What Is a Man? | Renegade Cut

Exploring the spectrum of gender identity, orientation and so much more with a little help from The Big Lebowski. Support Renegade Cut Media through Patreon: / renegadecut
#gender #thebiglebowski
Twitter: / renegadecut
Letterboxd: letterboxd.com/leonthomas/
Patreon: / renegadecut
BIBLIOGRAPHY AND FURTHER READING:
www.statesman.com/news/201910...
www.researchgate.net/publicat...
www.researchgate.net/publicat...
journals.sagepub.com/doi/pdf/...
www.amazon.com/Man-They-Wante...
www.amazon.com/Mens-Lives-Mic...

[@renegadecut9875]

I'm not going to click "Approve" on your meme. Sincerely, the moderator.

[@dinorancher5560]

Noted. I come here for good content that helps me grow and think. Not to gain approval. Thanks for providing said content, Leon.

[@RB01138]

I don't get it. Nice video though.

[@jackskellingtonation]

Remember, under capitalism if you're not a wage slave then you are not a man. Your manhood is measured by how much you make and how you spend it. Women are slaves at home while men are slaves at work. But under reformed capitalism, everyone can be a wage slave! And soon we all must serve our corporate masters! Let's get those whips cracking people!

[@The5lacker]

"Elementary students are not given the full picture of the world." You'd be amazed at the number of people who've never moved past that point in their lives.

[@Gloomdrake]

Way too much of America is still thinking on that level

[@alchemicpunk1509]

Instead of horrified like I am?

[@mountainhun]

In "The Science of Discworld" (a surprisingly insightful book about education and science) Terry Pratchett mentions the phrase "lies to children." This is the way we teach the basics to children in such a simplistic way as to be false, because you have to lay these building blocks in order to expand on knowledge. We explain that the sky is blue due to retaining certain wavelengths of light, but if you get into physics you'll learn that researchers don't really know *why* that happens. We teach that the civil war was fought to end slavery, but there were so many other factors and motivations. We teach that there are two genders, when there is so much more diversity culturally and biologically.

[@frickinfrick8488]

The5lacker reminds me of how people got mad at Bill Nye for saying sex is more complicated because in his old show for children on a segment about probability someone said “you have a 50/50 chance of being born with xx or xy chromosomes”. This people deadass don’t understand that we simplify things to make explanations easier. If I want to make a probability question about flipping a coin it’s pointless for me to go into the intricacies of how the probability varies depending on the coin and the small chance it lands on its side, I’m just gonna say it’s 50/50. It honestly worries me that people don’t grasp this concept, it’s like they don’t think about anything before they form their opinions.

[@vebdaklu]

​@@frickinfrick8488And even that seems not to be the case, since modern research indicates that there probably is a genetic component in a likelyhood to have children of certain sex - some have strictly male children, some strictly female, and only rarely do people have mixed sex children.

[@aspenpotter930]

one of my favourite quotes, from naomi alderman - “Gender is a shell game. What is a man? Whatever a woman isn't. What is a woman? Whatever a man is not. Tap on it and it's hollow. Look under the shells: it's not there.”

[@shadowcat8653]

Aspen Potter The Power is great

[@blondaibonsai]

Oooh I love the poetic feel of this quote as well as its meaning

[@enbyarchmage]

As an Autistic person, the more I think about the arbitrariness of gender, the more I identify as nonbinary, bc to me the term means "identity that's not defined by any gender norms, labels or stereotypes". During most of my life, I performed my AGAB passively, because people always told me that my genitals dictated how I should express myself, even in public. After reading/watching tons of LGBT+ content, I came to the conclusion that I could embody as much masculinity, femininity or androgyny I wished, without identifying as a (wo)man nor ignoring the fact that I'm biologically male. That realization increased my self-confidence by A LOT: my fashion sense improved, as well as my will to take care of my own body, which I used to see as a mere brain-carrier. That being said, I have a very ambivalent opinion on gender, to say the least. On one hand, its hollowness means that we can, in principle, adjust it to suit our biological/psychological inclinations and aesthetic preferences. One the other hand, for that very same reason, others are just as likely to impose their own inclinations and preferences on ourselves, sometimes with so much force that our very humanity becomes a subject of "debate". Misogyny and transphobia turn gender into such a big deal that performing it authentically is, for many people, something between a distant dream and a living nightmare, not the fun activity it should be. Why? Why? 😭😭

[@h.j.froehlich326]

It's bizarre to me that we lie to children when we just end up having to go back and correct what we taught them in the first place.

