Why Always My King??? - I'm Better Than My Viewers - Episode 3

If you really enjoy my content, you are more than welcome to support me with a small donation via Paypal.
Link to Paypal donation: www.paypal.me/...
Check out my other channel: / randomchessgames
Xomu - Walpurgis Night
Xomu - Last Dance
Subscribe for more funny chess content, and join my Discord server at:
/ discord
#chess #BetterThanViewers

[@ZaCh-sb5jt]

Pieces: Casually moving Stockfish: SLIDE TO THE LEFT SLIDE TO THE RIGHT CRISS CROSS

[@legate7158]

Playing Tennis

[@jasonlongfur4695]

Cha Cha real smooth

[@nianyiwang]

sportfish

[@Cruxify_]

@@jasonlongfur4695 lol

[@Keldor314]

Gotta love Stockfish's ratings throughout the game. Stockfish: "Ha! That's mate in 11! Wait, WTF are you doing? And that response?! Don't either of you know the first thing about chess?!??"

[@JayJay-wf2oe]

That's what AI are for, they are excellent at individual things while human are decent at everything :p

[@me-di2ol]

@@JayJay-wf2oe stockfish just good at everything

[@niveshproag3761]

@@me-di2ol Nah weird positions make stockfish a bit crazy.

[@me-di2ol]

@@niveshproag3761 Not really, can you give an example with stockfish 14.1? (LEGAL POSITION REQIRED)

[@kamil118]

@@me-di2ol Idk, stockfish is pretty bad at playing poker.

[@RGC_animation]

Ok that oponent was still pretty good.

[@saekashiwagi5829]

But like the one before him, he didn't attack the vulnerable king at the beginning. Worst, he open HIS King making him vulnerable :/

[@TylerWx]

@@saekashiwagi5829 Yeah, exactly. The King was miles away from any help. Go attack it please, lol

[@Capivaradissimo]

nah cap, I should attack his king at the first moment.

[@froopea9094]

I mean the only way to do that was with knights because pawns cannot go backwards and knights are the only pieces that can jump and idk if you can checkmate with knights when you only have 2 rows of room

[@KayOScode]

Wasnt he only like 1150?

[@groundedgaming]

Thanks, Simp I faced a 1100 in this position countless times.

[@Cripplified]

Honestly gotta respect Simp for putting out a video on standard, theoretical chess for once.

[@bobon123]

The Classic "magic trick" opening, where black ends up with 16 pawns. Interesting you need two chess sets to perform it properly, and an opponent that is easy to distract.

[@adventurer3288]

Now I finally know what to do in this position!

[@groundedgaming]

@@bobon123 OHHH!!! SO THAT WAS THE NAME OF IT!!! *THANK YOU SO MUCH* I HAVE BEEN LOOKING FOR IT FOR A WHILE NOW

[@clawboss2028]

an 1100*

[@Tytoalba777]

For some reason, for the first half of the video, I thought the back row pawns could move backwards to check the white king

[@vratha9740]

Same

[@elijah_da_draggo7094]

Same

[@Leo-ok3uj]

Same

[@MistrJonesMusic]

Same

[@had0j]

same (but for the first ~4 seconds of the video)

[@jotaro8546]

1:47 it‘s a blunder because he can take the pawn with the bishop and you can‘t take the bishop back because he can take your rook with his queen afterwards

[@szmash3726]

Exactly. Bxg4 and You can’t take bishop because it’s pinned to the rook.

[@timothyLucasJaeger]

I thought so too at first, but this isn't why. This was 6.g4. If black responds 6...Bxg4 as you suggest, 7.fxg4 Qxh1 8.gxh5 is indeed good for black even though white nets a piece, because black's passed g and h pawns are very strong. However, 7.Bg2 is still "ok" ("only" -5.69). The real reason 6.g4 is a blunder is that black can play 6...Kf4! preparing ..Qe5 followed by ...d5+. This plan is a little too fast for white to find counterplay and black mates quickly. For example, 6.g4 Kf4 7.Bg2 Qe5 8.Qg1 threatening Qh2# is a move too slow for white. 8...d5+ is mate in 4.

[@szmash3726]

@@timothyLucasJaeger oh I see. Thank you

[@mrjoe5292]

If you take the rook on h1 then white can take black's rook on the h5. Overall it's better for white, a bishop and rook for a pawn and rook. Although the black queen on h1 is tricky, pinning the bishop and blocking white's queen with both f2 and g3 protected by pawns.

