If you want a computer to decode hand-writing (not just take a copy of the image), though, you're talking very high tech and very expensive. It's also worth noting that Morse code was used by a US prisoner of war when he was filmed by his captors, making a statement condemning US policy. He sent the Morse code for the word 'TORTURE' by blinking his eye-lids, to confirm that he was tortured into doing it!

[@ianstobie]

In ancient Egypt a "simple and cheap decoder" would a trained "slave".

[@Zbigniew_Nowak]

@@jackx4311 I do not deny that someone could have given signals with a piece of gold plate shining in the sun. But if there was a complex system like Morse code, the chroniclers would certainly mention it, and I see no reason why such a code would magically "disappear into history." Such a thing would be known by thousands of soldiers and everyone would know about it, other armies would copy it, etc. We know that, for example, the Romans used light signals to transmit complex information, but in a completely different way.

[@glennso47]

I thought Aldi was a grocery store chain? What is up with that? 😮

[@chrisnemec5644]

The two words are of completely different origins. Aldi is from German.

[@kratzikatz1]

Aldis is an english name. Aldi is for Albrecht discount.

[@trooperdgb9722]

It may only be "8 words per minute", but given that a "word" is deemed to be 5 letters, that IS up to 40 letters per minute ..or 1 every 1.5 seconds. Given that many Morse letters are made up of 4 dots/dashes even 8 words per minute is not at all shabby. As a young Midshipman I achieved that speed only occasionally and after much practice. Our Navy signalmen of course manage higher speeds.. PARTLY through the use of shortcuts .... "2" for "to" and so on... I could NOT "read" our Signalmen sending by light. It was too fast and too "informal". In the Gulf War in 91 we were under "EMCON" most of the time and Morse by light and even SEMAPHORE (!!) was used when Replenishing from support ships. Fascinating stuff. Note: For longer range we also carried the 10 inch lanterns... they were BRIGHT!

[@deputydog1995]

"Uhura... Open a channel..."

[@Allan_aka_RocKITEman]

Great video...👍

[@MirlitronOne]

"Blinkgerät", as in "I can't get this blinking device to work." By "Standard Morse Code" I presume you mean, "Modified Vail Cypher". 😉

[@geoffgeoff143]

How many trilobytes per second?

[@Nupetiet]

that's classified until 2045

[@jonr6680]

Offtopic, the german for helicopter.

[@robbytheremin2443]

I'm an old school ham radio operator and I can do around 20 words per minute by ear. I'm really curious if that would work with light. Maybe I'll build something to find out.

[@xeniafox7925]

Disappointed, no ponyo reference

[@donjones4719]

It's interesting to think that signal lamps using Morse code could have been used long, long before the electric telegraph was invented, especially the heliograph. Of course the dot-dash format was only discovered during the development of electric telegraphy, so a genius would have had to invent the code concept and the heliograph at the same time.

[@jackx4311]

No - the 'dot dash' format was adopted because it was the ONLY format that telegraphy could use. And as for it needing a 'genius' to come up with the idea - what do you think *music* is based on, if not a pattern of data in different lengths? Nor would it need a heliograph to send and receive; African tribesmen have been sending messages for thousands of years by using patterns of sounds and silence, by drumming on hollow logs.

[@northdetroit7994]

TT

[@franklinhirsch1654]

I hate to tell you this Jah but that’s not what a short is

[@bradlevantis913]

Interesting enough- to this day that 2 pin plug can be found in SOLAS Liferafts today