3 camera tricks NO ONE will suspect!

[@PeterMcKinnon]

BAM! Always be looking for that surprise! Hope you enjoyed :)

[@softwayre]

Hi Friend

[@UsmanShafiqueVlogs]

Peter McKinnon Booooom 🕺🏼🕺🏼🕺🏼

[@lifeksquared4565]

Always

[@kozy810]

Peter McKinnon dang posted only 3 minutes ago! Let’s go!!!!

[@ryans_life]

You know it! Smashed it 👊

[@alajode]

I asked someone to help me with these... but they ran away with my camera.

[@deeyammy783]

best comment

[@michaelkent7102]

When you follow Jodie and Brendan and randomly find Jodie in the comments of a PM video 😁

[@perimaster8016]

But did you get the shot though?

[@wanderingsoul1198]

Haa Haa Haa

[@alajode]

@@michaelkent7102 You just never know where you're going to find me..

[@JayneNicoletti]

This video proves that behind every successful person is a great team.

[@khuramshahzad7374]

Right

[@tonyadky3792]

Ya

[@Ben-rz9cf]

And behind every great team is Jason Voorhees with a machete

[@Robsn]

Hey I made a video about camera hacks rn! Have a look if you want :-) Would appreciate it!

[@lvm182]

@@Robsn dude honestly why do you hype it up if its not even in English. At least do this at your local creator's comment page.

[@Hiaki1000]

Peter: Birdwatching with like no cameras Also Peter: Filming a video with a camera

[@bobcloughjr]

Lol

[@Ell_lovell]

Me: I AM CONFUSION TOO!!

[@mika2666]

*pulls out 600 f4*

[@GrandisSilva]

Did he see an eagle??

[@BellsRidesAboardSeaBoss]

MY FAVORITE COMMENT, LMAO

[@angwishedmedia3972]

These “tricks” involve having friends.

[@whiteswanlol9086]

Feeling bad for u guy U okay?

[@angwishedmedia3972]

@@whiteswanlol9086 Yeah, I'm good. Let'a just say that this "quarantine" period I'm enjoying. Not much of an extrovert.

[@whiteswanlol9086]

@@angwishedmedia3972 You're right

[@MohdAkmalZakiIO]

...that knows handling camera/s.

[@parsasalmasy]

AngWished Media ayyy bro same, I lowkey like this quarintine. It’s so peaceful and self alone time which is bless

[@christopherpackart]

"Casey told me this once which I really took to heart." *points at head 6:44

[@tonyadky3792]

😂

[@ranjan_v]

I need observation skills like you

[@guyincognito5706]

Christopher Pack Art believe that meant he heard it, or was telling us to listen

[@pushkarbelsare7245]

Guy Incognito but 😂

[@DolisterCovers]

"With no cameras" as he's vlogging 😂

[@OutofOfficechannel]

I just thought the exact same thing hahah

[@shameemaroma3735]

Vlog life 😂😂

[@coltonbushue]

its ya doli boi out here with the top comment

[@larryl]

Ahhhh I came to write the same thing !!! LOL love it

[@DolisterCovers]

@@coltonbushue I DIDN'T EVEN KNOW THIS WHAT

[@thechrishau]

You sure you just don't have a floating camera? I'm gonna go with a floating camera. haha awesome as always homie.

[@PeterMcKinnon]

Don't give it away dude. We talked about this..... ;)

[@Creek5Romeo]

What about a spy camera in the McDonald’s bean sludge cup?

[@johndavidtackett]

Hmm 🤔 I remember Pete “floating the camera” while holding a hotdog on the 1st DopeSquad episode when you shared the Pass the Pigs game (I thought I was the ONLY person who kept that on me in my sunglasses case everywhere I go lol) and it looked freaking sweet then and it looks freaking sweet now!!!!! 😎

[@ANAKCreates]

link in the description??

[@TheVADstudio]

😂😂😂😂😂

[@LEZOMY]

Instructions not clear: I tried the floating camera now its broken into pieces.

