Comp Climbers VS. Offwidth Foot Technique, Ft. Ondra & Schubert

The first 1,000 people to use this link will get a 1 month free trial of Skillshare: skl.sh/wideboyz07211
COMPETITION TIME!!
Prize:
£150 worth of Wide Boyz shop vouchers with Free Shipping.
Competition Rules:
1. Leave a comment on this video with what move you would like to see in an IFSC competition. it could be made up, and adaptation on something you've seen, just be creative :D
2. You must be a subscriber to the channel. So if you aren't already, click the subscribe button.
3.you must like the video. We can't monitor this, but it's within your interest, as the more likes it gets the more youtube 'likes' it, and the more it will get recommended. The more it gets recommended and watched, the more prizes we will be able to give away in the future.
4. closing time for the competition is midnight Sunday 18th July. Winner will be announced in the following week.
The more you get engaged with this stuff and the bigger we build our community, the more often we will be able to do things like this for you guys :)
We'll be able to give better and bigger prizes to more people, more often, so get involved!!
We check out the inverted foot lock in the recent IFSC Salt Lake City Boulder World Cup. This was a pretty unique move, not one that has really been seen before, which had the men's finalists flipping upside down and into a foot lock.
The foot position is similar to that which you would use on a very wide 'wide pony' invert. The competitors that were successful, seemed to use an invert technique and then with the foot, place their heel into the crack first followed by the toe rolling over the top. The less successful competitors either tried to go hands first, or if they did invert, it looked like they were going toe into the crack first followed by the ball on the heel. This is all speculation, and who really knows what the best foot positioning fo that move really is. Only the 3 competitors that made the move will be able to truely tell us :)
Climbers include Adam Ondra, Jakob Schubert and Kokoro Fujii + more!
Visit our online shop: wideboyz.com
check out our freestanding climbing wall: wideboyz.com/freestanding-wall/
🔴 SUBSCRIBE to our KZbin channel here: kzbin.info
Find us:
www.wideboyz.com
Follow us:
📸Instagram: @wide_boyz wide_boyz
👥Facebook: @wideboyzltd wideboyzltd/
🐦Twitter: @wide_boyz wide_boyz
Contact us:
[e-mail]
Music:
Barroom Ballet - Silent Film Light by Kevin MacLeod is licensed under a Creative Commons Attribution 4.0 license. creativecommons.org/licenses/by/4.0/
Source: incompetech.com/music/royalty-free/index.html?isrc=USUAN1100310
Artist: incompetech.com/
www.bensounds.com
Invert Foot Lock, IFSC Salt Lake City 2021 - Wide Boyz Analyse, foot lock, climbing, adam ondra, jakob schubert, kokoro fujii, crack climbing, crack climbing technique, ifsc climbing competition, ifsc salt lake city men's boulder final, ifsc salt lake city 2021, rock climbing, bouldering competition, pete whittaker, tom randall, wide boyz, foot jam, wide pony technique, ifsc salt lake city boulder finals, ifsc salt lake city semi finals women's, ifsc salt lake city semi finals mens, ifsc salt lake city qualificat

[@WideBoyz]

The first 1,000 people to use this link will get a 1 month free trial of Skillshare: skl.sh/wideboyz07211 COMPETITION TIME!! Prize: £150 worth of Wide Boyz shop vouchers with Free Shipping. Competition Rules: 1. Leave a comment on this video with what move you would like to see in an IFSC competition. it could be made up, and adaptation on something you've seen, just be creative :D 2. You must be a subscriber to the channel. So if you aren't already, click the subscribe button. 3. You must like the video. We can't monitor this, but it's within your interest, as the more likes it gets the more youtube 'likes' it, and the more it will get recommended. The more it gets recommended and watched, the more prizes we will be able to give away in the future. 4. closing time for the competition is midnight Sunday 18th July. Winner will be announced in the following week. The more you get engaged with this stuff and the bigger we build our community, the more often we will be able to do things like this for you guys :) We'll be able to give better and bigger prizes to more people, more often, so get involved!! We check out the inverted foot lock in the recent IFSC Salt Lake City Boulder World Cup. This was a pretty unique move, not one that has really been seen before, which had the men's finalists flipping upside down and into a foot lock. The foot position is similar to that which you would use on a very wide 'wide pony' invert. The competitors that were successful, seemed to use an invert technique and then with the foot, place their heel into the crack first followed by the toe rolling over the top. The less successful competitors either tried to go hands first, or if they did invert, it looked like they were going toe into the crack first followed by the ball on the heel. This is all speculation, and who really knows what the best foot positioning fo that move really is. Only the 3 competitors that made the move will be able to truely tell us :) Climbers include Adam Ondra, Jakob Schubert and Kokoro Fujii + more! Visit our online shop: wideboyz.com

