The Wobbly Future of the Hard Disk Drive Industry

[@hanselda]

I am always amazed at mechanical engineering of modern HDD. The slider is mounted on a long stroke stage performing micrometer movement and a 5 DoF short stroke to do nanometers positioning, all fitted in a tiny device cheaper than 100 dollar.

[@lucasrem]

Try to make a transparent front please, install it in a clean lab environment, see what it does ;) any old drive is the is good.

[@johnlacey155]

yes they make a swiss watch look a very rough piece of engineering, yet they cost a fraction of the price

[@HeadlightsAreTooBright]

Amazing until my dumb ass drops it

[@PorqueNoLosDos]

Preach!

[@BillAnt]

I like the MAMR approach better, by its inherent design it should be more reliable than heating the platter. You can focus microwaves better and more precisely with no heat involved. It almos like the difference between CD and magnetic recording. imo

[@thomasruwart1722]

Here's an interesting tidbit: the tracks on a current-generation HDD are so narrow that you can fit ~1,500 tracks on the EDGE of a piece of paper.

[@MegaChickenPunch]

@@thomasruwart1722 jesus christ that's unimaginable

[@thomasruwart1722]

@@MegaChickenPunch -Kind of makes you want to go do a backup right about now, doesn't it...

[@MegaChickenPunch]

@@thomasruwart1722 fortunately i don't use hdds any more. All of them started clicking/getting bad sectors. Completly unreliable piece of tech. I have raided SSDs and zero problems ever since.

[@nickwallette6201]

Huh. Well someone should tell them to use the front instead. It'd be much easier.

[@paulmichaelfreedman8334]

I am keeping that one, that's one heck of an analogy that I must tell others.

[@Vincent-sq3qy]

References are clearly stated. Slow pace, multilingual subtitles, friendly for viewers whose native language is not English. Perfect video, great work.

[@danielalba7651]

I see a Sophie pfp

[@awesomeferret]

So... Good luck explaining how a video that contains misleading statements (EG "SSDs are more reliable") be "perfect" ! 😂 After all, the entire premise of the video is itself debatable (there's obviously plenty of evidence suggesting that the HDD is here to stay long-term).

[@Fennecbutt]

​@@awesomeferretssds are more reliable lmao

[@BertRedd]

@@awesomeferretdid you read the comment? He’s not defending the conclusions.

[@TammuzKay]

Amazing how far we've come from simple cavemen smashing pieces of magnetite together to store low resolution bitmaps of their hunting achievements.

[@xmj6830]

Ah you're one of them believing such stupid theory...

[@raylopez99]

Or a caveman throwing an animal femur into the sky and it turning into Space Lab (2001 ref).

[@matijaaa]

@@xmj6830 oh my god why does every comment section have to have people like you, do you guys have anything else to do????????

[@MegaChickenPunch]

@@xmj6830 take a bath with a toaster

[@ricdeh1701]

@xmj6830 Lol buddy, you are the stupid one for denying evolution

[@gkanai1400]

As a consumer, most people who use devices wont purchase an HDD unless they buy a tower PC or build their own PC and add an HDD for mass storage. Of course we all use HDDs daily via cloud/streaming services. I appreciate that we have the choice of SSDs for speed and HDDs for capacity.

[@T-Ball-o]

and HDDs for long term storage, too. An unpowered SSD can start losing bits in as little as six months

[@christopherd.winnan8701]

1TB satisfies most ordinary consumers. I have more but I struggle to imagine how I am ever going to watch all the video that I have in just a couple of TB. 20TB seems like overkill for home users.

[@savedemperor8024]

I only use a ssd for installing windows on it and the rest is still hdd and i even want to get one or two of those new Seagate 30tb server hdd for storage lol

[@savedemperor8024]

@@christopherd.winnan8701 Well i want to get two 30tb hdd drives so there are exceptions 😂

[@johndoh5182]

@@T-Ball-o Both forms of storage can flip bits over a few years. You can do a disk operation for HDD that will refresh the data. Yes, I know it's magnetic and the data should be retained, and yet there is a program to do this very thing. The bigger advantage is LONG term storage because a magnetic disk has a much longer life expectancy if you aren't constantly spinning it, as in over 2 decades, once again running a refresh every few years. An HDD will retain its magnetic field strength for over two decades. An SSD won't last that long, and 10 years is about as good as it gets regardless of it being powered or not. So, you not only get more capacity but also more life expectancy with HDD, once again if you're not spinning it all the time.

[@Markimark151]

Lot of businesses still use HDD because they’re more durable and cost significantly less per data compared to SSD. Seagate and Western Digital still makes hard drives for a reason, even game developers and animators use them to store their large assets of data!

[@BrophyMichael]

I was wondering why hard drive prices hadn't come down in the last 4 years! I wanted to back up my capture footage and building a NAS is too expensive so I just bought a massive 14TB HDD in 2020 and backed up everything and it cost me $210. Fast forward 4 years and now 14TB costs 250. It's gone up! This makes so much sense now, thanks for the great video!

[@Geo64x]

I bought a 4TB seagate barracuda off of Amazon for $160 in 2020... it died within 3 years (just outside of warranty)

[@ivanteo1973]

so what can you get for $250 10 years ago?

[@AchmadBadra]

They just want forcing user to using their QLC, by reducing their hdd factory and stock to rise the pricing. And rightnow they just on the fire to revive HDD one ☠️

[@cjay2]

You need to buy one more and copy everything onto the new one - for back-up. One always uses (at least) TWO, not just one.

[@cdl0]

The reason is two characters long: AI. It need huge amounts of storage, thus demand exceeds supply, and hence the market price increases.

[@danirichard470]

I remember reading a Datamation article in 1975 stating that demise of magnetic disk was just a few years away. That was when the CDC 300 MB disk has just came out and were put on washing machine sized pedestals.

[@skilletpan5674]

I remember magneto optical was supposed to be the future in the 90s. Where are zip disks now?

[@BillAnt]

​@@skilletpan5674 - MAMR is similar to magneto optical but using a microwave instead of light. There's usually a breakthrough every 10 years as materials and technology improves, so we shall see.

[@skilletpan5674]

@@BillAnt A couple of things really killed zip disks. The advertising was ok but not fantastic. The IO interface and the cost are the two main things that killed it. They had IDE that from memory wasn't standard or was rather expensive for what you got. A typical HDD at the time was faster generally so most people would just put bulk storage on their HDD and suffer loading it on floppies. They had other interfaces (parallel was really slow) such as scsi and USB. I only used the parallel version which was of cause rather slow. USB solid state drives were starting to become good around the mid 90s and zip drives only started to sell in 94 so I think also the timing was terrible. If they'd been 2 years before then it would have had way more adoption.

[@manuellongo4365]

I never cease to be amazed at the microscopic scale of these (HDD 's and semiconductors) they are now to the level of single or small number of atoms. It is absolutely incredible.

[@uss_04]

I love HDD’s just not in my personal machine. Preferably connected to a NAS with dedicated caching.