[@zeewezel]

same, it's pretty wierd and ridiculous, it's just double the work

[@PedanticPig]

It's talked about a lot in The Science of Discworld books (of all things), where they literally call it Lies-to-Children. I think the idea is that the explanations, while innacurate, are good enough to be going along with for the time being and give you a starting point for getting to more accurate explanations later. At the end of the day, pretty much all explanations and models we use are ultimately a kind of Lies-to-Humans, as the world is far too massive and complex for use to understand and make decisions without shortcuts. The problem is when people start to think that the simplified model in their head isn't just something to help them comprehend the world, but is in fact what the world is, and start trying to chop bits off the world that don't fit.

[@SabrinaRina]

Not usually the same people though, least in my observation for subjects like this. The misleading or out right lying person probably wants to keep that impression and information in place and it's someone else that has to challenge that kid or even adult later in life. Why I try to not look at any modern adult as just a bigot or ignorant by choice, unless everyone with influence around them seems way more open and informed... but how often do you see that? Kids might find stuff odd and take time to learn true empathy and cause and effect, but a child raised with true openness and given answers to any questions doesn't often seem to be mean and malicious just due to people's differences or something unknown to them. I joke that kids still need to grow into being people, but really it's that even by about 4 y/o most kids have some real jerk they're exposed to, or they have media shoved in their faces and no one helping them navigating it. So then they already have jokes, faces and even physical actions they'll take against other people already. A kid might slap their hand in touching things to feel, but a kid that outright slaps has seen, heard or even felt such things done before doing it to someone else.

[@Gloomdrake]

We’re allowed to teach kids how to be heterosexual, but god forbid they find out about homosexuality.

[@riqueramalhete2348]

that's because the teachers and adults in general themselves think that way too. It's a wrong lesson that is just passed beyond, generation through generation. But now more adults are knowing better and can educate better the children. I see the future of society with high hopes.

[@ichbinben.]

"Even elementary school kids know there are two genders" Yeah, and when I was in elementary school, I learned that red, yellow and blue are the primary colours. Then I tried to mix purple and got brown. Other things I "knew" as a kid include: Romans only wore white, when you watch too much TV your eyes become rectangles and Africa is just a single country that somehow consists entirely of desert. Also, history goes like this: Stone age (everyone lived in caves), Rome and Greece (other places didn't exist), middle ages (everything's dark and terrible), then came the 70s-80s (when my parents were young) and then today. I had it all figured out already, no reason to learn more!

[@Lodane]

Yeah I thought of the color thing, too. I'm actually glad you said it, because you did it better.

[@anadice9489]

"I had it all figured out already" is exactly the mentality people need to recognize and avoid. I'd have saved myself so much embarrassment by just catching myself thinking I already know something so I don't need to learn more or check if I was misinformed. Hard to know how much you don't know, but it's probably a safe bet that there's at least something.

[@InfinityMinamimoto]

Man, Dracula's monologue got really deep over the years!

[@o.liveil7111]

As a trans man this makes me very happy and hopeful for the future knowing there are people like this channel out there

[@Antony_Oscar]

Same.

[@mainpage725]

💙

[@lazuliwinters743]

As a genderfluid transfemme I feel the same way

[@Eon2641]

Worth pointing out that those stats are only the intersex or trans who both know and are comfortable reporting their status as such. Odds are very good that those numbers are higher in reality.