[@justintaylor474]

Butterfly jam with feet move name: Dragonfly Stack

[@Blade2Raiden]

ayy btw the comments about clown shoes, I wonder, I've just bought Scarpa Instinct VS and they got a pretty darn good rubber on top for toe hooks, would these have worked better in your opinion?

[@WideBoyz]

@@Blade2Raiden no they'd be terrible, they bend in the wrong direction. Down turned, not up turned

[@ivarstrang6767]

Inverted kneestack into a righthanded thumbs down fistjam gastogne

[@Blade2Raiden]

@@WideBoyz so basically the best shoes for feet jamming in this moment are flat shoes, right?

[@TheMacroGravity]

If I don't see ondra trout tickling in a world cup, what's even the point?

[@dave_h_8742]

Would be laughing like a drain if O Dog said in interview to Matt Groom, what would Pete do here ! 🤯😂😂😂😂

[@driesvanoosten4417]

Never would have thought it could be so much fun to watch two guys in a Zoom conversation

[@Robert_McGarry_Poems]

Talking about crack, none the less...

[@ntman1567]

Id love to see J Schu doing a full comp route of just crack climbing with the Wide Boyz being the MCs for the comp shouting all the things he is doing as he goes up. Educational, confusing and hilarious

[@BrettMack44]

As fun as it would be to see some insane crack dyno, a really good roof crack would separate the O dogs from the Shoe-Berts.

[@GregBrantUK]

A butterfly jam with feet has to be a “Footerfly” jam!

[@billybones4950]

My exact thought!

[@kokoo2744]

I would like to see a double feet dyno on to crack. Nothing else. Nothing less.

[@groezy]

I want to see more roofs (rooves?) in bouldering comps i remember seeing an old school comp and thinking ive never see a roof boulder

[@omerenes1001]

I loved the idea of a crack only competition. Dont wait for IFSC to do it! I think you guys could organize an amateur crack only competition to find the best crack climber of the world! It can be a cool way of bringing the best crack climbers of the world together annually, and it'll be a joy for us to watch.

[@tommybahommy]

After seeing the book opener in action, I can't wait to see Ondra pull a heelside 480 reverse book opener

[@reflexion.climbing]

There is only one move everyone wants to see. Wide pony all the way!!!

[@Robert_McGarry_Poems]

I don't know, that trout tickler seems like a winner.

[@sambeard4428]

2:40 Pete: "you'll need some.. some.." Me: crackspertise ofcourse!

[@queuecueq]

All I want is to watch a competitor make clicking noises while working out the jam beta.

[@ianculhane8453]

A boulder consisting entirely of tight squeeze chimney (think Harding Slot), followed by a beached whale for the finish. IFSC spectators will have never witnessed such elegance before...

[@grheffron]

Butterfly jam with feet = “footerfly “ 👌🦶

[@matenw.9530]

Imagine how epic that horizontal press move from Feta Kake would be on a finals lead wall! Megos would probably do a split and try to hop up the chimney. You could call it the bavarian chimney sweeper.

[@plengtattoo]

It's got to be the frontside 180 paddlehanded bookopener into a flipperoo. Just to hear Matt Groom try to get that out without laughing!