[@ayomideajimuda8234]

I like to use the store a lot.of my personal information since it cheaper than portable ssd

[@johanslabbert2869]

If ever there was an award for the best combination of simplicity of design, reliability, precision of operation, portability, robustness and cost, it would probably go to the humble present day hard drive. To my mechanically inclined mind, it is an intrinsically trustworthy technology, far more so than any SSD. Much respect, may it continue to exist for many more generations.

[@Fractal_32]

Tape drives are good too. Remember 3-2-1 for backups.

[@shoego]

I prefer HDDs over SSDs for long-term storage. I have many external hard drives where I back up photos and family videos, besides documents and other things. Not only are they cheap, but they are proven to last for over ten years, which is enough for me to replace them before they fail. HDDs still have their usefulness to me.

[@Sku11Basher99]

Missed opportunity to call it the floppy future

[@strob5657]

Nice.

[@SpiceFox]

for me, there are two advantages: cost per byte is the main, but also an hdd will hold data much longer unpowered. For main computing though, ssd is the only way to go

[@jovetj]

Exactly. I am still happy to buy HDDs for mass storage and archival/backup

[@you2be839]

But how long do you need to hold data unpowered? For me, any data that I only access a handful of times per year goes into BD-Rs, and anything that I need on a weekly or even monthly basis goes into SSDs, even if it doesn't benefit from the SSD's speed. I still have several HDDs, but I'm only waiting for them to start showing read/write errors to replace them with SSDs, and I haven't purchased an HDD in the last 7 years... it's either SSDs or BD-Rs for me!

[@BillAnt]

HDD will continue to sell as long as a gig is $1 cheaper than SSD's. Once they become equal in cost, that will be the end of HDD's.

[@MikkoRantalainen]

@@you2be839 If you keep any offline backups, you'll have unpowered storage. And if you don't have any offline backups, you'll be vulnerable to ransomware attacks that encrypt all online storage. Granted, such attacks are not (yet?) that common but they do happen.

[@robotron1236]

Yeah, this was basically my comment as well. I got a bunch of HDD's from a garage sale that hadn't been used since 2005 or something, that had perfectly intact data and windows 7 installations that were still bootable using my Xeon CPU. That's probably my favorite feature of my $30 14 core Xeon, is that I can boot literally any windows install. It strictly runs Linux, but if I need to boot a windows drive bare metal or even in a VM, it just boots it no problem.

[@johnlacey155]

HDDs have never really been on a march to oblivion. If anything, it's the reverse.. HDDs are not what consumers want any more, but in the world of cloud and hyperscale providers, there is nowhere near enough production of SSD storage. HDDs have been where the bulk of all data is stored the whole way along (ignoring tape for archival purposes), and there isn't much sign of that changing (in terms of SSD production catching up). I wouldn't say that the future of HDDs is wobbly! :)

[@KH40T1C_yt]

this. Plus you add in filesystems like ZFS (with SLOG on a small SSD device / partition) and you mitigates a lot of IOPS delays.

[@ellescer]

Thanks for repeating what the video already stated

[@johnlacey155]

@@ellescer oh so the video tells a different story to the title? should I watch the whole thing?

[@VVashabi]

1TB SSD are cheaper than 1TB HDD and casual consumer doesn't need more. 2TB SSD were at the same price too before recent price hike. Small HDDs are on their way out.

[@raymond9290]

But 1 TB HDD can last more than 20 years which SSD can't​@@VVashabi

[@megalonoobiacinc4863]

when i bought my new gaming pc in 2019 i saw the 1TB SSD and figured i didn't need more, a year or two later i bought another one. However pretty quickly i realized just how easily a steam library eats away at the available space. Then there's all the cruel updates, tearing away at the poor SSD's life expectancy. So i was pretty happy finding a highly reviewed HDD with 18(!) TB of storage space :D

[@AC-jk8wq]

I just watched a video of a lecture by Dr. Grace Hopper about the storage of data in 1982…. A year before I bought my first 10meg Winchester Hard Drive… The topic was the time value of the data being stored… recent entries vs. ancient history… 😃

[@alexandera.1411]

Mine was a Bulgarian ES 5 MB five-inch drive.

[@thorpejsf]

The physics of the hard disk drive never ceases to blow my mind. Great installment, Jon!

[@siberx4]

Tape media endured a big slowdown in the 2015-2019 time period due to some ugly patent battles around the LTO-8 format that effectively stagnated capacity increases and kept prices for existing media higher than they should be. I think this is resolved now, but it definitely put tape on the back foot compared to hard drives in terms of capacity increases over time. The history of tape storage might make an interesting video topic. You briefly mentioned shingled magnetic recording in this video but didn't elaborate. The technology is somewhat niche/controversial, because while it does improve areal density, it vastly complicates the writing of new data to the platters (especially when there's existing data nearby). It's a cool trick, but you need to ensure your whole software stack is aware of the quirks and that your workload is suitable for the restricted write patterns that shingled drives can handle efficiently. In some ways, it's similar to the caveats around rewriting flash storage, except that flash is so much faster than hard drives that they have a lot more tricks available to hide the overhead. Some of the hard drive manufacturers (Western Digital in particular) have gotten in big trouble for selling shingled drives without clearly disclosing them as such, and consumers were understandably very annoyed when their general-purpose workloads performed like junk. One interesting change I've noticed in that last 5-10 years is that while hard drives _have_ gotten larger (although the rate of improvement has slowed) the cost per GB has plateaued quite significantly. Prices per GB used to drop every year (and there was a distinct curve of prices across the size range). These days though, you basically pick any capacity between about 2TB and 20TB and the price per GB will be nearly identical; you just buy the drive size you need for your application and that's that.

[@guytech7310]

Nah, Tape is dead. Too much hassle replacing drives because of warn out heads, PITB accessing data, and refreshing tapes as they degrade. Virtual Tape Drives replaced tapes more than a decade ago.

[@someguy4915]

@@guytech7310 Lol you're all over here spamming how you couldn't get tapes to work. Are you selling VTLs or something?...

[@meneldal]

SMR shouldn't be an issue if you're using HDDs for what they are meant to: huge amounts of big files. Random writes were never great with HDDs

[@guytech7310]

@@meneldal "SMR shouldn't be an issue if you're using HDDs for what they are meant to" Yes, but you never see SMR drives marketed that way. Usually you have to check the fine print & consumers often buy them, not realizing the limitations.

[@Mr.SharkTooth-zc8rm]

HDD ain't dead yet.

[@MegaChickenPunch]

too bad

[@jtelliso]

Not yet, but hopefully one day we get m.2 or other SSD that out size the platters. So far tho 20tb platter is way wayyyyy less cost than 20tb of ssd storage.

[@volvo09]

Hard drives have a market. Can't get a 20GB SSD that can be stored for years without power

[@MattExzy]

I left a flash drive unplugged for what I think was two years. Totally corrupted, nothing was recoverable from it. So as far as even short-term archiving, flash memory is very untrustworthy. I hope optical media makes some sort of comeback, or we're potentially going to have an entire era of missing personal data.