[@renegadecut9875]

I pointed this out on Twitter the other day, and someone went OFF on me. lol I suspect there are more trans people in the world than we currently realize. Not everyone is out of the closet, and it might be a while before we get a better picture and numbers.

[@chucksteak_]

peoples' perceptions of being intersex in general are pretty limited to physical stuff like genitals too, im the first in a long line of hormonally intersex people in my family to even talk about that being a thing + im also trans so that's part of why im so open about discussing it, but i cant imagine how many others there must be like us if i already know more than a handful in my family alone who haven't had this documented really.

[@Mooseplatoon]

The numbers are going to skyrocket as more people become aware that such things are even a possibility/aren't putting themselves at risk by existing publicly.

[@EricArgyris]

1) I think a lot of traditionalists are feeling the world crumbling underneath them, all the things they thought where solid, dependable and set are turning out to have been built on nothing. God, faith, gender, sexuality, The curse of freedom and the individual responsibility to find meaning, morality, purpose and identity in their life are sometimes overwhelming. That's when the fear sets in. 2) It's not helped that many of the things that have been part of what makes traditionalist men feel like men are vilified, for their damage to society, Aggression has (to mention only one criticism) been rightfully criticized for it's role in the treatment of women in society. But on the other hand aggression has also, when applied correctly, been part of helping social movements succeed. For example when a company employs union busters or gets help from the police to stop strikes and blockades, then aggression might be called for in service of the working class.

[@ryokinor6223]

Well if it's all about labels, make mine 'Dude'. “I have no objection to anyone’s sex life as long as they don’t practice it in the street and frighten the horses.” - Oscar Wilde

[@Gloomdrake]

A nearly perfect philosophy, though I would specify consenting adults.

[@maestroicarodecarvalho3947]

But if they do on the streets and the horses dont care, go ahead.

[@vinigressana]

Today I learned it's OK not to feel like I fit in a "box". I've been struggling with feelings that I couldn't understand or put into words. Thank you very much for this!

[@ahouyearno]

11:45 In elementary school I learned about WW1 and how it was a border conflict between France and Germany with Belgium as collateral. Boy oh boy was that a limited view of the subject.

[@TheDanishGuyReviews]

That's a *yikes* from me.

[@leow3696]

Do you mind me asking where you grew up/went to school?

[@commandrogyne]

this video essentially covered the 'gender' lecture of my sociology class, which I thibk is pretty cool! of course, I encourage everyone to do thir own research, but this information is pretty much the same as that which is being taught in college currently (or at least, last fall). also, thanks for actually mentioning nonbinary people, even in trans discussions we're always left out and it's irritating because we have just as much to talk about, if not more, than binary trans folks when it comes to gender.

[@ribbitcryptid]

^^^^^^

[@stayphrosty]

+

[@NickonPlanetRipple]

Traditionalists is the perfect word to describe such people. The entire mindset of conservatism is to keep things the same. How many times have we heard someone say "If it ain't broke, don't fix it?" They think "Well, tradition is good by its very nature! Why would we ever want anything to change? Just keep doing the same things forever!" It's all about comfort.

[@jaredbajkowski266]

My favorite film used for gender theory analysis? Hell yes!

[@greg_1492]

ME TOO

[@crimsonpriestess]

These videos always make me nervous but it’s a good topic when you do your research.

[@phoney2627]

Why do they make you nervous, may I ask?

[@johannageisel5390]

I'd like to know too.

[@blondaibonsai]

Johanna Geisel also want to know. Someone tag me when they answer, lol

[@leviangel97]

To be honest, seeing the spectrum of what manhood can be and the spectrum of what womanhood can be... I'm not sure what being a man means. By all definitions I know of I'm a man, but some really rigid ones I would probably not be a "real man". I'm cis het, but I'm a generally gentle and soft dude.

