Hearthstone Theory: The Druid Problem

[@DeviilReaper]

A month and a half later, Druid is dead.

[@Pigmedog]

turn of the expantion, pretty much no viable decks i m a g i n e m y s u r p r i s e

[@DragonKing-mj2rk]

meh token kinda works

[@mamneo2]

Token Druid, the *Best* Druid Deck right now, one of the top Hearthstone Decks right now, and one of the *cheapest* competitive Decks available in the history of Hearthstone, at 2900 Dust.

[@marinmarinhola]

@@mamneo2. But the combo ramp druid that had dominated hearthstone since Classic, is very much dead forever, unless something magnificent happens in Uldum and the other expansion. Token druid has always been around, pretty much, it just got really good tools in Shadows, enough to push them into the light.

[@alexkrstulovic6054]

@@mamneo2 Token druid sucks.

[@Callsign_Axel]

Yet again, new expansion revealed on the same day as the new Pennyless video. Unlucky mate

[@Edu697]

He could've predicted lol Blizzcon that was obvious

[@explodingpineapple6459]

prediction wasn't even needed we already knew that it would be announced today

[@justinjakeashton]

Yeah, they gave us a free golden card yesterday just to celebrate.

[@literatemax]

Luck has nothing to do with Blizzcon scheduling.

[@lemurman2635]

Benjamin Walton t

[@absoldestiny2657]

He's no longer penniless POGGERS

[@justinjakeashton]

He has a $60 pair of earphones. Now he's richer than most of us.

[@ariamae-922]

dollerless boi

[@damienleigh9943]

@@justinjakeashton I may not have a pair of 60 dollar headphones, but I DO have two 60 dollar stones. I am selling them, and if you order in the next 4 seconds, I'll throw in another set of stones. s&h prices apply

[@ICityCatI]

Wild growth getting nerfed to 3 mana as of today's announcement. Nourish will also cost 6 mana. When year of the raven rotates out this kind of Druid will indeed disappear.

[@AkaiAzul]

With seemingly nothing to take its place....

[@vitorguedes8297]

Congratulations on the sponsorship :)

[@ludviggranath5769]

That Secret Druid joke made me laugh for long.

[@ryun4306]

Naah its maybe work like that 5 mana after one of your minion attacked give it deathrattle gain a mana Crystal 😂

[@ChumMiser]

T A Z D I N G O

[@Jorison432]

Yeh

[@KaskDaxxe]

@@Jorison432 Heh

[@ryun4306]

Plz dont forget the hhe hhe

[@evanolszewski6441]

Blizzard will make sure you never get an up to date video out

[@grantharrison1715]

With the mess that is youtube....I'm oddly happy to see people get sponsors. How times have changed

[@hector-m-carrillo]

Well, i think sponsorships were always mostly a good thing People just needed to see the other perspective.

[@explodingpineapple6459]

11:36 ill have you know that taunt druid was a great deck in KotFT which consistently got me to rank 17 with my Hadronox > innervate X2 > moat lurker combo. it was glorious trust me

[@Dracinard]

But... Hadronox + 2 (old) Innervate is only 5 mana, and Moat Lurker costs 6...

[@explodingpineapple6459]

@@Nyundaa yeah either of those

[@carbonatedcheese523]

I think Druid actually is more powerful than the stats suggest. The stats are what they are because the class warps the meta. People play decks and tech specifically to counter druid. Also, I think the problem is Druid's classic set, which is much more powerful than other classes. Druid has always been a powerful and viable class through Hearthstone's history and will remain one until Druid's classic set is changed.

[@brainiac9767]

I don't completely agree with the last point though, if you look at Hunter I would say it's Classic cards are about the same power level.

[@RadexyTV]

Totally agree with your first point. I'd also add that (Malygos) Druid is relatively difficult to pilot. While I agree with druid having a strong classic set, I think the larger problem is that the classes non classic cards cover the weaknesses of its classic cards too well. Historically druid had problems with weakish removal and defensive options as well as running out of cards, when going full on ramp (at least after AoL was nerfed). Now they have Spellstone, an abundance of armor gain, Plague and so much card draw that even naturalize becomes viable as removal, since the extra two cards likely won't change much in terms of card advantage (having a slower meta also plays into that).

[@alecshockowitz8385]

Honestly Druids classic set of cards really isn't that great. Other classes such as mage before the Mana Wyrm nerf especially for instance has a WAY stronger classic core set of cards. Rogues set of cards are also so incredibly powerful that it outright warps every single card that is printed for rogue as a result. Druids classic set of cards overall are really not that strong. Many of them have significant downsides. It's just the fact that all of the new druid cards added have doubled down on a new archetype while making alternative archetypes trash. Similarly only Even Shaman and Shudderwock Shaman exists right now, because literally nothing else has any sort of functional support.