[@Macks_Mustermann]

I would love to see some assisted Czech style on some mossy starting holds.

[@timoelke1849]

I would love to see one of your cracktrainers in the comps! :)

[@WideBoyz]

New updated crack volumes coming, which are gona blow any crack volume, crack trainer out the water 💪

[@cadenrogers3093]

Crack climbing isn't crack climbing with a good ol fliperoo. Imagine a roof climb where the competitors must perform a fliperoo. Beautiful, simply beautiful

[@BenR66]

that sketchy upside down move that pete did in the vid with Magnus when they set the hardest crack route

[@mcrazyclimbs1470]

I'd pay to see Jan tucked in a corner pulling the old extended teacup into a bookopener

[@toreygroen6585]

Never have I laughed out loud at a climbing video. Best climbing content on the tube. Keep it up boyz!

[@reginabaptista7402]

The banana feet and the fish foot xD

[@melancholiaenshrinesalltriumph]

Here's the scene. A car driving on an elevated platform that leads to a jump across a canyon. The platform has 2 tracks, one for each side of the car with a space in the middle so that the climber can hang from the bottom of the car while it moves. On the underside of the car is a horizontal offwidth called the safety box. The climber has to hold on as the car, hopefully, makes the 100 meter jump across the canyon. Sadly routesetters lack the vison no make this a reality.

[@baumbiber3115]

Chicken crack and arm-baring on the head wall in lead would be brutal, but no fingers needed 😂

[@alexharvey5808]

I just wanna see someone entering a near impossible crux sequence so we can hear them whisper "top rope, top rope, top rope" to themselves.

[@benwhiley9680]

Schubert gave a rueful shake of the head because he felt as though the crowd helped him figure out the move, with encouraging cheers. A kind of hot/cold approach.

[@cameronnewby6510]

A wide pony into a flipper roo. All with Tom’s high pitch voice (from this vid) commentating it with intense energy 😂

[@michaelg9626]

Starting jugs into paddle hands with a back side book opener to get them onto power crimps. Obviously this will be in the olympics...

[@jordanheller1151]

I'd also like to see a full on dyno into a roof wide pony. Even if not in a comp. Someone catching a wide pony out of a dyno.

[@Joseph-mv3rz]

I’d love to see more of a traverse style Boulder. I think that would be testing of outdoor experience.

[@zamiG74ever]

To see a paddle-handed book opener with ollie 180 and a fliperoo combo, would be epic!

[@lvl9metapod33]

I'd love to see some more use of the figure 4 and 9 technique. Love the vids, keep it up guys!

[@Therealadriaanvisser]

Tom’s face while watching the ballet was aa intense as him trying to analyse a crack route bahahaha

[@Therealadriaanvisser]

As*

[@ck1858]

I totally agree with Tom, seeing a wide pony in a roof crack in a lead cup final would be absolutely wicked!

[@homonululukuluku]

The power move that Mari stuck in the basement. Our of a fist jam to a self carved finger crack that looks slightly suspicious!

[@danleitch]

I don’t care what moves he does to get there, but seeing Jakob Schubert squeeze into a pleasure box and start professing his love for crack would heal a lot of wounds.

[@paulelderson934]

He would never dabble in those unnatural crack climbing nonsense! Now back to those triple paddle dyno to practice the competition...

[@slimsyhenrik]

I would just love to see the climbers try a gnarly overhanging offwidth with a transition to a treacherous wide pony hahaha

[@HouseOfOrion22]

Love how Pete lost it with the fish foot, hahaha. Great video!

[@niallmccormack6359]

Some cheeky Wide Boyz cracktrainers with a feet first sequence on a lead climb. Paddle paddle flipperoo!

[@killjoy0973]

Id love to see a team climb for an official IFSC competition. Don't know how you could score it but watching world class climbers from the same country attempting boulders like your impossible boulder video would be amazing.

[@Micke92wr]

A Silence style off-width roof into a thin finger jam section would be evil and fun.