[@pinata111colada]

same. I'm bi yet I've only had male partners and I'm pretty flamboyant and am fine with wearing dresses and makeup and shit, but I'm pretty consistently seen as very masculine (as my pfp may show lmao). Due to this, I have no idea where to even put myself on the masculine/feminine spectrum of gender expression. I am a man, I am seen as a man, I "fit" what makes a man, and yet I act pretty damn feminine. I'm not a crossdresser, I'm not gay, I'm not a "soyboy". I'm just a regular ass dude that somehow fits into the ideas of what makes a woman and what makes a man at the same time. And then when I think of what makes a man, I don't even think of the macho stereotype... I don't even know what to think. I fit a whole variety of things and so do other ppl ik. And so does like the entirety of history. What makes up a man is just, personally, a meaningless question to ask, as you can literally be anything and still be a man. Just as long as you feel like you're a man, you're a man.

[@teo161]

Wow, apt timing, I'm planning to come out as a trans man to my therapist today. Hopefully I don't have to give him the 101, but it was great to hear you talk about men today.

[@cfor8129]

Hey I hope it went well

[@donbeverage8359]

Hope it went well man! Adding for more positivity lol

[@GenericSoda]

Absolutely adore your use of "ne'er do wells" in this video and plan to use it as such in the future.

[@doritobrando4966]

Do Americans only learn about intersex people in higher education? Its so weird to me cause we learned about most common intersex conditions in middle school in my country.

[@goncharov000]

Every time I come across videos like this, I feel a bit more hopeful about the future of gender... Thank you... Sincerely, a non-binary trans person

[@BaronVonSTFU]

I didn't know that there were other combos past xx and xy until like two years ago and I definitely took college level biology classes that I actually did well in. Felt like a real dipshit when I found out.

[@AlexMint]

Let's hope you don't get too much flak for talking about intersex issues. I'm intersex(partial androgen insensitivity syndrome) and get a lot of flak from people who enforce the binary.

[@AZ-ty7ub]

I'm intersex too, it's really refreshing to FINALLY see someone talking about intersex issues.

[@stayphrosty]

+

[@filipem.aguiar3119]

Here's the thing. I live in Brazil and your videos are, due to the language barrier, not appreciate as it should. I'm formally asking you the permission to translate your work to Portuguese and published with you name only. If it's ok to you, I would like to do it not only with this video but several others. Again, only with your consent. These articles would quickly reach the academy but is very important that you get the recognition of your work. I'll wait your response. Our country needs to better the progressive agenda even mora now that we have a extrem right as Bolsonaro

[@renegadecut9875]

That's not how this works. You can't publish or upload my work. Instead, you can submit subtitles to me this way: support.google.com/youtube/answer/6054623?hl=en After they are submitted, I review them and decide whether or not they are published myself. If I accept them, they appear as an option in my video.

[@filipem.aguiar3119]

@@renegadecut9875 I'm sorry if I sound like "miss using your work" I would never do something like that. I'll start working on subtitles as you suggested. I really like your work and I have the upmost respect for it

[@tiagospeckart]

As a brazillian man engaged in gender debate about masculinity, I feel extremely happy with your initiative, I want to help. PM me and let's help each other, I can translate/proofread. Um grande abraço, irmão!

[@Yony42]

@@filipem.aguiar3119 I think your efforts and enthusiasm are very valuable. I'm sure it will benefit many people!

[@onalos1271]

It's important to expand the reach of this type of work to people who don't use English as their primary language.

[@redactedredacted6656]

As a wise Lizzo once said "If you feel like a girl then you real like a girl".But also it sucks that the most minimal display of allyship makes me feel validated and satisfied because of how blatant and common people with even the tiniest bit of social influence doing the opposite is.

[@notsam7928]

Thanks for including the definition of asexuality. I wish more people would talk about ace and grace people

[@Uhlersoth77]

Agreed. I've all but given up on trying to explain what "romantic asexuality" is to the average person who asks about my relationship status. (Also, I wish that one wouldn't so casually ask another they barely know about said status. It always feels a bit invasive.)

[@SimplyMavAgain]

really grateful I stumbled onto this channel So many people in the comments are happy with your breakdown of this topic and your understanding of it. This is amazing.