[@exantiuse497]

I always hate it when people bring out stats to prove some card or deck or class is perfectly balanced, while ignoring any context. There were a lot of players claiming Patron Warrior (the one with Warsong commander and charging Berserkers) was balanced or even weak because it had

[@KayzerAlpha]

The paladin has more op cards starting comparing tirion vs cenarius The only weapon is equal to 8 mana cost plus one 6/6 taunt with annoyng divine shield, And cenarius well... who play him ?? Kkkk

[@justinjakeashton]

4:20 2 cost Malygos + 4 cost Floop Malygos + Swipe + Twig of the World Tree deathrattle + Swipe + Moonfire + Moonfire. 40 OTK damage from the hand and complete board clear only for the enemy. Keeping your health up or controlling the board isn't going to help you at all especially since Druid can do this as early turn 8.

[@thejesterscapnc]

Back in the day, particularly during the wombo-combo days of force of nature, Nourish was not used at all. It was considered an inferior card. It was the invention of Ultimate infestation that made it more popular to play because it was now flexible that you could lose the 3 card draws for a boost in mana when you were going to draw 5 cards in a few turns.

[@anonamos225]

People have found something to complain about since I started playing the game in beta. There's always some "cancer" or "ebola" in every single card game I've played. I can't think of a single one of them where the player base was content and happy. Not once.

[@justinjakeashton]

Kripperino isn't around so... 1:28 Skip ad 15:05 Skip video

[@oliverpezelj]

skipperino*

[@andreikoto4810]

I play tempo mage often, and even though it's only 3000+ legend player opinion, I think druid's armor gain is overtuned. They almost always gain 65 armor in the course of the game which is 10 more than I have burn in my entire deck (considering all the random missiles land on druid's portrait and not his minions). Ramping up and playing powerful stuff is okay with me, spreading plague can be played around to an extend, but how do you play around branching paths + "well played" emote?

[@clash-talesfromsparta3167]

Play something that requires a bit more thought than throwing spells at face?

[@randomname9723]

@@clash-talesfromsparta3167 right and druid takes skill

[@clash-talesfromsparta3167]

Blahblah BlahBlah Yeah, completely agree - Juicy Psychmelon wrecked wild until the nerfs came. Haven’t played wild much since but the nerfs seem to have largely gotten rid of that star aligner abomination...

[@RadexyTV]

Some armor gain is totally fine, but they really shouldn't be able to out armor warriors.

[@zikou123]

fck tempo mage players they are trash retarded pieces of crap

[@kennethokubo3435]

One idea i have for druid is to make treants an actual minion type like murlocs or pirates and give it to some minions outside of just summoning them like say the ancients or ironwood golem. You’ve already got the whole theme of flooding the board and getting crazy power levels from field buffs, why not allow this archetype to actually work as a more midrange/ aggro type of deck.

[@Zthewise]

I like that, I mean lore wise the ancients are treants right? Could be a double edged sword, but would at least give more options, and I don't think we are going to get more treant cards in Rastakhan's' Rumble.

[@matasremeika4007]

treants are already a minion type some time now

[@kennethokubo3435]

Matas Remeika but like, with an actual treant tag that can be given to current and future cards. Would also allow for more treant synergy cards to be realistically printed.

[@matasremeika4007]

I promise you, if you give a good aggro card to druid, aggro token druid will just go nuts again and will do turn 4 or 5 lethals as it used to do, it's a terrible solution, because it will totally destabilize the meta. Unless you like chaos of course :)

[@juliana.platino3996]

I would like that more, i used to play aggro druid during year of the mamoth

[@doblo2670]

Thoughts on the new expansion?

[@ThePennilessPlayer]

I'll start drafting a script in the next few days. Per usual, I'm feeling optimistic.

[@stivassc]

@@ThePennilessPlayer what do you think about the pre order bundle though? It's even worse than last one

[@grandcrusaderinokripperino94]

Rip morgl

[@TheDragonLord12341]

@@grandcrusaderinokripperino94 the new shaman hero art is horrible tho The murloc stays for me

[@pewdiepiejespersen7219]

I Said to myself that i was Gonna buy the next shaman hero skin that they release even if its a bad deal i only play shaman so worth it

[@Jonjon13Jonjon13]

Congrats on the sponsorship! I'm so glad you're progressing, you deserve it.