[@Kamil-kv6lv]

@@mrjoe5292 it would be better for black, because white has pieces locked and queen trade is likely

[@matt92hun]

Twist: we didn't see the resignation because there wasn't one.

[@cosmictrash697]

next video his opponent is randomly going to resign with a checkmate in one for him(the opponent)

[@52flyingbicycles]

I don’t think black can do anything to prevent pawn f4 checkmate in this position. Stockfish say M1 and it’s black’s turn.

[@BlueEyes-WhiteDrag0n]

@@52flyingbicycles black can hack into the server and make moves for white

[@AndreasChrisWilhelmer]

@@cosmictrash697 whelp, it just happened xD

[@Mernom]

Iirc this chess client doesn't show them.

[@mrcalligraphy2722]

This was really entertaining, nice to see some relatively high level play being broken down.

[@Catzss]

bri*ish 🤮

[@lolcat1382]

@@Catzss what

[@Kaizu-E]

The more he wins the stronger simp gets. Great video as always, keep it up.

[@aak-agami9734]

Blood of Saiyan

[@catcatcatcatcatcatcatcatcatca]

Damn that was a great game, even if neither player spotted the obvious mate in 11. But the ridiculous blunders aside, the game took a very interesting position. Your opponent still has a bit of a weak spot when attacking king behind their pawns behind their king - probably something they need to study in future

[@pirilon78]

"obvious" and "mate in 11" should never be in the same sentence

[@rubickevich]

Yeah, obvious mate in 11. I saw it too, of course.

[@EdibleOstriche]

@@pirilon78 it's a joke

[@saitama2467]

​@@rubickevich the mate was obvious to me, when black moves the pawn to prepare to block the queen mate you take with bishop if he takes back with bishop you take with queen and king is forced into corner and moving the pawn up is mate, if he doesn't take bishop and instead moves into corner queen mates, if he moves behind bishop you take bishop and if he takes bishop there you mate with queen, if he moves back towards the queen you move queen up check force him into corner and pawn up mates

[@saitama2467]

​@@rubickevich basically its just understanding the fundamentals of forcing a mate, move your pieces in instead of blocking sight lines with pawns, even without seeing the mates, taking with bishop is just better because you have more attacking pieces so you want to trade down, if they do trade down mate becomes obvious by forcing them into the corner

[@ED-yy4te]

Your king was actually safe in that position while the enemy is trapped in the middle.

[@davidy22]

King wasn't safe and every move chess simp made up until the first attacking queen move was a blundered mate in 10

[@RepostCollection]

The "ah ha" had me in tears every time XD

[@jedzenie9770]

Watching these videos while having absolutely ZERO idea about how chess works is so damn fun

[@SG2048-meta]

You should learn it, it’s great

[@NateTheOhioan]

I feel like this is just the pieces going on a mission to save their already captured king

[@cobalius]

Finally an opponent who was able to set up little tactics xD

[@Known_as_The_Ghost]

Imagine if Hikaru just.. drops a comment. "You're better than your viewers?"

[@CodaRyu]

Oh no

[@lordpumpkinhead265]

The Chess equivalent of bringing in a retired Marine to teach gym class.

[@大砲はピュ]

@@lordpumpkinhead265 active*

[@lordpumpkinhead265]

@@大砲はピュ If it was an active marine, then there'd be nothing to teach as said marine would be deployed on a military base.

[@smurfaccount9269]

@@lordpumpkinhead265 It's not the chess equivalent then since he's not retired no?

[@Jasper-yz7vy]

Did I just see a Mate in 21?

[@BleachWizz]

1:47 - I guess stockfish saw Bishop takes g4 Pawn takes g4 Queen takes h1 Pawn takes h5 And now his queen is pinning your bishop. And the only next move that doesn't cause at least a trade is queen e1. But it's not your turn so probably i think: Pawn c3 pawn takes c3 Knight takes c3 Queen e1 Queen e6 And now you're back with only being able to move the rook without giving pieces.

[@ritamdutta5860]

Opponent saw Bishop g4. He just didn't like it.

[@makj155]

I think you got the first half right, but the second half is a bit wrong. The opponent could move their pawns forward to promote on the last two columns after pawn takes h5. The only way to stop it would be the bishop taking the pawn which would mean sacrificing his queen.

[@Whatever-gi4rx]

You are all wrong, its king f4 where he is completely safe, taking either piece will result in Qe5 and d5 and a mate in a few turns with the queen getting out. Best response to kf4 by stockfish is c5 with the intention to go cxd4 + saccing material to basically just prolong the game.