[@blep8563]

as a trans man, those questions are fascinating. what is a man indeed? what am i transitioning to? trans men are very often kept away from things that help men shape their understanding of their own manhood (for example, all the staples of growing up as a boy, like having your dad teach you how to shave your beard) and we have to piece it together on our own we are self-made men in that sense, in the sense that we have to figure out for ourselves what being a man means and what masculinity looks like

[@hunnybadger442]

Youre transitioning to your truth... Whatever form it takes it is your vision of the true you... And it is absolutely beautiful...

[@acheybones588]

I’m a cis man who was expected to figure a lot of stuff like that out on my own so I relate hard. And yeah you’re also dead on the money about that “what even is a man” question. It’s always made me curious about the experience of trans men. I feel like there’s a lot to learn from someone who wasn’t “man” by default, rather by virtue of conscious effort and deliberate action.

[@robonick3607]

12:18 I appreciate my elementary teachers for being honest unlike so many others. I was taught about how California-area was discovered far before Columbus came. I also learned about slavery far more than others, I knew Harriet Tubman as Moses before I knew the lore of The Old Testament.

[@888fluffy]

nothing taught me more about the varieties of sex and gender than my university biology degree

[@Anondod]

I remember we had a lesson on chromosomes that included sex chromosome variations, in fifth or sixth grade. But that's here in the socialist hellhole that is Sweden. Seriously, this is a great video, one of the best I've seen from you (and you consistently produce quality stuff).

[@dinorancher5560]

What makes a man? Better question, what makes a good person? Providing what they can, helping how they can, and protecting those they care for in any way they can. These are traditionally attributed to the 'masculine', but are certainly not limited to cis males. A good person does what they can for the betterment of others regardless of gender identity, sexual identity, or race ethnicity. This is more of a philosophical view than the social science views expressed here.

[@dinorancher5560]

@@dwc1964 this is why I choose the word 'person'. As it is universal regardless of our birth or self identity or abilities. Being a good person is something all of us can strive for, but some choose not to. This is not to say that choices made that go against social norms or laws due to lack of options created by institutional oppression should be viewed in a black and white filter, as they may be done to provide safety or material necessity for those we hold dear. Morality like social norms aren't universal, hence my framing of this thought as philosophical in nature.

[@trekjudas]

I'm Gen X, I'm down with gay and transgender. I can wrap my head around that. Non binary is new to me. I'm having a hard time wrapping my head around it. I guess I'm not as cool as I thought I was.

[@dummythicccdave5834]

You're not alone. I'm a millennial and I still have trouble understanding the non-binary issue. I keep and open mind to it and I say identity however you like if it makes you feel better and doesnt hurt anyone good on you!( cant see how it could) But I do find it confusing myself.

[@wondashozen]

One of my favorites from you. So well laid out and concise. Keep killin it.

[@nicholasnora139]

Leon keep up with this amazing content!

[@guilmon182]

I... actually have no idea what makes me feel I am a man. I just... know I am one? I've never really thought about it. I suppose, as the husband of a non-binary masculine person, I probably should think about it.

[@ownerofastolengun]

I'm not a woman I'm not a man I am something that you'll never understand

[@CapeBarnes]

I'll never beat you. I'll never lie. If you're evil I'll forgive you by and by.

[@Busto]

I'm not your lover I'm not your friend I am something that you'll never comprehend

[@NoiseBoulderRecords]

Totally spot on, is like asking what makes me a Mike? Or a Julie? Or a Hendrick? That's just how they call you, nothing more than that.

[@emobirch4559]

your videos are always so concise, on point, and well defined so that anyone can understand them, thank you for your work

[@Jessica-oz1yn]

another delicious serving of great takes~!! thank you ^_____^

[@aroace7913]

It is pretty nice that you even mentionend ace people because to often we are just ignored like intersex people^^.

[@Xondar11223344]

This video just makes me want to watch The Big Lebowski.