[@JimFaindel]

Scrambling to make a video on an expansion after just finishing another video is like a tradition here. Can't wait for your peniless impressions! Also, congrats on the sponsorship deal, I hope many more opportunities like that come to you next

[@ZedZerdz_]

Interesting video, although I was watching one of Firebat's videos a while back, & he mentioned how ramping up to 10 mana & pulling off big stunts was Druid's thing, & that the real problem with Druid is how they are a multiclass, well, class. Warrior, for instance, is the signature defensive class, armouring up to the heavens & outtaunting / outfatiguing their opponents. However, Druid does it better by a mile & a half. I don't think the solution is to give Druid more aggressive options (although that wouldn't be too bad of an idea), but after watching this video, I personally think that Druid's gameplan should be diversified a little. Maybe give them a ramp option similar to Darnassus Aspirant where the ramp isn't permanent because it's tied to a minion that you have to protect. Maybe give them a card that ramps for 3 mana but you lose them all once you reach 10 mana. Hell, maybe even give Druid a 0-attack minion that adds an Innervate to their hand at the end of their turn. Druid's identity revolves around ramping & pulling off crazy combos, but I'm one who thinks that the concept of ramping isn't handled the best in Hearthstone, mainly due to how, at the moment, they can take a beat-down in the early game as they ramp & then recover from it later on with their strong defensive tools, which as a Wild Player, is something I'll have to live with for the rest of Hearthstone's lifespan.

[@kasiosseijuro8494]

I love your content! Glad to hear that you got your first sponsorship!

[@dauchim]

How is druid winrate against druid not equal to 50%? For every druid that loses the matchup, there is one that wins?

[@blahthebiste7924]

Draws must count as losses for both, idk

[@SaladDongs]

@@blahthebiste7924 how do you draw a game when both players are druid?

[@marsovac]

@@blahthebiste7924 has nothing to do with that. You count your wins and losses and write them somewhere. It doesn't say that your opponents has to do the same. Therefore you can have any winrate you want. Example: - All people that are tracking wins/losses play 1 game with druid against another druid - All of them looses - Winrate of druid vs druid is ZERO

[@blahthebiste7924]

Isn't the sample size supposed to be, like, massive though?

[@marsovac]

@@blahthebiste7924 since it is massive you got to 49.2%. The 0.8% is the statistical variance from not having all druids (opponents) track the percentage.

[@strongside4565]

I face more deathrattle hunter than I do all variants of druid combined right now. I think people feel bad about playing druid and just aren't right now, which is sort of bizarre.

[@ronanelliott9709]

I mostly hate how it feels like the druid can just ignore me the whole game. I play minions, buff minions, make trades. They gain armor, gain more armor, occasionally swipe something, and then drop spreading plague. Then they press their "I win" button and it's game over. It's like playing against face hunter, but in reverse. Then again I mostly play Odd Paly, so I probably shouldn't be talking about skill-based play . . .

[@theaquaforcegal1067]

Well it looks like next expansion might help druids case. It appears to be going back to the, bite to win, aggressive variant that existed VERY early on. Based off of its description and savagery on a stick. Only time will tell if it is strong enough though.

[@crimsonfury949]

Ancient of lore had to be nerfed for Nourish to see play and end up also being op IMAGINE THAT!

[@The5lacker]

Honestly the big problem with Druid isn't even how all druid archetypes kinda play the same: All druid GAMES play the same. They have access to such obscene card draw and ramp they routinely see their entire deck. It's not fast, but it's consistent, which means the games themselves have less variety and, ultimately, take less skill, given you already know how to go about doing what you built the deck to do.

[@adind.5179]

Congrats on the new sponsorship! Keep up the good work! :D

[@Hongsta]

Congrats on sponsorship hope u get youtube sorted keep it awesome man

[@stonekidman2306]

at 13:05 why is Before Then capitalized?

[@Adr16n1122]

Easy answer to the branching paths problems suggested for aggro. Make branching paths a 5 mana card anyways. Its too powerful for 4 mana, because the 12 armor is already more flexible than greater healing potion. The +2 is still less of a finisher than the +3 from bloodlust. However, it stays with your minions as a benefit. And draw 2 is still okay at 5 mana, because its offers more flexibility options than nourish does anyways. it would likely stop seeing use as a scry in general, but its other 2 effects are still powerful anyways. And it no longer turn 10 combos with spreading plague either. Or if it stays 4 mana, make the just make the attack gain and end of turn like blood lust. So if the opponent puts up a second wall of sorts, it isnt still marched over with ease.

[@samioriginals]

Can't wait for the polarity meta explanation video! also good job on this one :)

[@duelponzac]

good point there: blizz has created many archetypes that never got touched again (take freeze shaman, for example; its bad when you get just a few packs, few legs, and you think you can play something different but then those said cards never truly show up since they are not powerfull enough by themselves to stand ground and dont have any means of support to help them to see the light of the match). i just hope druid gets a decent leg (class leg, not neutral like tug) that provides him support for other archetypes. this way we could see less combo, wich, at least in my oppinion, sucks, since you have just litte interaction with to fight against it, and when you have it, all what you have to do is to destroy one of the combo pieces with dirty rat, gnomuferatu or demonic project - lets not forget what druid has to offer for wild mode.