[@supC_]

@@Whatever-gi4rx Ok, you lost me at “best response to Kf4 is c5. That’s not even a possible move. Did you mean c3? Other than that, your logic makes a lot of sense.

[@zakarikante9674]

Chess but it's actually a paid actor (Day 3 of asking)

[@ulrichbrodowsky5016]

Did you take my idea?

[@NinjaNanya]

Better donate some money so he can pay them lol

[@zakarikante9674]

@@NinjaNanya yeah i know, sadly i don't have the money

[@twelftheagle3043]

Agreed

[@krzysztof-michalak]

he doesnt take challenges from yt comments

[@wynoglia]

Wow. I thought this was going to be losing, and fast But damn this exceeded my expectations a million times

[@oanhienlong7264]

It was losing, his opponent just fails to exploit the advantage. Any 1800+ could handle the situation like how it should be.

[@cadiskox8073]

@@oanhienlong7264 me being 1000 would do it completely differently, it's hard to believe 1100 failed so hard with that advantage

[@tr0n4556]

Stockfish just spent the entirety of the game just spitting random numbers and saying it was good enough. Poor bastard was so confused

[@W4rfire]

Wow that was really an impressive 1100. He was even impressing by resigning, because this meant he sees he cannot defend anymore

[@stanime3062]

he was 1500 no?

[@musicforever7014]

3:29, F takes the woman🤣🤣🤣

[@alexmijo]

for some reason this is perhaps my favorite of your videos

[@tobuslieven]

I cannot believe the respectful resignation. That guy is good and decent.

[@ironclad452]

Didn't see your opponent resign so I don't believe you

[@Capivaradissimo]

I actualy resign cause I dont have nothing else to do

[@Molten404]

You: that blunders qe5 Stockfish: that blunders m2

[@michaelmoccio2225]

I love the idea of this series, even if you lose it will still have high comedic value but I definitely appreciate you winning for your sake. Great game as always!

[@janellysosa7590]

The bishop at the back could demolish your king but he didnt see

[@far_centrist]

He decided to resign rather than face a humiliation of getting checked by a pawn.

[@missedelweiss8771]

The "I'm Better Than My Viewers" series is so interesting!

[@76soccerlover]

3:29 “fx the woman”←Amazing dialogue!🤣🤣🤣🤣

[@waldoman7]

That would be a priveledge of a game to lose. Well done to that guy

[@connorhorman]

"Oh no my queen" Ah, I see you're a man of culture as well.

[@DandDgamer]

Super entertaining video, well balanced and a great struggle!

[@TheGamingPalace123]

Simp: *I am better than my viewers* Carlsen: _Enters the chat_ What you said? Simp: *Did i said something?*

[@lolocookiehax611]

say

[@bored-bt4nn]

Plot twist: He is Carlsen all the time

[@victorberezovskiy5923]

Plot twist: Carlsen is not his viewer

[@JhonAndTheInfinite]

@@bored-bt4nn wtf

[@chesscomsupport8689]

@@victorberezovskiy5923 Plot twist: he is better than Carlsen

[@khangtrantan9756]

Mean while in an alternate universe 1:00 pawn F4, checkmate

[@khangtrantan9756]

If no en-passant rule applied

[@NaThingSerious]

Stock fish just dancing on the side as it tries to figure out wtf is happening

[@saxorskittle3839]

Chess, but you can’t move any other pieces (or pawns) until either, or both, of your knights have taken 5 pieces (including pawns)

[@folushooludare786]

Man just rescued his king who has been held hostage lmao

[@no_name4796]

1:48 it's a blunder because: bishop eats pawn, pawn eats bishop, queen can now eat your tower and you basically lost

[@freddie9705]

This is such a tense game! The faintly anime music feels really appropriate

[@hans935]

2:45 take with the bishop... blundering ur piece to force moves is the next level game play. (That was a mate in 2...)

[@UselessBunny]

1:45 is a blunder because he can just take with his bishop and then when you take back with the guarding pawn you loose the rook in the bottem right corner to the queen.

[@GuardianHalberd]

It's either something else or a deeper move, because taking rook with queen also allows black rook to be captured in sequence with pawn that took bishop

[@UselessBunny]

@@GuardianHalberd Lets count it down you take a bishop and a pawn and loose a rook and two pawns ? That is 4 for 7 that seems like a blunder to be.

[@GuardianHalberd]

@@UselessBunny I didnt get it. black moves, Bxg4 white moves, fxg4 black moves, Qxh1 white moves, gxh5 black loses bishop+rook, white loses pawn+rook black has less material now

[@oanhienlong7264]

@@GuardianHalberd wdym you don't get it, look at the back 8 pawns, that shit is gonna crashing down and white is gonna be the one giving up pieces to stop the insane promotions coming up.