[@brianray8351]

: The identity spectrum is pretty rad. I like it precisely because it makes no definite claims as to what it's worth (unlike the loaded question "what is a man". But that only happens when highly specified labels are not a part of the discussion surrounding identity. I believe that many people who aren't comfortable with traditional standards regarding masculinity, sexuality, anatomy wanted to find specific points on that spectrum that applied better to them. Then, they start fighting for their right to culturally legitimize that point on the spectrum, in order to bring about that experience of comfort mentioned in this video. That's cool and all - if that's their way to become liberated, that's their way - but my god, I could never make that level of commitment when it comes to defining myself. I found it to be so anxiety-inducing that it become a waste of my time and energy than anything promising. I suppose that's why I love this film so much - everybody and nobody is truly identifiable. Everyone is their own spectrum, especially when compared to the traditional standards of masculinity, and I don't have to try and pin any character down to a singular point. I much much prefer to be a slacker in regards to this identity business. As odd as it is to argue, and this is just like - uhh - you know - my opinion, man...being a firebrand about it is like being a nihilist. Sounds exhausting.

[@zinchalk]

My weekly reaction to RC videos: “New shit has come to light, man.”

[@Mobesly10]

I’ve been watching nothing but movie analysis videos so when KZbin suggested this one I assumed it was an in depth look at The Big Lebowski. I had no idea what I was in for. 5 minutes in I paused it, went to the channel & subscribed. Well done my dude. Well. Done.

[@alecdonaldson8849]

brief shoutout to that asexuality is ALSO a full spectrum. Some are sex-repulsed, some want sex sometimes Just a little PSA

[@hawksandsparrows]

I can't thank you enough for covering topics like that so well and succinctly!! Thank you for helping fight the good fight

[@gwolfe333]

The dude agrees.

[@irmsurr56]

Just discovering your content and its wonderful stuff! I thank you for it.

[@diddles3383]

This is the best gotcha video I have ever stumbled upon, and as an agender folk, I deeply appreciate your deconstruction here (along with your other videos, they're all great!). Keep up the great work!

[@CreatureSH]

Thank you Leon. This is very, very good.

[@robdood2]

My god I need to watch Big Lebowski again. It's been literal decades(!) :'(

[@m3ntyb]

This is the best video on this. And I’ve seen many and intend to see more and I know none will break it down as well as this. Thanks.

[@catcatcatcatcatcatcatcatcatca]

This causes me some serious questions about my own gender. I agree with the thesis that manhood is a club and that there is no biologically sound way of defining genders. I also don't feel like a member of this club, at least fully. I do hold some toxic elements and am raised to see gender trough such binary, yet I also feel that my own expressions of manhood are often unwanted and feel alianating from what kind of person I want to be. Similiarly I feel the role of a man too limiting, and don't feel that I match the description well enough - and I also don't want to match it in future. Yet I don't feel that I lack gender, as I always image that much be a feeling of somekind, other than just resistment toward ones assinged gender. But neither do I identify with any other gender, or feel that my gender-identity is fluid - sure I sometimes do gendered acts of many kinds, but having a gender-identity build on those also doesn't feel logical - I feel these acts shouldn't be tied to gender. I also don't resist absolutely all masculine attributes, and actually like some of them, like having a beard - yet defining my gender trough those both misses the mark of social manhood, and also feels forced to some extend. And again, I don't think these traits should be tied to one gender. Can I just say I wish to abolish gender, as an answer for someone asking my gender? Is that a valid answer? Or do I have to choose a gender I disslike, or build an identity around not having a gender?

[@MARA610]

Bless you, Leon for educating us on these important topics.

[@anacastrodavila2689]

This video is very informative and well put together. I love it. Just one thing, a lot of bisexual people don't think about they orientation as attraction to two sexes, they defined it as attraction to the same gender or a different gender, or attraction to two genders (non binary and female, for example). But overall a great video.