[@jtelliso]

@@volvo09 Yeah, SSD is good at storage but they do need to be powered up much more frequently than a platter drive needs to be power to keep everything happy in the long term for data integrity.

[@rockpadstudios]

I live next door with a guy that spent his entire career at Seagate. He told me all about HAMR tech and was working on a new HAMR drive before a layoff. He says the fines for selling drives to china cost Seagate millions with the decline of HDD because of SSD. Tape drives still are the best long term storage.

[@crash.override]

*for selling drives to Huawei specifically

[@paulmichaelfreedman8334]

It may have cost millions, but if they were doing it, it means they were still making a profit off of it. Simple math, and all about $$$$

[@MegaChickenPunch]

@@rockpadstudios good! this horseshit company must not exist

[@lucasrem]

long term storage or archive it, many levels we do, tape is the last stem, argive it, before that step, you need to direct access is, HDD will be a solution for years to come.

[@guytech7310]

Tapes suck. I cannot recall the number of drives we had to replace because the tape drive heads wore out, and they are a pain to access data. We replace them all with Virtual Tape storage more than a decade ago.

[@video99couk]

I generate 4k KZbin content as well as running a business digitising tapes, so I absolutely rely on HDDs for the vast quantities of data. My total capacity is presently about 140TB, but if I could get like 40TB drives at a sensible cost I would certainly want them. SSDs have their uses, but not for every application. They're also not so well suited for applications where data is being written continuously, such as CCTV.

[@flyingdutchman28]

HAMR TIME!!! Sorry. I had to do it.

[@stevebabiak6997]

Can’t touch this …

[@raylopez99]

@@stevebabiak6997 If the head touches it will crash and bring down da house.

[@edward9674]

Hammer.exe is the best encryption option for HDD's.

[@tr1ck5h07]

It’s MAMR time!

[@VincentTorneyPlus]

STOP.

[@vi6ddarkking]

If they ever solve the laser problem. The new multilayer optical disks would be a worthy successor. To the good old hard drive.

[@T-Ball-o]

Optical has always been miserably slow

[@MBunn-uf1we]

@@T-Ball-o for archival storage it would be great.

[@Blink_____]

@@MBunn-uf1we still ridiculously slow

[@thomasruwart1722]

Tape is the thing that will outlive HDD and SSD. I know this because Mr Spock often refers to computer "tapes" and that is a few hundred years in the future! So, there you have it!

[@paulmichaelfreedman8334]

@@Blink_____ Complaining about properties that are not important to the application, isn't very constructive.

[@haven216]

HDDs definitely still have a place in mass storage. Much more capacity for much cheaper. They won't be going anywhere any time soon

[@privacyvalued4134]

HDD isn't dead until the cost per TB gets to be about the same for SSD. The gap between SSD and HDD is definitely closing though. Right now the sweet spot for bulk storage, especially for backups and very large files, at affordable prices is HDD at around 13TB. Tape storage isn't nearly as cost effective per TB. Sure you can get 20TB tapes but they are two times as expensive as HDD storage and the tape drives themselves aren't cheap. SSD/NVMe drives are about 6 to 8 times as expensive as HDDs. Used to be closer to 10 times just a few years ago. So there's still a very significant gap in cost per TB between the two technologies.

[@mintoo2cool]

there will always be a market for HDD .. specially in archival and cold storage usecases

[@catcatcatcatcatcatcatcatcatca]

Tapes have a huge advantage in cold storage because of the form-factor. AFAIK the tape in itself is entirely ”passive” component, meaning there isn’t as much that can break during storage. HDDs don’t allow storing only the disc and making the read/write mechanism independent. So you still need to pay for the rack-space and server to ensure broken disks are detected and swapped before data is lost.

[@v12alpine]

For cold storage HDD's are still king for disk sizes over 1TB... just my opinion.

[@asm_nop]

I'm honestly just glad that HDDs lost the battle with SSDs in the

[@AchmadBadra]

I dont care about cost per TB, but the durability. Even some ssd is already cheaper but the trade off is their durability 1/4 than before.

[@thisisausername1265]

I enjoy how you say MAMR and HAMR.

[@AC-jk8wq]

You must love his DRAM as well. 😃 Jon is an efficient speaker… he has saved a few syllables over the years…

[@KF-bj3ce]

Great lecture on Hard Drives. Thanks.

[@mattilindstrom]

Shingled magnetic recording serves best as a write once, read multiple times medium. The write delay plays merry hell with e.g. the ZFS file system. A couple of years ago there was a problem with HDD manufacturers selling shingled type disks to consumers and companies without explicitly stating what they were getting.

[@guytech7310]

I avoid SMR. More of a gimmick than really useful. Only except is for backup storage media.

[@innonation]

Thank god when this channel mentions NFT, it's referencing a technology other than that hype train and some ape.

[@ronch550]

It's up to PC makers. Many laptops these days don't even come with HDDs or HDD bays anymore. Same thing happened with optical drives.

[@shockwavecity]

2 months ago: "Why hard drives are dead" Today: "THE FUTURE OF THE HARD DRIVE INDUSTRY!"

[@nathansmith7153]

Well in 1973 when we did the first one at IBM we were told the industry would last 3 years

[@scaryjam8]

@@nathansmith7153Technically wasn't wrong

[@AchmadBadra]

Actually why SSD dead? Because the vendors forcing user to accept their fragile QLC.

[@lucasrem]

@@scaryjam8 flasable EEPROM was the future back then, we can make them at home. Hughes, Toshiba, unable to produce larger quantities on a chip. We needed HDD's way too long, true fact ! Too cheap, so we were to lazy....

[@ArawnOfAnnwn]

The video still says the industry is in decline, so there's no contradiction.

[@NANDOFFDataRecovery]

As the owner of a data recovery company I would like to dispute the fact that SSD's are more reliable than hard drives. I specialise in flash memory, I can tell you with absolute certainty reliability is being sacrificed for cost.

[@Waccoon]

My concern with SSDs is semi-long-term storage. Say, around 10 years. I've had multiple issues with SSDs degrading in performance over time, as old data starts to fall prey to weakening cells. The data must simply be read and rewritten every few years with a complete "surface refresh" to return performance to normal levels, and possibly stop the SSD from losing data. It doesn't matter if the drive is powered continuously, it seems many SSDs need regular refresh maintenance. I have plenty of charts that show how dramatic this effect is, and how it coincides with areas of the drive with the oldest files. Meanwhile, I have hard drives from the 80's that still function perfectly fine and have no read errors, no matter how old the data is. I use SSDs for most things, but I'm still not sold on using large SSDs for my data archives and backups.

[@NANDOFFDataRecovery]

@@Waccoon I agree.. Don't do it.

[@hopwon]

Tape is the new CD!