[@oanhienlong7264]

@@GuardianHalberd I don't get how most of the viewers do not understand how black is having a hugely winning game and his opponent is just too weak to get it right.

[@johnlucas2838]

1:01 Instead of taking g3 black pawn, you could have just moved f2 white pawn to f4 for checkmate.

[@kickstart3974]

I came here looking for someone to notice it I'm not that good at chess rn so it kind of drove me crazy that someone miles ahead of me didn't catch it, but it happens

[@deboogs]

Black could en passant with the e pawn to avoid checkmate

[@peterjohnson11655]

@@deboogs holy hell

[@kalleleikos5260]

Eric Rosen is proud of you! Oh no my queen for smothered pawn mate is so beautiful

[@panzerhund7836]

When the enemy has your king hostage but all youre giving him is your flank

[@oicmorez4129]

fix title, but great video!

[@Xehanort107]

dude literally had checkmate all game, and playing through begging the opponent to stop him for like 10 moves.

[@ManosSef]

What checkmate are you talking about?

[@MrKyle-dy4en]

When the computer starts a chess KZbin channel

[@blacklight683]

5:03he was like yes *yes* YES until he saw his king no *no* N- (*player disconnected*)

[@OptimusSubPr1me]

Stockfish wants off this wild ride.

[@synka5922]

1:40 the blunder is that if he takes the pawn with his bishop, and you take the bishop, that blunders your rook so its really just a free pawn. and if you do take the bishop and then his rook, he still has 4 pawns on a side with no rook to oppose him

[@unknownunknown6500]

2:43 here taking with bishop would open up a lot of checkmating outcomes

[@JohnSmith-ox3gy]

Sweating stockfish: But this isn't a legal board state!

[@Thats_quite_cool]

1:50 the problem with this is that the Bishop on F5 can take the pawn on G4 and you wouldn’t be able to take the bishop with your other pawn because then he could do QH1 to take your rook

[@selectivepontification8766]

The bigger problem is that now black can play Kf4 which opens up Qe5 into d5+ discovered check and then the king is locked in with a queen and bishop and probably gets mated in a few moves

[@Phillitopolis]

@@selectivepontification8766 And the biggest problem is that white missed an unstoppable Queen pin with his bishop to G2. No matter what black plays in the next move, white has f4, checking the king with discovered attack on black's queen.

[@Theresia66]

This is the 4th chess game i've ever watched, i am confused again

[@NaThingSerious]

Is it just me who love the way he says “aha”

[@coolskeletondude5902]

1:47 after Bxg4 and Recaptures with pawn his queen takes your undefended rook

[@drrianblox]

Episode one, the third episode

[@addymant]

Yeah stockfish really struggles with such a weird board

[@mihirkarwani8891]

Only legends know that the title was named "Episode 1" instead of "Episode 3"

[@unknownunknown6500]

At 1:45 the blunder is if bxg4 your f3 pawn can't take it because its protecting the h1 rook from the d5 queen's diagonal.

[@pikachudj8069]

I can't believe you didn't see mate in 21. I thought you were an AI because of your computer voice. Guess you just need to play more games to get more experience.

[@user-hp6uk5ht8j]

The opponent not even attacking the king

[@kalahatze]

1:45 Just a guess, I'm not very good at chess, but Stockfish probably wants black to move his king, ignoring the fork in order to get his queen out. Moving the pawn opens up the space it was guarding from the king, and there is probably a forced mate if black ignores the fork.

[@Acid31337]

Famous "oh no, my queen"

[@picklecodm682]

1:51 bishop takes pawn, pawn takes bishop, queen takes rook

[@aslightidiot]

1:46 I think the blunder is that the bishop takes your forking pawn and the other pawn cannot take it and threaten the rook because the queen is currently pinning the pawn that would take to the h1 rook, which it would take and then be pinning the bishop to the queen. So basically, you either lose material and leave the rook wide open, or you get your rook killed faster

[@Т1000-м1и]

He could just take the damage and slowly block your king tho

[@timwhite1783]

2:32 Mate in 11?? wild... would be really curious what that is.

[@PurpleFreezerPage]

I would love something like this for fighting games

[@andrewchapman2039]

A proper tense one, love the high stakes series!

[@sorryeverafter523]

Quite impressive I must say. Maybe you are not chess simp, but chess god sandbagging

[@valiant8987]

1:49 I think stockfish calls this a blunder because the bishop can take the pawn on g4 due to your f3 pawn being pinned by the queen.