[@nessyno-name3855]

As a bisexual person, I stumbled over that part of the video as well. Despite the literal etymology of the word, I believe that the term "bisexual" has basically been divorced from the binary notion of sex and gender at this point, and people (bi people and non-bi people) just use it as a comfortable and well known word to mean attraction to two or more sexes/genders, ie, not-monosexual. A lot of crossover with pansexuality, but a way that I've heard it explained is that pansexual people form romantic/sexual/intimate bonds with people without regard to sex or gender, and that bisexual people may form romantic/sexual/intimate bonds with people with those people's gender or sex having some bearing on the situation or affecting the perception and development of the relationship. Please note, this is is not a universal definition, but one that some people may relate to or find useful.

[@SplashtheOtter]

I still remember the last video you did regarding the Big Lebowski, I ended up using as a source for a sociology paper I did in community college on the movie. Keep it up Leon!

[@nicholaswhyte1986]

I love your analysis. It may not be new or flashy but its deep and complex. I will showing this to many of my worker colleagues. Brilliant

[@jeffkatz3494]

Really enjoy all of your videos but I think this is one of your best yet.

[@NotesFromTheVoid]

I once did a survey where it assumed there was only two hair colours. It was hilarious. REDHEADS EXIST DAMMIT

[@aby110]

Trans rights ❤

[@oof-wi7hp]

TRANS RIGHTS!!!!!!!!

[@feelsgoodmanlol]

Trans rights!! :)

[@kibblemom]

Wonderful essay. So glad I found your channel!

[@bepkororoti8019]

Thorough analysis of an important topic, great work, as always! And all that with the dude running in the background, what is there to say... Glorious!

[@pressqtoquaff]

you basically summed up and even surpassed my Introduction to the History of Contested Sexuality class from 20 years ago in a 20 minute video. beautiful

[@leo9753]

God I love you, I have all the questions and stuff. Your deep dives offer so much insight, thank you

[@elizapetersen8302]

Okay, I've never seen the Big Lebowski, and I cannot conceive of a cohesive narrative from a film that contains all the scenes this video uses clips of. Is this movie just an acid trip?

[@draexian530]

I really did not expect Arnold to be the man that kid was addressing.

[@steviefuufuu]

Great video as always! Just a heads up, the American Psychological Association (APA) publishing manual says to avoid using the term "homosexual" as it's rooted in pathology and only really used by the religious right anymore to avoid using the word gay (they use it because it's based in pathology). Same-sex sexuality is what I use. I'm a grad researcher in lgbtq issues primarily so it comes up a lot. Keep up the good work!

[@Desimcd]

Love this video, so refreshing. I'm now subscribed

[@iheartjackieyes]

comment for the algorithm because this is a very, very good vid

[@gigo20]

Is anyone planning to surreptitiously play this as the in-flight movie whenever Shapiro et al flies? There have to be a few anarcho flight attendants, right?

[@kathmaguire6776]

Really useful resource Leon.thank you.

[@colinmiller6649]

I don’t know how much I needed to hear this right now because even sometimes I question who I am and removing the binary really helps at least except myself as I am even if I don’t always know what I am

[@unrealnews]

You’re asking a lot of your audience. I think that’s a good thing.

[@QUAD00DLE]

After watching this vid, Dylan's "The Man In Me" takes on a whole other meaning in the film for me.

[@jabberw0k812]

I do love the Dude's disdain for the question that's so important to Lebowski.....

[@BrokenWingman]

Brilliant. (if it's not evident by the timestamp of my comments, I am down the rabbit hole, watching all these videos)

[@nicholasb4071]

Inspiring. Thanks for the mind opening content.

[@halfpintrr]

Thanks for the Ace shoutout! I’m a biromantic Ace :) ♠️♠️🏳️‍🌈

[@phoney2627]

Oh hey I'm a pansexual Aro

[@lindan.137]

Yo, another bi/pan aro here 🌈❤️💛💙💚🖤

[@oof-wi7hp]

i love bi peeps who fall under the ace/aro spectrum. livin' that all _and_ nothing life 🤙🏽🙌🏽

[@bunhilda6319]

halfpintrr I’m a panromantic ace lol

[@jordang7479]

was just having a similar convo with peer group.