[@NivMizzet89]

One other important thing I think is crucial is bringing the general power level of cards down. One big problem (in my opinion) is that cards are just too strong right now, which also leads to polarization. The issue isn't just dealing with Druid, the issue is finding room to deal with druid whilst also trying to fend off the dozen other cutthroat decks in the meta, any of which can easily destroy you if you're not fully dedicated to beating or surviving them. While it's certainly possible to build a deck that can chew through the armies of scarabs and dozens of armor points to kill druids, it's an utter pain to run those decks against anything that isn't druid.

[@kannachan2744]

It's been months and I still *sigh* every time I'm matched up vs a Druid or Baku Warrior, since I play mainly tempo decks and I have to play near perfect to beat them every single time.

[@egorgomon4865]

If your can sustain a nearly perfect level of play (that implies 65%+ winrate which is enough to always stay in top100) then you shouldn't care about your matchups. Yeah, you might be upset when you get a bad one but you should be equally happy getting a favorable.

[@YAL23booboo8]

I just love it when i psychic scream an entire board of wisps , literally wins the game right then

[@Jadx42]

Whats the song name at 10:30 ?

[@ScarletSpartan_]

Literally I cannot fathom how none of those cards have been touched. So many pro players (as well as much of our community) scream and rant about nerfing spreading plague!

[@marsovac]

It was already nerfed once and they printed a minion that is a counter to it in the last expansion (mossy horror) :D

[@gregsmw]

so because spreading plague is litraly op as fuck now every deck has to make themselves weaker against all other decks purly so they can deal with sprading? the solution to an op mechanic is not to print a single card counter, that doesnt work, is god awfull design wise, and feels REALLY bad for both player @@marsovac

[@aldrennuguid8171]

Congratulations on the sponsorship :D

[@matiasm.aguilar9015]

Congrats on the sponsorship!!

[@5oulPower]

I'd agree with your suggestion, if only because I enjoy aggressive playstyles. I thoroughly enjoyed a Druid deck of old you forgot to mention - Aggro Token Druid. In Ungoro and KoFT, Druid had that variety you mentioned.

[@entothechesnautknight1762]

While I disagree on Druid decks not because by especially powerful (Raw numbers are meaningless without context), this is a very nice video explanation of the Druid problem; it's the ultimate form of meta polarization. Every Druid deck is the same, and in this meta? That means you win or you lose at the start of the game, Moreno then any other class.

[@TopPotato109]

Tldw: too many strong cards which result in 98.54% of the druids lists using the same 25 cards with the 5 remaining being some kind of combo

[@antonholmberg911]

Druid Will die when Frozen throne goes away anyway

[@seankeenan9277]

Druids will be everywhere in wild when that happens lol

[@Alexus-0]

I made a druid deck that uses all the ramp but then just drops 8+ minions, it has no minion bellow 8 mana and is actually great fun to play. It was the rams deck i wanted to play when the game first came out, it awful but great

[@oui7171]

Well, the only druid card we've seen so far in the next expancion seems to be announce some kind or aggresive druid, so maybe they're doing something good there

[@jonathanlui930]

Just got some new Massdrop stuff, nice sponsorship!

[@Sylfa]

One thing though, each class has their core mechanics. Demons + HP use + draw, Armor + buffing hurt minions + taunts, etc. Druids is Choose effect and RAMP. Giving a more varied game play would be good, but considering its a core mechanic of the class.. Well, if I hadn't stopped playing many many months ago I'd be quite upset if they gutted the core of a class just to improve a temporary meta. Especially when it's not even warranted.

[@yurikz9]

sponsorship from massdrop? holy shit, congrats!!!

[@penguindawg8817]

What class is the most balanced in your opinion?

[@catcatcatcatcatcatcatcatcatca]

Toth Mark Since balance is something defined by the relative strength of classes, I think the question you are thinking should be more like "What classes power-level would be the best to balance other classes on par with?"

[@kylenetherwood8734]

Warlock has the most variation

[@cameronc530]

I just end up playing Big Spell mage, my overall winrate against all classes is fairly positive and I haven't lost to a druid yet (mainly just see taunt druids).

[@defectivesickle5643]

I honestly don't see many Druids at all.

[@neilgrundy]

I've been trying to argue this in forums for months. What druid needs is tools that give it an option not to play ramp.

[@sarkdakras4336]

YES I STARTED PLAYING THIS GAME BACK IN DECEMBER OF LAST YEAR I ENTERED RANK 12 THIS LAST SEASON AND OH LORD I NEVER HATED DRUID MUCH MORE THAN I DID THIS LAST MONTH.

[@nangkates]

druid starting to get hated is from the damn jade.