[@Auxemplary]

Yea it doesn't work when you have no friends

[@sweetgem__]

😂 ^

[@evanbutler6465]

@@Auxemplary ooof dude

[@Karimsemeda]

متعملهاش تاني يا أسطورة 😂

[@fathurrizki6551]

@@Auxemplary true A.F

[@Lilylikecom]

this video is too good. you're literally a camera magician lol

[@HadiFilms983]

Haha so true😂😂😂

[@SusannahPerri]

OMG, Peter, I have watched SO many of your videos over the past couple of years, but just saw this one for the first time. It is one of my FAVORITES!! I had a smile and laugh the whole time I watched. Please never stop making videos, you are such a joy and inspiration! Big cyber hugs to you!

[@DavidWeder]

Yeah everyone has this one friend who's always waiting at home so he can be your assistant when ever you need him.

[@jgwulfert]

Yeah everyone has.....

[@skydaddy4192]

Unfortunately, i am that person. It's not like i love doing it, I just have nothing to do.

[@ZER-cr4dm]

Yeah no one likes doing it

[@sunflowerc9560]

😂😂😂

[@shinichi9do]

more like studio

[@timetravel2390]

''I Mean I will probably still drink the whole thing'' yup, relatable hahahaha

[@ANAKCreates]

haha yupp, totally know what he means. Basically everyday. haha

[@paulwatrobski8277]

Notice how right before/as he said that he put one cup down and then picked up another/a different cup?

[@ANAKCreates]

@@paulwatrobski8277 haha yes, he had 2 of them!! like of course hes gunna drink the whole thing..

[@AndreaJean]

Time Travel ha ha yep me too!

[@TheGrizzlyGarage]

So basically hire a little dude to follow you around to get that extra spicy vlog. LOL.

[@loveinatincanclintericka]

I love how excited and passionate you are about these! It's infectious and makes us want to try it too!

[@colinalexanderd]

Well done! I definitely wasn’t expecting the last one. And the little BTS sequence at the very end was just some good, clean fun

[@wizcombo]

Colin Alexander nice workout lol

[@LionelChambers]

the montage at the very end where peter keeps on looking back at the camera after walking away is gold haha

[@GawxArt]

Thank you so much for sharing this tips to us and inspiring me to make videos❤️ you’re awesome

[@TheJubileeDiaries]

Doodle.

[@bertjes2]

Look at you now, crazy

[@tj44017]

I've found the best photographer/cinematographer.

[@rahuls.krishnan4565]

Nice! @him please

[@xtonibx5770]

@@rahuls.krishnan4565 💀

[@natedicamillo3440]

/magician

[@davegrbic]

The last 30 seconds showing BTS...thank you for this. I've never seen anyone share these raw clips before and it's just nice to see how in reality things are as normal as you think, just down to post editing. Peter always keepin it real - thanks brother!

[@BestBrandsPerfume]

I just love these camera tricks, I once used the one where you snap your fingers and your clothes change, you taught me that too. You could have a camera master class people would pay big money. I want a discount since I know you though.

[@RunNGunPhoto]

I *DID NOT* see that 3rd one coming! hahaha! Awesome as always Peter!

[@dibees]

What was the 3rd one? I'm so lost

[@GoProMeetsAeon]

yea whats the last one? Just mounting it onto the car via Gorillapod?

[@filmmaker_howl1342]

he said it`s surprise,3rd one is surprise，so there`s no third one , surprised? you got it?

[@PaulaHeartland]

His friend drove. That's why he had to secure his camera 🤣

[@leonwong95]

noticed there's no people in the car while he shooting :P

[@ErykLapitz]

One of my favorite channels on KZbin. Literally, inspired me to make my own channel 🙏 Thanks Peter

[@PeterMcKinnon]

You're welcome! Don't forget to have fun with it!

[@dwitkowska]

Your joy is contagious, Pete. Thx 😍

[@dntliecate]

He makes me want to do better

[@ErykLapitz]

Marycate Masilela makes you want to make best video ever

[@ErykLapitz]

Peter McKinnon Most definitely ! 🤟

[@Victoriaro]

I was so surprised by the first one 🙈 Great!!!

[@catcatcatcatcatcatcatcatcatca]

This may sound rude, but the first one is so believable because people naturally assume vloggers don't have friends. (when filming)

[@NickIby]

Well now 2.9 million people will suspect it... 🤔

[@PeterMcKinnon]

Damn. You’re right. Hahahaha ;)

[@shameemaroma3735]

😂😂

[@JosiahVaughan]

😂😂this comment is golden

[@swiftproductions5241]

I literally clicked on this video just to make this comment but I see you've beat me to it. Fair play.