[@matthewharris517]

I will only use SSDs for the OS Literally everything else is stored on HHDs especially for long term storage

[@paulstubbs7678]

Definitely, with more and more bits per cell, they're pushing things to self destruct. I occasionally see mention of a new low cost SSD with incredible storage, then I look at what 'QVO' etc stands for, then I tend to step back and say NO, I want more, not less secure storage. I have an old 500MB drive, running 24/7 for 20 odd years, yes it's got the odd error, but I doubt an SSD would handle that. I have a slowly increasing pile of tablets and media centre boxes, all dead, from borked storage, no such issues from way older hardware running real HDD's

[@Crisdapari]

Magnetic tape still is a good option for backups, even today... I think. Just remember: Do not put magnets near those tapes. 😢

[@thomasruwart1722]

Tape is the thing that will outlive HDD and SSD. I know this because Mr Spock often refers to computer "tapes" and that is a few hundred years in the future! So, there you have it!

[@Lilybun]

would a solar storm similar to the carington event wipe those tapes?

[@renrutmat]

@@Lilybun A good Faraday Cage should prevent this.

[@negirno]

Good option if you have the money. Take drives are frikkin expensive for the hobbyist data hoarder.

[@thomasruwart1722]

@@negirno - correct - but these tape drives are not intended for consumers. Tape is now just LTO (Linear Tape Open) technology which has an impressive roadmap. There used to be consumer-grade tape drives but they died out quite some time ago. Consumers typically don't have enough data to justify the purchase of an LTO tape drive and tape cartridges.

Babe wake up, new Asianometry video has dropped.

[@CTSFanSam]

For what I understand, unpowered, HDD's will store data far longer than SDD's.

[@paulblair898]

Most consumer SSDs will let the data on them decay even when powered 24/7.

[@Indrid__Cold]

​@@paulblair898Sounds like a software fix is in order.

[@markleuck]

True although I just read a story how hard drives from the 90's in the music industry are failing, eventually the magnetic platter starts to decay

[@vilian9185]

@@Indrid__Cold you can circumvent it using advance filesystems with data checksum(like btrfs) not sure if you fix the decay with software patches

[@HowManySmall]

Yes this is why I got 14tb of hard drives in my desktop lol

[@atomicskull6405]

So long as SSDs are technically volatile storage (the data will decay in about 5 months if not powered on) then magnetic storage media isn't going anywhere because there will always be a need for cold storage.

[@awesomeferret]

An LD sized Bluray would probably get near 1 TB, definately over 1 TB if double sided. Imagine a world where people thought more about value than convenience. We could be buying 10 dollar 1 TB burnable Bluray discs. Optical discs at a dollar per tenth of a terabyte are already possible, we just choose not to make/use it. Yes, the drives would cost over a grand and not sell for the same reasons all the objectively superior magnetic storage devices of the 90s lost to the floppy.

[@alanwolters9651]

- Almost 70 years since the first HDD in 1957

[@TiBiAstro]

my PCs haven't had mechanical disks in about 10 years (I've been lucky enough to have most of my computers purchased for me by my Jobs) I have however had many many hard drives in my house at all times, because I keep an external disc array for my PC, and a NAS for my work and family. I don't see either of those facts changing for several years.

[@johnmijo]

SO, my idea of bringing back PUNCH CARDS just didn't cut it :p

[@christopherd.winnan8701]

Struggling to find a Jacquard laptop in my part of the world! ;-)

[@mintoo2cool]

ibm shill detected 😝

[@Atom224]

CDs are basically the closest thing to punch cards if you think about it.

[@cdl0]

Yeah, paper tape is the future of storage. 🙂

[@PorqueNoLosDos]

Actually, no.

[@rollinwithunclepete824]

Good video, Jon. Always interesting the subjects you find to explore.

[@Sutrabla]

Reminds me of Sony's MiniDisk, to write to it, a LASER heats up to 100 degrees Celcius to be able to write to it magnetically.

[@anapananapa]

They should just reintroduce the 5.25in HDD. That would give you more capacity. Just like they should make LaserDisc sized Blu-Ray discs. (Because it would be fun. That’s why.)

[@Slavicplayer251]

Yep I reckon a 10” blu ray might even be able to hold 3.5TB+

[@dercooney]

2 5.25 bays = 5x 3.5 or 8x 2.5. given that and the lack of overall interest, i'd be surprised if it took off

[@anapananapa]

@@dercooney Yeah, so that would be at least 5x capacity. 20TB *5 = 100TB. That’s a lot for one device. Besides, it would just be fun, regardless. Feels like almost the entire tech industry is plateauing and has become rather boring (disregarding the amazing advancements on the technical side), and what we have right now pretty much fills the needs of most. So, I think we should start doing fun things, because they’re fun. If I could plonk a single 100TB 5.25in full height HDD in my PC, that would hilarious and fun, if a bit ridiculous. They could totally do fancy things too like split heads, so you could have more versatile data streams, or have some kind of internal data redundancy something or other. Heck, there’s probably enough room to stick in a whole SSD as well. Have a hybrid drive. An all-in-one data storage device. I don’t know. It would be fun. That’s all I’m getting at.

[@joshcarter-com]

Problem is that transfer rates to/from the drives has not tracked with capacity. A 5.25in drive would magnify an already significant problem. Ditto access times.

[@negirno]

@@anapananapa Most of whom would need that storage are already using RAIDed JBOD arrays and/or tape drives. Tech like that would only benefit the hobbyist data hoarder and those are too small a market to worth being catered to.

[@OpenGL4ever]

"Go perpendicular" was a great invention. That saved my data. From 2000 onwards my needs increased significantly. In 2000 I only had 3 GB of storage space available, but a few months later it was 40 GB and later 500 MB, 1 TB, 2 TB and then 4 TB.

[@jdlech]

HDDs are cheap per megabyte. I still use them for backups and high volume storage (think a couple dozen UHD movies on one drive). But I use SSDs for things often accessed, like my boot drive and temporary storage. I look forward to putting together a 4 drive NVMe RAID 0 as a boot drive. Just to see how fast it would be.

[@BattousaiHBr]

careful using hardware raid, if you update your bios it might by default boot with the raid disabled and corrupt it. if you can help it, go with software raid instead.

[@jdlech]

@@BattousaiHBr Been there multiple times. I get a "no boot disk present" error. I go into the bios and reconstitute the RAID. It has always booted up with no corruption. And it also helps that I have it automatically backup every Sunday. And I've tested my restoration from a bootable CD. I've made the mistake of not testing my restoration process - only to find something was wrong and the whole backup was unrestorable. So I think it's important to actually do a backup and restore just to make sure it works. For obvious reasons, this test should be done before you spend much time updating and customizing. It should happen early in any 'clean install' process. I used to use Norton 'ghost' before they went nutzo on the remote over the internet backups. Now I use Macrium.

[@Coyote27981]

I wonder why they aren't building 5.25" disks again. Quantum Bigfoot were huge size back then. Sure, seek times are horrendous ... but sequentials are good, and you could have twice the disk space per platter. For storage of big files, it should be good.