[@ss-vs8te]

No one :He can go there to save him Fish : big mistake No one: this is the only good move for him Fish: mate in 11

[@JaguarBST]

1:46 if black takes the pawn you can’t take back because your rook would hang, that’s why it’s a blunder.

[@weewoogee]

as someone who doesn't know the difference between the queen and king cool video

[@grantarmstrong2968]

1:50 it is a fork, but the bishop can take it, and since taking the bishop gives up your rook you will be down material

[@grantarmstrong2968]

I just realized you’d still have their rook from this, but I imagine them taking a rook is worth a lot more since you have a lot less pieces

[@helmetmcbarin]

We didn't see him resign

[@janseta5162]

at 1:00 I thought you had checkmate by moving your pawn to threaten King, but then I realized en passant would have gotten you

[@biggbluecanoe7108]

Just watching this video now, and I made the same comment! Apparently it's due to the "en passant" rule, where a pawn can capture another pawn that just moved two spaces by moving to the tile behind that pawn (probably butchered that explanation). Essentially, if he moved his pawn to f4, the enemy pawn at e4 would be able to capture it by moving diagonally to f3.

[@quickattackfilms7923]

Nothing has made me want to play chess less than to know there are these friggin sweats already knee deep in the meta. Feel like I’d be picking the game up on Christmas morning when all the people who got it in November are already max level.

[@bruhnca]

I think that on 1:02 you couldve given a checkmate by moving your pawn to f4 since its protected by the bishop

[@rango4030]

Yes, he could have how did no one see that?????

[@sandatanidamocles]

Correct me if I’m wrong but wouldn’t a French move kill his pawn?

[@bruhnca]

@@sandatanidamocles sorry i dont know what a french move is i dont know a lot of terms in chess💀but i dont think anything couldve stoped it

[@sandatanidamocles]

@@bruhnca En Passant, I mean. It’s a specific move that allows your pawn to capture an opponent’s pawn if the opponent does the two space jump of their pawn to go beside your pawn.

[@archerberenson6355]

After fxg3, F4 wins on the spot. In the end, F4 is almost unstoppable

[@nudomkesmalee]

en passant

[@archerberenson6355]

@@nudomkesmalee Pawn takes, then F4 is practically unstoppable without making the game unplayable for black

[@AutumnReel4444]

That was the best one yet imo

[@brettd4599]

This series is hilarious

[@shmockette7158]

At 1:50 I'm surprised you don't see it: It's because of Bxg4, fxg4, Qxh1 and then Rxh1 because then both your Queen and bishop are permanently out of the battle and he can just move his pieces backwards to your king.

[@Sinfinity7]

1:45 Queen is xraying the f-pawn, black can just take. Yes you win the exchange but basically cant move anymore.

[@mence5992]

In the fork if bishop take and you take with the pawn he can get the rook with the Queen. You take the rook. So he loses a bishop for a pawn instead of a rook.

[@tangentfox4677]

I'm gonna guess I'm better than 1100 because I saw the knight to checkmate path your opponent could've used at the beginning, before you pointed it out.

[@flyinpatato9766]

1:50 , He can take g4 pawn with his bishop and you can't take back because it's going to make your rook wosh wosh

[@madisonking8057]

NGL when i first saw the setup I just forgot that pawns can't move backwards, I was trying to think how white ever stands a chance

[@xtentasticx]

1:45 He should have taken the pawn with his bishop. If the pawn takes, queen wins a rook

[@Lillyluri]

Fascinating to watch!

[@sufferman1]

Magnus in disguise

[@codeovercode167]

I'd love to challenge you as a 1550.

[@honsuaman8743]

What is his own rating btw?

[@oanhienlong7264]

@@honsuaman8743 Idk, but I'd love to know, most of the cases he is against incompetent opponents which sucks out the fun for me. I was screaming for the obvious moves so many times that his opponent doesn't take to took him down on the spot.

[@andeolevain]

Nobody knows, but definitely more than 1550. Would be interesting to find the right setup for a "I'm better than my viewers" game at this level.

[@monacle7467]

1:45 I believe it's a blunder because if the bishop takes and you take back with the pawn you lose your rook

[@crowreligion]

Then you could also take black's rook with the pawn

[@FavvvvazM]

Great video today!

[@alex_zetsu]

Wow black started with an 8 pawn lead and a safe king and still managed to lose this.

[@PedroOPedro]

Bruh the king forgot to go to the kingdom