[@ThisIsTechToday]

Oh, man. These are so much fun! BTW, who's the friend helping film?!

[@Hectoralejandroguerrero]

This is Tech Today incredible !!!!

[@Wh33lsofFortune]

What's up sir

[@ThisIsTechToday]

Hey, Hector and Chris! I see we all have amazing taste. Peter is incredible.

[@Wh33lsofFortune]

@@ThisIsTechToday herooooo

[@NohohonFTW]

I think its Kirk Lepiten, he is really good! Maybe he is his Editor? Pete never told us 🤷‍♀️

[@DuncanSmith]

That episode 1 title 🙌🏻🙌🏻🙌🏻

[@sophieshen6054]

You are so great!! can't imagine how many efforts behind the scene to make this tutorial which is so easy to understand and fun to watch.

[@HaleyLafaye]

I think my favorite part of most of Pete's videos are the ending clips like behind the scenes and bloopers... and ya know the camera stuff is pretty dope too...

[@Hashoshi4]

You know what I suspect....? another 8 minutes and 30 seconds of my life well spent watching Pete's content... yup. Inspiring my content FOR SURE

[@frittern7013]

No friends? No problem ;) Use a tripod with weels and create the same effect🙌

[@CoalitionGaming]

A Dolly :)

[@ronnation630]

Solid

[@unclebobbyb3917]

No friends

[@asjaljunejo3174]

He is like us No friends

[@bendixtrinity8337]

and it tips over. pentagon hexagon careergon.

[@TenthElementGraphics]

All these tricks require having a friend. Guess I'll wait for the next video.

[@Prejippie]

Cool tricks! 🙌🏾😀

[@AkhilMantra]

Superb... You are taking the vlogging to the next level. Your work is helping us think differently. Truly amazing... Love you..God bless you.

[@FotoFinn]

Now every shot of you vlogging I just can't trust that you won't sudden'y let go and let us float away 😂

[@MarriedwithWanderlust]

GOOD EVENING AND HAPPY NEW YEAR FROM SOCAL. Love the tips and can't wait to use them on the next vlog. Thanks for everything Peter. Travel More! Worry Less!

[@faizanraza583]

6:46 says "Took to heart" and points to head. You gotta love Peter

[@TheProvokedPrawn]

This is ace. Love it.

[@twoline567]

Tells camera: "I am bird watching without any cameras" You fooled me

[@AdrianWardhanaa]

Thanks Peter!

[@brickdaddiy]

Here I was thinking I needed some kind of rig, and I just need a friend

[@BikingWithCraig]

Once Upon A Workbench for me a rig would be easier to find 🤣

[@MJ98.]

#1 have a friend 👍

[@anthonyisensee]

Guess that's gonna be a no go for me. :T

[@ChinchillaByte]

Here I am trying to learn to make more interesting videos & you're literally showing me things I've never noticed that make such a big difference. Thank you Peter!

[@evanfinley2905]

I Like the fresh vibe for 2019! Thanks for all the great content!

[@Ryansacrobat]

I actually did the floating camera once and thought it was a great idea, but NOBODY noticed! :(

[@Ryansacrobat]

@@drewholmes9946 Well of course, but additionally, I dont have the same amount of people watching/commenting so naturally, that would be one of the effects that wouldnt be immediately called out.

[@MaikKleinert]

Just keep doing it in your videos from time to time. A lot of people are regains it but there are to lazy to comment ;-) Hope you had fun creating the floating move that's all at the end! @@Ryansacrobat

[@Ryansacrobat]

@@MaikKleinert Thank you for that! I will ;)

[@marcushillerstrom25]

Do it exaggerated, like pretend that your dropping the camera and it just floats away and then back to you or something.

[@veganlifechange]

But they probably enjoyed your video more all the same!

[@BradyuNunez]

Almost at 3 mil my dude

[@Huenique3dprints]

I would love to see more unedited raw behind the scenes. (from other angles) For me, that was very interesting and almost a sign of relief and a boost of confidence. While doing vlogs, I myself and I know thousands of other people feel very awkward talking into the camera and everytime I watch your vlogs, I'm almways soooo jealous. Seeing the raw behind the scenes from another angle gives me that extra boost of confidence. Maybe it's just me.