[@markleuck]

I remember those drives although never had one, Quantum is now owned by Western Digital

[@dercooney]

i can use 2 5.25" bays and have 5x the space with 3.5" drives. add a parity drive, so it's 4x 3.5 against 2 5.25. comparable capacity, but i have a design that is proven and high volume

[@oggilein1]

people who have acess to that much space will just run multip 3.5" drives in raid array, either giving them better speed, redundancy or a mix of both

[@guytech7310]

@@oggilein1 "eople who have acess to that much space will just run multip 3.5" drives in raid array," Think enterprise storage which have NAS arrays with thousands of drives. Going back to the 5.25" would cut energy consumption & the number of drives they have to maintain. Even better going with full height 5.25

[@undivided_unified]

if you dont innovate, you become history

[@gitduck]

if you don't scale, you look pale.

[@gitduck]

if you do scale, you look shiny ofc.

[@mintoo2cool]

not true

[@CarsMeetsBikes]

Seagate/WD both have SSD arms. It’s hard to say they weren’t innovating when they were pushing the limits of physics for a specific method of data storage

[@nickwallette6201]

@@CarsMeetsBikes "Were"? They still are. We kind of have a tendency to think whatever is the newest, shiniest tech ... that's all there should be. This is just wrong. People still enjoy vinyl and CDs in the days of streaming audio, books despite e-readers, artisan sandwiches despite fast food. There's still a place for hard drives. So I, for one, am glad that there are companies out there who keep plugging along on unsexy products that still serve a real and valuable purpose.

[@cdl0]

Brilliant video - very relevant - excellent presentation.

[@danielalba7651]

Some of us are data hoarders and love HDDs, especially in the live streaming age where nothing can be taken for granted. Some store just movies or music while most joke about their giant stashes of pornography. Personally I store Japanese media like games, anime and concerts, HDD are cheap and reliable for that.

[@AcvaristulLenes]

Great video! An detailing about DNA storage would be very interesting. I heard about storing data on glass. Maybe it would be the topic of a future video (?)

[@ceruleous]

HDD's are needed more than ever for data centers because of the growing demand of storage for cloud

[@kahvac]

I'm thinking the need for higher HDD densities is so great that perhaps longer seek times and or bigger disks are worth the tradeoff in some applications. 100 -200 TB drives ?

[@tulsatrash]

Love seeing data storage tech advance.

[@raylopez99]

Unless you're a WD or STX shareholder...

[@TransCanadaPhil]

i know I’m always looking for the biggest highest capacity hard drives for my plex media servers all the time. No point in using an SSD; the true rapid random access benefit you get from SSDs has a totally negligible benefit when streaming data from largely linear media. Rather the cost per gigabyte is a far more important factor in those types of applications. Also HDs are far better for cold storage backup when I just want to backup a huge amount of data on a raw drive, throw it in an HD case and put it on a shelf for 10 years. The major benefit of the SSD was in the storage and operation of the Operating system from it; a use case where you actually benefit from the rapid/instant random access to load/store small files from a number of different and random locations that the SSD provides over a hard disk (which must seek). But again, when dealing with non-random sequentially accessed linear media like large audio/video files there’s almost no benefit of using a more expensive ssd vs a hard drive.

[@forcelightningcable9639]

11:16 I’m just glad they found a practical use for NFT’s

[@louwrentius]

Don’t underestimate the bandwidth of a wagon full of tapes hurling down the highway (just don’t mention latency)

[@raylopez99]

Now it's an SUV with a pallet full of NVMes?

[@CativaCookie]

I recall reading about that happening some years ago, one of the major providers of cloud services, I think it was amazon aws, had to move a huge quantity of data from one site to another, they found out it was cheaper and faster to just load all the racks into a semi and drive to the new spot.

[@nickwallette6201]

@@CativaCookie That sounds like a ... fun weekend for the logistics and tech crew.

[@miscme7116]

Interesting to see when the limits for the HDD technology come so close that the industry sees only diminishing returns and will just start stacking more platters and start making for example dual 3.5" thickness drives, like back in the day when the drives were pretty thick. This way 100TB+ would be well achieved with relative cost efficiency and they would fit more than well in the regular PC cases.

[@Beregorn88]

the correct statement would be "SSD COULD be faster and more reliable than HDD, if manifacturer didn't cheap out on every thousandth of a penny". There have been plenty of SSD significantly slower than HDD, and even reliability is arguable, especially in applications where data is continuosly overwritten (security cameras, just to name one)

[@someguy4915]

Can you name one such SSD that is slower than a HDD?

[@Beregorn88]

@@someguy4915 ok, almost no ssd is slower than an hdd out of the factory (except for the most egregious scams, where they glue a flash card inside an ssd case). However, there are multiple factors that can affect ssd speed: if it uses TLC or QLC memory, has small cache or doesn't use SLC memory for it, doesn't have extra memory compensating for degradation, implements poor garbage collection, reaches near capacity and reads and writes not sequentially, all of this factors stack together to slow your disk to a crawl. The most egregious case I remember was the Samsung 840 EVO, that was * looks at the clock * almost ten years ago? God, I'm old...

[@hariranormal5584]

Obviously cost's are a factor. Imagine I make a car with 14 wheels and 4 engines because "well, it's now more redundant" It makes no sense to overengineer something as costs ARE a real matter, you can't just blame everything on "corporate greed" Even HDD's you see on the market are properly produced with cost savings and other basic production economics in mind. Now, with that considered and said, what's more better for what purpose? That depends. IMO neither of them are "one fits all". And both of them have a market for specific use cases.

[@awesomeferret]

@@someguy4915 the PNY ssd in the pc I built for my mom. It's so infuriating waiting for something to copy at 50 megabytes per second on an SSD, thinking "this would be over 100 megabytes per second on my hard drive" as you watch the SSD bandwidth max out for no obvious reason. It sounds like you haven't read into how dramatic the difference integrated RAM can make in an SSD.

[@awesomeferret]

@@hariranormal5584 I hope you are new to the pc building space and aren't trying to gaslight people. The fact that SSDs from 5 years ago were objectively more durable and sometimes faster AND cost nearly the same per gigabyte is a MAJOR thorn in your logic. You're overall mostly correct though, but that's why your comment is so concerning.

[@mattbland2380]

The combination of laser and magnetic read/write reminds me of the old MagentoOptical (MO) disks used by the NeXT and a few other systems. Whilst for the majority of consumers HDDs are off of the menu heir data is usually ly stored in the cloud in huge server farms on HDDs and even on tape if the provider stores backups in AWS glacier or similar. Mass market mobile devices and laptops won’t be candidates for HDDs any longer, apart from for those of us who prefer to ensure we have a local backup on an external device. The nanoscale lithography printed platters sound very interesting and I’m surprised we’ve not already moved from the ‘random’ grains to something more precise already. Optical media, whilst cheap and plentiful is just too prone to damage, errors and decay.