[@yoruichixx6951]

Ye

[@ded1020]

a problem I'm having with hs is that blizz keeps introducing new cards and mechanics, only for them to not see any play. A lot of classes feel like they've barely grown since witchwood. whole lot of boomsday left unexplored. To say nothing of all the cards that will rotate and have rotated with little to no play. I know i want more things to do in paladin than hero power. or ramp for druid.

[@kamossentholin]

I think the true Problem is the Choose mechanic and the complexity of the Druid cards. When they draw branching pathes they actually draw 6 cards at once. Sure four of them get discarded if you use two, but this makes druid very flexible vs all encounters. Some cards are just too damn good. I just cant understand why wild growth gives a card at 10 mana. I dont understand why you can choose the same path in branching path twice. I dont accept that UI can go face. It feels like the assigned designers for druid cards are just more generous than for the other classes. I dont know if they work like that but it just certainly feels that way. Another problem are the lengthy annoying animations which all sound and look the same. some green rings appear and a fartsound plays. yeah very interesting to watch a druid play the ramp game.

[@royaldoggo8946]

I genuinely think if you make branching path cost 5 to slightly hinder the ridiculous armor gain, and make spreading plague either 7 or 8 cost, I think you fix the issue. Druid continues to hold on to its strategies. It feels bad when you hit the 10 turn and you have a board advantage, with like a 10 health lead and in one turn, Druid can pull out up to 7 taunts and then gain 12 armor all in one turn. And at that point your already know UI or even more armor ramp is coming the next turn.

[@kevinloon6585]

How about introducing more ways to deal with plague?

[@DavegamerLp]

I personally see a very distinct problem with the solution you offer in the video: Creating a new archetype for Druid (which I support) will not kill the existing Druid decks, which will continue to be unfun and uninteractive to play against. The reason for this I feel is not that they all feel similar but that the entire match will often be decided purely on how well the druid draws, in regards to UI, BP, SP etc.. This holds especially true for Aggressive and Tempo decks. If they have SP by turn 5-8 you lose, if they don't you win. It just feels so unrewarding to play a game and be like "Well they have SP , guess I can't win". This wouldn't be so much of a problem if they did not win every control matchup by default (Well, except Odd warrior sometimes). That means that there just is no space to "outplay" druids , it's purely based on luck and/or matchup. Especially because nowadays as an aggressive/tempo deck you can absolutely not afford to play around SP , since it's not uncommon for druids to gain 10-25 Armor in one turn if you relieve the pressure just one bit. So in conclusion: No druid is not OP but the unfun nature of the deck (being a combo deck that has 2 fantastic anti:aggro cards that almost win you the game immediately) makes it not balancable in a satisfying way. So yes druid should get one maybe even two viable new archetypes, but at the same time the combo archetypes should be heavily weakened in one way or another to avoid frustration amongst the community

[@WinnaTheKing]

DavegamerLp but if you don’t give Druid new cards the old ones cycle.

[@DavegamerLp]

@@WinnaTheKing as I've said, druid should get new viable cards and archetypes, I just think that the old deck should be nerfed in some way for the reasons listed above

[@venkatasaikirangurram4280]

People always prefer to play aggro always over other types of decks . Everyone keeps complaining about ramp but that is not the main problem. As pointed in the video druid has no other style to go to if ramp gets nerfed. So just give them something better instead of nerfing ramp and also nerf their armor gain by a bit .

[@egorgomon4865]

DavegamerLp your statements about "uninteractivity" seem strange. The same logic you mentioned applies to every other game scenario in Hearthstone - if they have the answer, you are in a bad spot. If both players play correctly, the outcome is decided by random. So what is the problem with druid then? You say that playing vs druids is pure random. Are you sure that every game you play vs druids you execute perfectly? There are so many decks on ladder that just farm druid atm. I hit legend 1st day of November with Maly druid and since then I struggle to climb. 30% of the ladder are hunters and warlocks (no, they are not annoyed by druids, they are happy to face them) and I'm stuck at 100-200 legend. It may be that I'm just bad or I don't play enough games, but it really feels like it's better to play odd rogue or even warlock now.

[@Petrico94]

Could we make beast druid as good as pirate warrior? Druid's control game is generally ramp or we used to have Spiteful summoner just holding off for the big tempo play. We got here with powerful card draw and armor cards as well as Spreading Plague being a very useful control option, if we give early game aggression that doesn't need ramp then some of the savage roar win conditions will move there. Or maybe a control deck that doesn't ramp, I'm still not sure but there's probably a clever way to make a deck without Spiteful Summoner (6) as a conditional massive tempo play. Or maybe that's just their idea of Druid's control game, relatively weak spells but early on you can ramp up your mana to play them more or sooner than their labled cost.