[@caravanlifenz]

I saw a Pewdiepie interview once, and he said he was so shy in the first videos that they don't even feature him speaking at all (just playing video games). But it slowly became more natural talking and recording himself after he made a video every day.

[@BookerLeslie]

Love this Peter!! Some of my favorite videos are when you show these tips/tricks.

[@AAvfx]

*I needed that! Thanks* ☺️

[@Deviajeconlacamara]

New camera bag ? I think you are preparing a big surprise about this.

[@arquivofranklinmedrado]

Excelent video 👏👏👏👏.

[@MaxDiamond]

I saw that third one coming, I was like why is he standing in the bed of his truck?? haha Great video Pete

[@ZER-cr4dm]

What did he do? He just put it on the truck and move it

[@musictamaulipas6319]

Doctor Who Cares you have to listen carefully

[@ZER-cr4dm]

@@musictamaulipas6319 Cant you just tell me?

[@naeemcharania8996]

idgi

[@Mrdennismalloy]

He subverted your expectations, by not giving you #3

[@RoadsofFaith]

I wish I could hit the like button multiple times to show how COOL this was to watch and learn from! You are AMAZING!!

[@jennybaxter6532]

I looooooove this video! So cool! Love the B roll shots from the Episode intro in the snow. Love it!

[@adamconstanza]

Your vids never disappoint bro! And now I'm gonna try incorporate something similar into my next vid. You keep teaching, we keep learning. 👍

[@s101077]

Just goes to show ,how important a trustworthy friend is bro

[@NorikGaming]

I would love to see more BTS, it's interesting to see how things are done. Love the work Peter

[@Vejur9000]

Your energy is infectious, Peter.

[@Itsjessieleeee]

I just found your channel by a friend telling me about it. Love it!! Can't wait to learn filming tips and tricks!

[@lapzap8127]

How did he get in truck while he was in ground??😉😉😉

[@leonwong95]

Casey went in the car while Peter opening the back door?

[@SirPhoebus]

What ? He opens the back door, climbs up, puts the cam down, climbs down, someone drives away. He showed all this where are you confused ?

[@4shortpants646]

Misdirected

[@myke.p]

@6:38

[@sinjon]

SirPhoebus its a joke

[@derkholme]

So what you're telling me is.. I need my own personal camera guy??

[@ExploredPerpsective]

That's what I took from this!

[@RohitVinay]

Your first camera tricks video is the reason I subscribed to you, I tried to use those in my art channel.

[@ConnorEckdahl]

Same, but I cut open my lens with my knife... :/

[@waderaudi]

When I watch this dudes content, i see so many things that I want to represent with my own Photography. Just the absolute general love for photography and making content. Not for being recognised for it, but for recognising my own inner ambitions and artistic eye. That is true success.

[@Small_IslandGirl]

You need an award for teacher of the year! Thanks for making these videos, especially for those of us who haven't been in a classroom in forever or maybe never.

[@sammoffoot888]

3AM two options: -> sleep -> watch yet another BANGER by peter think you could guess which I picked

[@dominatingsole1775]

This video made me reach for my coffee. I wish I had coffee

[@InternationalBassStation]

...you can stay

[@Tipster49]

0:09 “I’m actually bird watching, with like no cameras...” as you talk into a camera

[@fuego604]

Good catch .. lol

[@bin369bastola]

Peter your the best beats on creativity ...you inspire me mate

[@שריההכהן-ו1ט]

its my first comment... i recently started to look for guids for first steps photo shooting tips. and just realized your chanel and its one of the best things ever seen. very intresting and usefull!! thank youuuu!

[@benjaminsolomon461]

Well now that Peter made this video, everyone will suspect these tricks 😂

[@spencerrr9878]

Okay honestly #2 went over my head at first 😂 😂

[@TheFriendlyReviewer]

Great stuff - is this when you broke your lens with the Joby?

[@Jmschnider]

I doubt it being in this video the joby was already broken

[@sinjon]

No the jobs broke when it fell off a counter. It damaged one of his lenses too. He talked about it in his camera bag video

[@Kunafah]

Thank you for the very kind demonstration Peter! Loved it

[@blessedisphenomenal]

Thank for putting in so much work into your video for viewers to enjoy

[@seanbilly22]

Goteeeeeeeeeeeeeeeeeeeeeeeeem

[@diydogs6714]

Hey peter I’m looking for a cheap (but good quality) beginner camera I was wondering what you thought about the canon eos rebel sl2?