[@onecalledchuck1664]

I had a Sony MO drive and archival grade glass disc/cartridges. Phase change MO for the win (in long term durability). It was pricey, though.

[@LydellAaron]

We'll see a spike in HDD if our cloud infrastructure collapses for some reason. I'd like to see a return to local data downloads and ownership. Between all my various services, Google drive, Dropbox, dashcam content, photos, etc I probably have about 12-24TB so an HDD is still key if you need to backup your cloud data with +10TB.

[@johnrickard8512]

I have been getting into this too as my flagship workstation has dual 10tb hard drives - perfect for data dumps. Linux makes these things easier still as well since static data can be packed away with SquashFS and yet remain fully transparent to the filesystem.

[@DavidHalko]

The cloud is buying HDD

[@LydellAaron]

@@johnrickard8512 didn't know about squash FS. Thanks for sharing, and the tip.

[@johnrickard8512]

@@LydellAaron it's a trick I picked up from tinkering with OpenWRT. Works great for huge dumps of websites and ISOs

[@catcatcatcatcatcatcatcatcatca]

I don’t think the average consumer is too keen on this idea, at least before someone packages into a nice product/service. Many, probably majority of people actually buy new PC/phone when they run out of storage. Users don’t know where the information they rely on is actually located in the filesystem they use, only what it actually does. To maintain local backups and private cloud/NAS, one needs to not only monitor the systems health, but also handle dedublication, basic labeling and basic storage policy. As well as connecting all their devices without centralised end-point/authentication. If google cloud sold a home NAS that used googles authentication and worked similar to google cloud, I think average consumers might want it for their family. At least parents might want to protect the images and other personal data of their children. On the plus side, this would probably raise up some great IT admins, who spend their childhood ensuring their minecraft servers are properly stored, as well as sneaking in whatever pirated movies and games their friends need storage for.

[@kellymoses8566]

AWS S3 storage uses magnetic hard disks. AWS has said that the largest S3 buckets are distributed over MILLIONS of hard drives.

[@JanekWerbinski]

HDD still wins as backup, mass storage and long term data storage. At 10$ per TB it's even cheaper than magnetic tape. SSD have two disadvantages: price and degradation of data in unpowered discs after only few months.

[@surewhynot6259]

Where are you getting (new, warrantied) $10/TB?

[@MiIIiIIion]

​@surewhynot6259 That sounds like it might be a reasonable price if you were buying them by the thousands. Definitely not a consumer price.

[@binba9]

Actually tape is half that. $5/TB. ($60 for a 12TB LTO8 tape)

[@guytech7310]

@@binba9 But that excludes the cost of tape drives, which the heads wear out & need to be replaced, auto loader maintenace. copying tapes as the media degrades & all of the labor in between. I would guess the overall cost of tapes is between $20\TB to $30\TB. We ditched tape a decade ago.

[@someguy4915]

@@guytech7310 Cost of the tape drives is about the same as the disk shelves you'd need for HDDs, heads wearing out happens much less than HDDs wearing out, auto loader maintenance doesn't exist (what would you need to maintain? there's no dust in the DC and the typical autoloader/library will do 1,000,000 hours mtbf) and what labor in between? If you need to archive or backup Petabytes of data, HDDs are far more expensive and error prone than a simple tape library. If your cost for tapes is $30/TB then you're spending at least $25/TB too much, which is insane.

[@davidestabrook5367]

Super interesting video, thanks for sharing it with us. I have a soft spot for HDD's, my favourite system was running 4x 1 TB WD Red HDD's in Raid 10. Fast, reliable and excellent redundancy. My new PC made the jump to NVMe boot, Sata SSD for Data, and HDD for backup, with checksums stored with the files to check for bitrot. For long-term storage HDD's are best, as SSD's can have bitrot if the drive goes without power for a year. I know SSD's are much faster, more reliable and use much less electricity, but I don't like how they have limited writes per bit. Which is why I recommend having a separate Windows drive from the drive storing your data, and why having a backup drive, with checksums is essential, as bitrot is horrible.

[@vannoo67]

So the solution is Hard Drives with Lasers on their frickin' heads?

[@crash.override]

Dr. Evil bought Starbucks; he can buy Seagate too.

[@MaximusNYC]

It's been a lot more than 50 years since 1957.

[@mururoa7024]

Capacity isn't the only problem for long term storage (which optical disks and tapes are for), but also the longevity of the reader device itself. 20 years ago the French state had a problem with Sony. Years earlier they had invested in optical drives storage for their national archives. The disks were guaranteed to last at least 50 years, but Sony stopped producing the readers and had no spare parts. Epic fail.

[@nickwallette6201]

I enjoy retro tech, and the thing that is most frustrating is that a lot of parts fail just as the entire market for replacement parts has dried up. Try finding a replacement laser for a CD or DVD player/drive now. At this point, it should be trivial to make them... but they're nowhere to be found. They were only around when all the original ones were still working perfectly.

[@awesomeferret]

And that's why dvd is special. I'll probably be able to buy a brand new DVD drive for the rest of my life, and I'm only in my 20s. Same goes for CD. That's the sad irony: the consumer standards are often better for archiving since there is a cultural incentive to keep making them, whereas a format designed for archiving will have to third party support that lives on decades past the prime of the big players (EG how you have much more variety in cassette players in 2024 that you did in the early days of the cassette's popularity, even if the quality of those players is often worse).

[@nickwallette6201]

@@awesomeferret I wish I could share your optimism. I don't know how many different manufacturers are still making optical drives, but more to the point, how many are still making the parts that go into them. I would be surprised to find out there are multiple sources for a laser diode / pickup assembly. It's not that we don't still make laser diodes, or optics. But how many companies are still making them tuned for the specifics of reading CD, DVD, and BD discs? I dunno. Two, maybe? How about the drive controllers? Is Sony still making the chipsets that control tracking and focus? Is Philips? Or is it now some smaller IP house that is solely dependent on a few niche applications, and will go under within months of all games consoles and PC and server manufacturers discontinuing the option of including an optical drive? How many cars can you still buy with a CD player in them? Best Buy no longer sells physical discs, from what I hear. How long will they continue stocking players? Will there ever be an 8K Blu-ray disc? As far as cassette tapes, IIRC, we're down to like one manufacturer that makes them. As for playback, there's one common mechanism being manufactured that everyone uses now. They don't even use name-brand motors, they're all knock-offs of previously known names. This is ALL tech that we have just about perfected in every conceivable way, and is trivial to manufacture. But all of the companies that were incentivized by competition to polish every surface to a piano finish have all bowed out. It's left to a handful of budget-tier manufacturers to carry the torch, and when they're done, that's it. All the expertise will be locked away in vaults of dead IP, with no practical experience left in the workforce. If anyone ever wanted to start over, they would only have existing products to reverse-engineer and figure out how to build, from scratch, while hopefully avoiding any patents that still exist. And that will make it too expensive to be viable for the tiny quantity of remaining interested parties to bear. Just like CRTs. The future for this stuff is bleak. Not only are the best days behind us, the worst is yet to come. Welp, have a good one! :-D

[@awesomeferret]

@@nickwallette6201 how can the future be bleak when we are talking about formats that have lasted longer than many people's grandparents? CDs have been around for over 50 year now, and will be for at least another 10. You do have a good point about the overall components, and it's guaranteed to get more expensive over time for that reason.