[@terrasearch]

7:22 says choose one, textcard says choose twice

[@DeathComesQuick666]

Did you forget about aggro druid?... people were running aggro druid like crazy for a couple months last year. Living mana gave rise to it, but there was 0 ramp there. Honestly no one plays treant druid in ranked, but if you play it yourself you will find its actually quite powerful, assuming you get an alright hand.

[@boblopers1620]

Armor gain seem to be an issue for me as well, because when a druid can gain more armor than an odd warrior there has to be a problem

[@exhalehate]

How about giving other classes powerful consistent cards instead of nerfing giglling wich was used i.e. , by rogue?

[@xARJS]

To me, what makes Druid un-fun to play against isn't so much in their ability to ramp.. if it was just ramping and drawing cards I would be able to develop a board and then hopefully swing into their Lich King , Dreampetal, Tyrantus or whatever. The problems I think you glanced over are having 1 and 2 mana removal spells in naturalize and spellstone, having aoe removal in swipe and some decks running starfall, cheap reliable armor gain in ferocious howl, branching paths, and oaken summons (and if they're running this you have to deal with a well stated taunt or violet teacher), THEN once you're through that phase you get hit with the death knight and spreading plague which wouldn't be a problem to take down the 1/5's if the board I tried to develop didn't get destroyed by woven in 1 and 2 mana spells. AND whenever they cast nourish, spreading, or UI it comes with a 0 mana 4/4 in arcane tyrant. It's so much to deal with and while you're trying to bust through they're drawing even more and gaining armor better than warrior ffs. sure, druid is beatble, but you end up playing a long drawn out game of solitaire and it isn't fun. it's never. you never feel good about the win its just "wow I survived."

[@egorgomon4865]

What decks do you play? There are so many decks on ladder that just farm druid atm. I hit legend 1st day of November with Maly druid and since then I struggle to climb. 30% of the ladder is hunters and warlocks and I'm hard stuck at 100-200 legend. It may be that I'm just bad, but it really feels like it's better to play odd rogue or even warlock now.

[@Crystan]

@@egorgomon4865 There aren't nearly as many of them as you think. Sure there are plenty of decks designed specifically to counter druid, but many of them absolutely suck against just about anything else, and the rest all use a single strategy - rapid aggro kills. Basically, if you don't play aggro in HS these days, you've already lost.

[@xARJS]

@@egorgomon4865 I've been climbing with elemental mage, midrange hunter, odd rogue, and resurrect priest and have had success against druid, but regardless of what deck I'm playing facing a druid just isn't fun. it's just stall, stall, stall; do something borderline unfair. and like Crystan said below, you can tech to beat druid but then you struggle against other things, which I guess is what techs are for.

[@Polfor]

Ayy man that's so fulfilling to see underrated channels get bigger, i'm happy you start to get sponsorships, and good luck for the future!

[@MeandMonkeyLP]

What annoys me is that on top of having Spreading plague, druid kind of "naturally" sits on Warrior-Level amounts of Armor while drawing like crazy

[@davidhenriksson285]

Malfurion heropower changed to +2 Branching path to +4 armor and Ui to 4 cards, 4 armor 4/4 minion and Druid will not be op anymore but still playable

[@ExoticSenta]

just hall of fame wild growth or nourish cut down a bit on druids ramp potential. the new card (1 mana give yourself and the enemy 2 mana crystals ) is the way to go. i just hate it when i reach turn 3-4 and the druid is already at 10 mana then UI's me fills up his hand

[@TheFalseHuman]

Whoa, the sponsor spot is like ~8% of the video

[@HeathenDan]

You're in the big leagues now.

[@RadexyTV]

All decks of one class being kind of similar is a good thing imo. At least while the ladder is still bo1. It just makes the mulligan less of a guessing game. While facing pre nerf rogue you had to decide between Odd or Quest, which often required very different mulligan strategies. What I like about druid is that it actually has a strong class identity (ramping), which I would like to have for every class. They often have very loose ideas of what they want to be doing, but nothing that really sets them apart. All classes feel very similar. That said I still think of the current iteration of druid as problematic. Currently the core offers too much of everything. Ramp, Armor gain, defensive options, card draw. At least one of these aspects should be weakened. For me it's the armor. Druid always had some armor, but they shouldn't be able to keep up with what should be the armor class: warrior.

[@lobsterfork]

You just made me realize that the next standard meta may only have 2 hero cards. That is kind of crazy.