[@catcatcatcatcatcatcatcatcatca]

Haven't had this much fun enjoying top quality crack since last friday night

[@henrycowell193]

love to see a coordination slab. starting on hand jam, run along volumes to catch another hand jam and wide left foot jam, following this another Dyno to a crack and then a funky footjam invert thing to top. complicated but could be pretty cool

[@jordanheller1151]

It's hard to explain but basically a dyno to a single hand fist jam between two small volumes so you can only jam one hand and then a campus move to a crimp so basically they can only campus on one fist, which is unlikely, do a figure four, or crimp the fist and then campus up to the last hold.

[@MrGlenardan]

I just want a deep jam at the end of a problem so mat can say when ondra tops it "now we see the O dog hunting for dung, and he tops it, he ended up finding gold".

[@heididixon165]

As a former dancer I can say that there is significant cross over between ballet and rock climbing. Ballet dancers are experts at hip mobility and developing the muscles for hip turn out. Point shoes are very similar to climbing shoes in design. Ballet dancers develop enormous foot strength. I think that if climbers developed proper foot strength they wouldn't need to fit their shoes with their toes curled. They could let their toes lie flat and rely on strength. Finally, ballet dancers are experts on pressing up to balanced positions on their toes. They would be amazing slab climbers. You guys need to find some professional dancers and do a cross over video.

[@timgroothuis1217]

An off-the-wagon rose move campussing on cracks would be sweet! The routesetters could make the crack so small that only one hand would fit in so as to force some sweet rose move campussing

[@jeffmaya5345]

Running start into an inverted double chicken wing. KFC-stacking their way up. Calling it now, this will be on the olympics.

[@danielwhettam1564]

Nice big swing/Dyno into an inverted foot jam

[@JL-pc2eh]

I want to see more roofs in competitions prefered with big holds that are like Teagan Kaiju Stalactites 1-3 from Kilter. I also love the transition from roof to vertical around an edge. I would like the transition too be really technical and in a way that you drop of the wall when your feet slip.

[@austris_]

Hand stack jam would be amazing to see!

[@v.r.963]

The fancy dyno into hand jam looked perfect for a comp boulder (that noone will top)

[@benjamintaubenblatt6916]

The flying uppercut: Dyno to fist jam

[@TheRedWon]

I would pay 150 pounds worth of Wide Boyz shop vouchers to see Stefano Ghisolfi wide ponying up (or off of) a World Cup lead final! I wonder, if all these super strong climbers are going to be honing their crack skills from now on are we going to see someone attempt to send Silence with Pete's foot beta? That would be so sick.

[@LSDerek]

The final boulder problem should have a pleasure loop, every loop takes 1 attempt from previous problems 💪

[@lomsengvilay]

Double clutch from a hand jam to a back-handed book opener

[@climbingwithgabkels5512]

I would love to see a roof crack in competition! Love the video guys keep it coming!

[@RocksClimbings]

Definitely need to see a horizontal crack, paddle hands, then a double Dino into a ring lock Gaston.

[@maxw2132]

I’d love to see a figure 4, I feel like they’re really cool to watch!

[@finnweber56]

I wanna see the o-dog chalking up in the mono-spin-trough move from „the kraken“

[@przemekstepien3468]

Classic paddle through some roof crack, watching o-dog pleasure climbing whole thing 🙏

[@vaughan6562]

I’m dying to see a classic paddle flipparoo in IFSC , get chatting about some route setting Pete!

[@AZZ14]

I want to see a dynamic start to tea cup Jam. Let's see that thumb strength!

[@ikarosdream5971]

Its time for a crazy handstack in bouldering.

[@ColtonMakesStuff]

I want to see more foot first jams!

[@Alexbeauchesne1]

IFCS COMP : I cannot wait to see a Wide Pony up on the head wall

[@baclimbing6427]

Frontside 720 bookopener, footjam above head, then paddle handed fliparoo into a crack dyno to finish, just pure high quality crack

[@jackhodgkinson1335]

Seeing Ondra and the rest enjoying a pleasure box would be the best!