[@nickwallette6201]

@@awesomeferret The CD was released in 1982. So, 42 years ago. If you want to include the time it spent in R&D, then you could make an argument for 50 years. But, in terms of availability to the public, 50 years is going to be about the realistic total lifespan -- from the point where you could first walk into a store and buy a CD player, to the point where you could still expect to find one on a shelf at a retail store anywhere. After that, you're relying on the secondhand market. I have a collection of both AV players and computer CD drives. I have definitely had to contend with no end of reliability issues already -- lasers past their useful lifespan, worn out belts to open and close the tray or rotate a carousel, dried-up capacitors, broken gears, spindles with rubber grips that have turned to goo or adhesive, etc. I will do my best to keep the units in my posession going as long as possible, but it often takes 2 to make 1, and that's with a degree of technical proficiency that most people lack. You won't see ordinary users ordering replacement electrolytics to re-cap the PSU -- and that's table stakes to keep some of them alive now. The stuff that's being sold new today won't last as long as the stuff Sony and Philips and JVC and Toshiba made 20-40 years ago. Not only has our willingness to pay for tech dwindled to the bottom of the barrel, but it also seems that red lasers in DVD fail more often than infrared lasers in CD drives, and blue lasers fail even more quickly than red. Whether that's inherent to the materials they use, or back to that "nobody's paying as much in the 2020s for a Blu-ray player as someone would in the 1990s for a CD player", I don't know. So, I hope I'm wrong, but I expect that in 10 years, good luck finding working a disc drive at all, anywhere, unless you've stockpiled them and know to fix them as the start to fail.

[@localattucson]

Thanks!

[@caluna76]

HAMR reminds me of magneto-optical tech used in PD, MiniDisc, and DVD-RAM but with data read back magnetically instead of optically.

[@awesomeferret]

I'm pretty sure that DVD RAM is not magneto optical.

[@caluna76]

@@awesomeferret You're right 😅. DVD-RAM and PD were phase change.

[@notesscrotes4360]

I still buy HDDs for a "niche" use case that really shouldn't be: my home server. Mass storage at home is extremely convenient.

[@spyderlogan4992]

This technology and industry has come a very, very long way from the first fixed head disk drive I ever worked on. A Data General Corporation 'Novadisk' with 512KB capacity, with a belt driven spindle motor. Then a 2MB Diablo Cartridge Disk Subsystem. The Read/Write head was the size of a dime...Then the 'Zebra'...

[@AmaroqStarwind]

I am interested in SSHDs: hard disks with a large, flash-based cache for a speed boost. I’m also interested in any other technologies which make mechanical hard drives faster. Another note: Helium likes to escape through things, even thick walls of solid metal.

[@jamesowens7148]

SSDs lose data when not powered on for longer periods of time.

[@namesurname4666]

Like other flash, Emmc, SD cards, but people stop using them before they even die

[@pietjan2650]

Nope

[@misterid1075]

I’m still buying HDDs for my NAS setup. I just recently purchased 48TB worth of storage for an upgraded system. Until SSDs can match the space and cost, there’s still going to always be a market for them. I recently heard Samsung achieved 66tb with a SSD but was told that’s likely not going to be available to consumers anytime soon. I was told never, but I don’t believe in never when it comes to tech.

[@technicallyme]

Ssd's can also do orders of magnatude more iops per second Love the triforce chart 😅

[@seancondon5572]

2:20 - man... I remember the glory days of HDDs. When you could find ones that spun at like 10 or even 15KRPM. I never had one like that, but I had a friend who did. Those things were LOOOOOOOUUUUDD.

[@theencore398]

I love hearing about new stuff from you, the puns are absolutely top notch nerdy and i love em all. Thank you for compiling all this information and simplifying it for dumb tech enthusiasts like me (i am not from a tech background, but i absolutely love computers and all their bits and pieces of every component that goes into it) i really appreciate learning about new and latest stuff in pc space. Thank you once again, you are the best.

[@n00b247]

Imho, bluray will be back soon. Burning holes in hair-thin metal is the only way to store data for centuries. Yes, 25-50GB is floppy size by today's standards, but with just 10 disks you can sure save a lot of memes for future generations. HDDs will also stick around for "long term" 5-10 years NAS storage.

[@johnrickard8512]

Tbf Blu-Ray is good for 120gb, and I seriously doubt that optical storage is out of tricks.

[@DavidHalko]

@@johnrickard8512- I hope so

[@fus132]

My collection would take only half a bluray disk, nice

[@Slavicplayer251]

Until the plastic degrades

[@T-Ball-o]

Are you for real? Optical is not only a pain in the butt and rots, it's SLOOOOOOOW

[@davidholder3207]

My first experiance with computer storeage was 7 hole paper punchtape writing and reading from a TTY 33. If you ever dropped and unspooled a large reel of punchtape the best way to respool it was to use a deep stairwell and throw the tangled reel down it from the highest level. Many years later a 50 mbyte pc hdd got zapped in a lightning strike. The only meyhod I found to retrieve all the data was to place said drive in a freezer for around 10 mins which gave you up to 2 mins of read time before repeating the process.

[@yordan9669]

HDD's not dead!

[@HelloKittyFanMan.]

"...By adding more disks and heads...." * Platters (the grouping of platters is one disk).

[@O.M.G.Puppies]

The only problem with SSD is if you turn off the power for a year, they will degrade. The little capacitors leak.

[@juhotuho10]

this isn't necessarily true, there is a video on youtube about testing this and after a year being unpowered, the guy didn't found any data degredation so far

[@ivanteo1973]

@@juhotuho10 in fact SSD degrade as you use it. the more read and write the more degradation.

[@Zenheizer]

I think that should be easily mitigated by a small integrated battery, if the needs ever arises

[@ivanteo1973]

@@Zenheizer is only is that easy SSD manufacturers would have done it.

[@O.M.G.Puppies]

@@juhotuho10 I should have said after years. I've seen loss of data on old ucb flash drives that were powered off for several years.

[@ShaneMcGrath.]

SSD/M.2 for games, HDD for storage and backups. If I were to build a NAS with SSD's to replace my current NAS that has HDD's it would cost more than a new car, Nothing beats HDD's for price per TB yet for the average consumer.

[@awesomeferret]

What games do you play? Most of the games I play are older than 2016, so it's actually rare for it to be worth putting a game on an SSD when the only benefit is an initial load time that's 5 seconds faster. Yes, there are obvious exceptions like GTA V. But more modern games like the Spyro and Crash remakes are truly a waste of SSD space due to how perfectly they run from an HDD. Then there are strange outliers like Beast Battle Simulator that are nearly unplayable on an HDD even though the graphics 9ook like they are from 2005.