[@exantiuse497]

Force+roar was never an otk deck (how could it be, the combo did 14 damage, or 22 with 2 roars, not 30). It was just a finisher you put in every druid deck except aggro. That made it even worse than an otk combo the entire deck revolves around, because it was so cheap and easy to pull off there was no reason to not use it Also Nourish wasn't always a core card, in fact most decks used to run 1 or none. There were less incentives to rush to ten mana, and Druid had another card draw cards, Azure Drake and Ancient of Lore, so adding 2 nourish would've been an overkill. Again, Druid decks didn't use to be combo based, they had the force+roar combo but that wasn't the win condition, so the heavy ramp and draw seen in modern decks wasn't necessary And btw Blizzard didn't release Ultimate, Spreading and Malfurion as a response to the Ungoro cards performing poorly as those cards were released in the first expansion after Ungoro. Blizzard designs the cards well in advance and they'll definitely not wait until a few months before the expansion launches to see what the meta looks like to decide what they release. When Ungoro launched, Frozen Throne was probably already fully designed and more or less balanced, and they just focused on the technical aspects, coding the cards in and testing for bugs and performance

[@holokom3330]

I need a new headset, lets try....Wait 50 Heartstonepacks ? ! ok no earphones

[@vermiculo5060]

You said that Druid has no real control options. While this is true, the real problem for me is the amount of armor gain they have, which, in itself, is an incredibly strong DEFENSIVE option. Druids can almost double their health bar by turn 4, which means they literally negate a couple turns of damage from aggro decks and make some combo otk decks (like velen) no longer in kill range. I don’t know if my solution is the best, but I believe blizzard should add a new effect called “fading scales” that replaces Druid armor in which the armor is reduced by a bit every couple turns. This would still make armor a good option vs aggro but it would make otk matchups like Velen more skill oriented as they would have to plan out when to armor up.

[@terrariku2010]

I present to you the worst case scenario "fix": *Blizzard misinterprets what you mean, moves wild growth and nourish to the hall of fame. Ignores negative feedback like warsong commander*

[@Edu697]

Penniless I have been saving up for the new expansion and I went up to 1860 gold so far I know the "minimum" in your opinions 50 packs so I ask you if there is a way to better earn gold other than doing daily quests because I find those kind of boring and braindead

[@CrazyGoGoVrose]

daily quests (refreshing the 50 gold ones in hope of 60+) and the 10 gold per 3 wins is the only way unless you're willing to do some arena but that could lose you gold depending on how good you are or your luck.

[@Edu697]

Every time I refresh my quests they stay with the same gold reward leading me to believe that the reward doesn't change after you refresh it maybe it's my luck thank you anyway@@CrazyGoGoVrose

[@CrazyGoGoVrose]

@@Edu697 it does change but 50 is the most common I think, you just need to be lucky

[@marvisyam9256]

I've been saving up to but looks like the power level of the cards was way lower than expected. I don't see more than 2 cards being competitive viable

[@Edu697]

Only a small portion was revealed and even pro players get predictions wrong so dont dismiss cards before you see them in play@@marvisyam9256

[@michaelbowman6684]

I actually like Druid's playstyle, he just needs less powerful end game. Printing Aggro won't fix anything, the Ramp still exists and "limiting design space"

[@snikrepmas14]

i disagree with the point that evenlock counters druid as i think druid has too much defense armour gain and board control, i think deathrattle hunter is the only real counter, btw good job on the sponsorship you deserve it

[@jacobwilske5665]

“I’m playing secret druid”

[@foolishsamurai9]

Hope druids can rumble like trolls, Pennyless!

[@dog3714]

If I use massdrop will you send me some of the objects you quilted

[@WoodsRunner]

I miss when token Druid meant summoning weak minions and buffing then for a OTK, not pulling out 4 cost minions and gaining armor

[@Mark-uc7xh]

And the nerf are here. What will druid have after this?

[@lennyraddohl3034]

Spiteful druid still has ramp with that 3 mana 3/1 with deathrattle gain an empty mana crystal

[@LounoirRecords]

what the solution is? discontinue base set altogether nothing will truly change as long as these cards are in standard and that goes with every class, not just druid

[@michaelfinelli7002]

My problem with Druid isn’t staleness. It’s not similar gameplay between archetypes that makes it annoying. It’s the fact that it’s better at armor gain than the armor gain class (warrior). It’s the fact that it’s identity of ramp has two, non adjusted since release, classic cards that have survived every meta. It’s the fact that it has the most card draw capacity out of all classes. Druid wasn’t necessarily given too much POWER, it was given too many OPTIONS. Take the armor gaining away and the main form of defense turns into taunting (not as strong). Take away the card draw and it’s stuck with ramping and playing big (not as strong). In the current state I’ve never seen Druid lose/concede in those “bad draw rng” situations because, unless the best aggro pulls off top tier draw and opening, there is always an option by turn 4. Druids adjustment needs to be more than just archetype change. It needs a single identity back like the other classes have.