[@diydogs6714]

Or the canon 60d?

[@whosjozikolnik]

Yes go for SL2. You have nothing to lose!

[@diydogs6714]

Well my friend is selling me his 60d for 300 vs the sl2 witch is 700

[@BradyDean]

lol when he said "there's Literally Nobody behind me" haha when at 4:18 you can see people hahah nice job XD

[@oneavinashkumar]

That was really cool! Good job, Peter :)

[@GeekRobotYT]

I really like the last one! Think I’m going to try it out for myself

[@yammi385]

0:10 "I'm actually bird-watching. With like... no cameras" Then it cuts to b-roll. With no cameras huh? 🤔

[@DontKnowLetsGo]

Awesome as usual, Thanks Peter.

[@Hectoralejandroguerrero]

Don't Know? Let's Go always learning bro!!

[@DontKnowLetsGo]

@@Hectoralejandroguerrero true true, never stop.

[@intothevoid47]

@3:26 Can someone please explain that?

[@toreontrack]

He is literally explaining as it happens

[@intothevoid47]

@@toreontrack I think you're slow. Maybe rewatch the video, you'll catch it.

[@toreontrack]

@@intothevoid47 Nothing off about that part. I must be the slowest on earth I guess

[@intothevoid47]

@@toreontrack it might have been in another video, but there was one point where he said he gets that comment all the time where people ask "can somebody please explain that?" It was supposed to be a joke. I guess that was a joke you missed because you didn't see that part.

[@toreontrack]

@@intothevoid47 Skipped the intro lol, my bad

[@GuilDormeus]

I can watch this video all day. Amazing as always

[@chinmayasinghrawat4622]

This video was soooooo good! Came for the tricks, stayed for the BTS.

[@MichaelNNguyen]

You can also try this using a Manfrotto monopod.

[@Ropetupa]

I thought that this effect will be easier to achieve when you have a drone. I wish I would have known that was BAD idea before I lost my index finger.

[@tjsinva]

I may have missed it, but why doesn't the other guy get some kind of credit. Just a thought.

[@jrukiddingme]

thats kirk, one of the editors that applied for matti's job opening. at one point peter also mentioned he wanted to get an editor. the white computer chair also literally has kirk's name written on it (well its covered now but you can see it on one of the older episodes). An educated guess would be that he's now the editor for pete, but pete doesnt wanna talk about it yet. Its kinda been a while since the chair first showed up btw.

[@survivingfaith]

Always love learning from your videos ♥️

[@jacobjohnson9810]

DIED laughing at those BTS clips at the end. Peter you seem like such a funny guy on and off camera, please do more BTS!

[@LashanR]

I tried this but my camera ended up floating away :(

[@Anon54387]

Use fewer helium balloons next time.

[@Robsn]

Hey I made a video about camera hacks rn! Have a look if you want :-) Would appreciate it!

[@TheCrowleyCrew]

Ha!! Saw the BTS! Does that mean I am a fan? So have you even touched the eos M50 since that one video?

[@wenhuber]

The Crowley Crew 👏👏

[@gregweir3380]

Woah I was just watching your videos yesterday. You've already helped me a lot with my m50 haha thanks

[@yoacasia]

Soooo close to 3 mil 😮

[@wenhuber]

Acasia Simone truuee

[@firinglinechannel]

Good stuff! I always get to excited and just shot the info for my vids and put the details on the back burner. Definitely have to work on that

[@Ankmovingarts]

Well, quite creative with the gadgets & stuff

[@MJSailing]

Well, if anyone didn't know you were Canadian before....

[@SEANLIGHTZTV]

Don't worry about this guy up there, clearly he's a douche that gets zeroooo pussy lmao

[@MelvinAlc]

First you always surprising us Pete

[@Hectoralejandroguerrero]

Melvin Alcantara always bro

[@a1_boss]

Who else came from tiktok

[@cheetoclips1904]

EwWwWwWwW

[@m.singleton8688]

You're so lucky to have snow. I live "down under"....great video!!

[@vovik05]

Great stuff! You're turning in to my favorite KZbinr!