[@kunka592]

@@awesomeferret Games from that era were likely multiplatform with the PS4 which shipped with a slow 2.5" HDD so they probably had to get it running properly without an SSD. Nowadays, I would not count on a game running smoothly without an SSD.

[@KeinNiemand]

I mean tapes a better price per tb but the drives are stupetly expensive so that's only worth it for enterprise (or if you have like 100s of tb of data or something)

[@andreyv116]

HDDs are still useful for NASes given a beefy SSD array cache for data tiering but yeah that's not very general consumer

[@SHO1989]

yep. been researching building a new NAS with my "refurbished Hard Drives" cause the cost of used Data Center drives is so cheap doing raid level using 2 disks as redundancy is totally cost effective. If one drive fails, who cares, it's a fraction of the cost of new drives. Homes all over will be buying up these used Data center drives at a fraction of new.😂

[@ShaneMcGrath.]

@@SHO1989 Yep NAS all the way, Currently have a Synology but might be tempted to build the next one if Synology doesn't pull their finger out(They keep using 1GbE ports). Nothing beats local storage, Screw the cloud.

[@SHO1989]

@@ShaneMcGrath. Exactly the reason I built my own nas. Once I tasted 2.5gbe there's no going back to plain gigabit. Video file copy so much quicker. It's funny, whenever I look at a PC, router or switch now the first spec I look for is the nic speed.

[@ronaldgarrison8478]

Data rot is something that must be considered, but I don't believe it will ever be a deciding criterion for much of anything. Whatever the time to rot is, you just need to refresh the data often enough to avoid it.

[@tehpanda64]

With a combination of stalled technology progress and high inflation... I think we are seeing the beginnings of the first ever increase in price per gigabyte. Lets hope it was just a 9-12 month stagnation due to "ai" server demand, and that prices in this next quarter manage to decrease again or even hit new all time lows. admittedly I am mostly talking about ssd pricing, I do think hard drives may have been more consistent in price per gig in comparison.

[@CalgarGTX]

The lack of price gains per Go on the SSD side is sadly mostly due to price fixing cartels and collusion from flash manufacturers rather than tech limitations atm. We generally pay the same $ per Go we had reached around 2014-2015 despite droves of tech innovation meanwhile, QLC, 60+layer cells, massive economies of scale from datacenter use etc...

[@gemstone7818]

a video about the future of magnetic tape would be interesting

[@TWPO]

Holy shit this video is loaded with info with no fluff and I'm here for it. Excellent job.

[@markleuck]

My only criticism of the video is that SSD's are not more reliable than hard drives, I just replaced my 2015 computer that had no issues with the hard drive running 24/7 since the day of purchase AND the secondary drive was from my previous computer bought somewhere in the early 2000's that while slow still worked fine. find me an SSD that will do that

[@jimdawdy6254]

I've had 2 SSDs crap out on me. I've never had a HDD go bad.

[@IntegerOfDoom]

I have a few old Caviar drives under 2GB that still work fine. (for now)

[@yamamoto65536]

My only SSD all the data gone is Samsung 840Evo, all the late 2000's Intel SSDs X25-M 80GB, X25-M G2 160GB, SSD320 still retain data.

[@atomicskull6405]

@@jimdawdy6254 The only HD I ever had that went bad was a Tohshiba drive and SMART warned me before it completely crappd out and I was able to replace it and transfer everything. Typically HDDs will show signs but SSDs just stop working all of a sudden and your data is gone.

[@chengong388]

At this point I have had many very old 2.5" SSDs, and they've all been super reliable, even when used in somewhat heavy duty (for a consumer) roles, like running it in a NAS with torrent running 24/7.

[@onecalledchuck1664]

My spinning rust drives last on average 8 years. Even buying Toshiba, I have yet to get more than 4 years out of an SSD.

[@JP-zd8hm]

Anecdotal, but I’m yet to have an ssd actually fail and my oldest has over 100,000 power on hours.

[@onecalledchuck1664]

@@JP-zd8hm I have outliers, too. Anecdotal, sure, but it's been my experience with buying a half dozen or more SSDs every year for more than 10 years, and multiple HDDs per year for decades. At least with the HDD's you usually start to get warning signs so you can migrate your data off it: boot up times start taking longer, extra long reads, SMART warnings, RAID failures. No such luck with SSD's, they like to just up and die, taking everything with it.

[@drakelangham4412]

At this point, for retail/consumer purposes, I'd think reviving full height, 5.25" drives would be cool.

[@nathanahubbard1975]

That would be something. And hard to resist if someone is offering a 100TB hard drive for a reasonable price.

[@Slavicplayer251]

And how cool would it be to see the inside a full 4.5” wide platter stack

[@8BitNaptime]

I'm in.

[@nate9000x]

Raid setups with 5.25 drives would be epic.

[@asandax6]

​@@nathanahubbard1975 at 100TB I ain't putting things in a single point of failure.

[@sehvekah7368]

Thanks for the MAMRies, even if they're not in RAID.

[@johnrich7879]

SSDs failures are instant, not more reliable than HDDs at all. When HDDs fails, there are usually signs and the failure is gradual.

[@kunka592]

Yes, I've never had a catastrophic 3.5" HDD failure, and I've owned dozens. I do have a Seagate 1.5TB that had a firmware issue that soft-bricked the drive, but it was recoverable with a special cable and some hacking around. I'm still using that drive but it's making some noises so maybe it's not perfect but good enough for its purpose. The few drives with serious failures all had enough time to backup the data and I hardly lost anything from them. Meanwhile I bought a Samsung SSD for my mom's laptop and it died suddenly and completely within a couple of months. I think SSDs are reliable enough to use, but I'd be worried if most of my data storage was on them.

[@JP-zd8hm]

This isn’t true; Datacentre flash drives have about 0.4% AFR, compared to 2-4% for HDDs.

[@lucasrem]

The grain on my old 68" Disks you could see with the open eye. loved them, when they became absolute i used them as wall decoration.

[@TheDesertMexican]

For storage HDD is much cheaper and more reliable. That's why cloud services use HDDs

[@crash.override]

Anyone else remember the "Get Perpendicular" musical promo animation from Hitachi about PMR?

[@wertywerrtyson5529]

Storage really isn’t increasing like back in the day. I remember going from 3GB to 120GB to 640GB. These days many computers come with less storage than I had on my computer 20 years ago. Faster of course but if someone had told me 20 years ago that my 2023 budget laptop came with the same 120GB my 2003 PC had I would have laughed. I would have expected Petabytes by now.

[@catcatcatcatcatcatcatcatcatca]

The lasers in HAMR hammerheads! This must be why my aunt told me to invest in Near-Field Transducers two years ago!

[@iamfinkyuk]

Fascinating stuff, thank you! But you seem to have barely mentioned SMR.

[@K3NnY_G]

"SSD's are faster, more reliable, and consume less power." Okay valid, but you can't say this while showing a damn OCZ drive.. 🤣