[@andrewklavekoske3399]

The world needs to see an angry pirate!

[@dragonslayer859]

I wouldn’t mind seeing people chimney climb between Ondra and Megos as those two are in a fist jam hang off either side

[@zuzkamedvecka3760]

Jumping into a hand jam would be cool!

[@jbh5286]

Roof crack would be pretty entertaining to watch these monstrously fit people attempt.

[@mtbrenso6089]

Great job guys, hope you will made soon a europe tour

[@bjornpietschmann-boulderin4610]

Love it with tears in my eyes 🤣 I would like to have a cellar session with you guys 😍

[@ryansawyer6476]

Paddle fish - starts with a paddle, flip inverted to the new "fish feet" jam

[@buddy11212]

I would love to see coop climbing as you demonstrated ages ago! Running has relays and stuff lets diversify and have fun ^_^ btw hello from CZE :)

[@timcapota8033]

Won't even feel like the olympics if there is no backhanded book opener

[@weebowman09]

What we need is a conpletely feet first problem. Show the comp climbers the fear of being hung upside down by your feet for a full 4 minutes, followed by an all 4 points match on the final hold!

[@terezajakoubkova1966]

I would love to see some chimneying followed by dyno to a roof crack. That could be interesting.

[@TheAnthem88]

Would love to see a longer roof crack start into some mantle on a plate. some more variation

[@klassicvibes]

I want to see a sneaky ring lock sequence

[@zacharylaschober]

Czech-style shoulder press into a wide pony with your Olympics compatriot to establish on lead. Circus strongman antics with offwidth technique and almost zero regard for safety.

[@joansole941]

I wanna see some wide pony from some t-cups finishing with a paddle-handed book opener.

[@Fullofbugs]

Megos, Schubert, Tomoa, Ondra fighting inside a pleasure box... for all the world to see. That would be something of epic dimensions!

[@braydenketchum]

I think we just need a massive jump into a decent jam, , it’d certainly be exciting

[@j616s]

Just a plain featureless off-width that leaves them grovelling all the way up. Bonus points if the route setters can get some genuine gritstone lichen on there for a full on slime-fest.

[@hone_the_rat]

I'm gonna have to also go with a wide pony, either that or a vertical offwitdth that widens quickly towards the top to change up the jams a little almost every move

[@EirikJeppesen]

Short vertical crack volume with the top blocked by a dual texture block, no footholds and next handhold directly above, forcing the competitors to dyno into a one arm pull up (or fig 4) on a bomber hand jam.

[@conesa0]

It would be great to see a book opener!!

[@nikhann5682]

I need to see that fishy fella Jakob Schubert being forced into a wide pony with a back-handed book opener on the overhang on the lead wall, before coming over the lip onto the headwall and having to slot in a dirty little cray.

[@GavynPendleton]

I wanna see a wide pony sized roof crack in one of the lead comps!

[@wixic111]

Half time has become wide time. I forgot it was Sunday! Love these analysis videos.

[@ashwood268]

Surely a cheeky book opener

[@tobywalker4297]

would love to see a double dyno into some sort of jam! would be cool for modern comps

[@Rowantree1998]

An evil slippery offwidth! Let them feel the pain of trad 😂

[@ludwigsandtner2112]

full wide pony into a bookopener and the route is a replica of the cellar haha

[@joshuaaddington6165]

I want to see more training videos!

[@ColourTv4U]

Seeing Matt Groom commentating on any of the advanced techniques you taught to him in that live stream would be amazing! Maybe a rest using a trout tickler, since that's by far the best name for a move. 🐟 🤌

[@Airsofter3009]

I would love to see a sport route in finals starting with 5 or 6 consecutive gaston moves, alternating between crimps, pockets, slopers and finally a good crack where crack-climbers can take a good rest before the crux and then the rest of the route. Competitors with a good crack training would enjoy the rest while others who neglected it would struggle a bit or enter the crux already pumped.