[@connorm7915]

Here's an idea: Nerf Nourish to 6 mana Nerf Spreading Plague to 7 mana Nerf Naturalize to 2 mana Nerf Emerald Spellstone to 2 mana Nerf Branching Paths to 5 mana Nerf Swipe to 5 mana Nerf Wild Growth to 3 mana Nerf Malfurion the Pestilent to 8 mana And last but not least, nerf Ultimate Infestation to 11 mana. JOB DONE

[@gregsmw]

joke wise yes but serious wise spreading 7 naturalize 2 branching 5 (or drop the armour from 6 to 4) wildgrowth 3 and ultimate 4 of everythign not 5 and ferocious howl (you missed that) 4 (maybe even 5)

[@B455PL4Y3R]

lol mystic.

[@gregsmw]

2:40 i can tell you right off the bat why druid is an issue its not that they have all of that its that they have all of that while sitting behind 40 armour and LITRALY otk combos that ignore your health/defenses meaning any control deck litraly cant beat druid, combo decks have to rush for their combo faster then the druid (and cos they obscene card draw they cant) and have just as good combos (which they dont) and aggro decks have to be the most hyper aggro they can in order to deal with the armour gain, but that turns the game into a litral coin toss on the draw where decisions dont really matter thats why druid is the problem oh and the reason nourish is used for mana now not cards while it used to be cards not mana is because druid classic set doesnt really have good card draw, it has nourish and starfall and thats about it while new druid has oaken summons (effectivly draw as it thins the deck), ultimate infestation, ferocious howl, branching paths, psychmelon etc they have insane amounts of card draw now meaning they dont NEED the card draw from nourish and just use it to ramp into their other better card draw

[@lennyraddohl3034]

This is why kibler saves hearthstone with odd druid

[@rochieamolato5657]

There was an aggro midrange Druid deck before giggling nerf though

[@galonath218]

Now we have token druids that are equally as annoying. Sweet.

[@CaptainEggcellent]

Interesting content. Subbed.

[@Xanthopathy]

Nice

[@Jussumgai]

Zoo Druid used to be visible in Wild until Odd and Even decks emerged. Zoo Druid has to use cards to go wide while Odd Paladin and Even Shaman go wide for free. Baku and Genn killed the zoo archetype since they just do it better.

[@STJebus]

Druid has been a top meta deck for all but a short window in Hearthstone. Between old gods (when force roar was nerfed) and mean streets (when they printed jade idol). Druid has been dominant since and before that period of time and honestly I'm just tired of Druidstone. Druid can gain more armor/health than priest and warrior. Druid has more board presence and burst than shaman. Druid has cheaper removal than mage. More card draw than rogue. They are the only class that can ramp. They are the only class with the choose mechanic. (they are the only class that has identities all to themselves. No other class has even small ramp or basic choose cards) Choose cards don't cost anything. (want greater healing potion? sure. instead want permanent roar? sure. how about draw two? sure.) where is the cost to these options? They have the best board clear in the game in spreading plague as it give you a board that is 9 times out of 10 better than your opponents board. For the love of god #MakeDruidBadAgain

[@Interplanetary555]

When you have the best board clear by not really having any board clear lol.

[@sammie16508]

Not a board clear, but it might as well be one, as it counters the only real strategy that you can use to beat a class that plans on winning the late game a hundred percent of the time, as explained in the video. In that way, it serves that same purpose as a board clear... stalling. Same as the armor gain, taunts, etc.

[@Interplanetary555]

Imo, the rules of this game is pretty simple. It's the same rules as in MTG for example. You build your deck by having some minions and some removal in it. Problem with druid (and paly for example) is that the class doesn't really have any removal. So you need to compensate that. The way you compensate that is by having infinity armor, infinity card draw, ramp and all that stuff. And it doesn't really work well. I play only paladin and druid (coz poor) and gameplay with this classes was cancer for like 5 metas straight. Paladin is eternal agro, druid is forever combo. I hate that shit.

[@defectivesickle5643]

While I agree that Druid has stayed consistently strong, he's not really as strong as people complain him to be. In order to ramp, Druid will have to spend 3 turns doing nothing, meaning that he would HAVE to have Spreading Plague ready when he has enough mana. The only Choose card that sees play is Branching Paths. The swarming capabilities Druid has is slow and prone to board clears. Tell me HOW Spreading Plague is a BOARD CLEAR? I have no idea what you're on about on Druids burst.

[@STJebus]

​@@defectivesickle5643 Spell Burst= Maly+ 0 mana deal dmg spell. Board Burst=PotW, Savage Roar, Branching Paths... Plague often give you a board bigger than your opponents board which leads often to one of 3 scenarios. 1) They're forced to suicide their minions into yours, clearing the board 2) You're minions are now bigger than theirs/ protected by the plague so you can safely ignore their minions and go face. 3) It makes their board irrelevant. Usually long enough for you to close out the game.

[@trikovi1628]

Yo blizzard is making hand buff warlock a thing