[@JonesysMomma]

This is the best video on gender I've ever seen. Truly amazing, thank you!

[@itstoomuchman5503]

Thank you for the video. I would like to share what I learned in my intro to human physio about how even people with "normal" chromosome pairs XX and XY can manifest different primary and secondary sex characteristics. Suppose you have XY chromosomes, your body produces relatively high levels of testosterone, but the gene that codes for testosterone receptor has a mutation. You now have testosterone coursing through your blood but your cells can't take it in and hence your Wolffian (proto-male) ducts degenerate in utero, you are born without the internal plumbing system of a male and without a defined external penis. Or maybe the gene that codes for the enzyme 5-alpha-reductase is mutated so you can't convert testosterone to its active form of DHT. Again, same effect. Let's say you have XX chromosomes but your adrenal glands secrete more than usual amounts of androgens (congenital adrenal hyperplasia). Since external genitalia is determined solely by testosterone levels, you develop a phallus in utero and high adrogen levels also preserve the Wolffian ducts. However the Mullerian Inhibiting Factor (MIF), coded by a gene on Y chromose, is still absent in your body so your Mullerian ducts (proto-female) do not degenerate and you are born with both sets of internal genitalia. Resistance to hormones is not a binary by itself either. Some individuals have a higher resistance and some lower. Even apart from all of this your cells may, as they very often do, separate abnormally. So even if you had XY chromosomes as a fertilized egg, some parts of your body might lack a Y chromosome and hence not have testosterone receptors, while others do. This might seem confusing and detailed but this is just the tip of the iceberg. The take away message is nothing about life is ever simple. Also do your own research and don't hesitate to correct me please, I'm not a qualified medical professional by any means.

[@frickinfrick8488]

A little off topic but I always wondered why Gender Studies became the biggest punching bag in academia for non academics. Like, there are so many absolutely useless courses out there, like really pointless stupid courses, but the one that discusses gender, something relevant to everyone, is somehow the worst one. Little bit revealing.

[@culturalartsandpoliticsrev6916]

Just another reason why The Big Lebowski is such a great movie.

[@joemeitl4971]

This was ridiculously helpful. Thank you.

[@martinholt4939]

Love your content !! Thank you!!

[@dogmiagy]

Luv from Portugal 🇵🇹 Luv ur reviews!❤️

[@me-nah3343]

This is really good. Liked!

[@kirk001]

I was raised by a Silent Generation father who stood up for LGBTQ+ in the 60's, and taught me that women are equal to men. So the concept of gender roles was not something I dealt with in my home. When you state in the video "What makes you feel like a man? or What makes a person feel like a woman?" I have no idea how to answer that. My first instinct is that being able to pee standing up makes me feel like a male, but I'm aware there are females who can also pee standing up so I don't have an answer.

[@spekticat]

I love this video so much, thankyou

[@jackpowell95]

Amazing video, I only wish you more explicitly referenced to the big lebowski and how these ideas were supported by it.

[@k.s.4209]

Love that music at the end

[@drunken87]

I love the hair argument!

[@thismesswecall...]

Great episode!

[@renegadecut9875]

Thank you.

[@jarrahfitzgerald2752]

Outro is best yet!

[@theniftycat]

Great point about the elementary school, I need to memorise it

[@contra234]

What man? Which man? Whose the man? When's a man a man? What makes a man a man? Am I a man? Yes, technically I am

[@herbivarsawus4359]

How noble in reason, how infinite in faculty, in form and moving how express and admirable, in action how like an Angel, in apprehension how like a god, the beauty of the world, the paragon of animals.

[@revdrjon]

What's the name of the music piece you used at the end?

[@ramonasagan8148]

when I hear you talking about toxic, transphobic viewpoints and how they're garbage, I just sorta append "...*Colin*" now lol. Good video Leon.