The Artist is Absent: Davey Wreden and The Beginner's Guide

patreon: / innuendostudios
tumblr: / innuendostudios
twitter: / innuendostudios
transcript: innuendostudios...
Amanda Gay Watkins' art: / wotkins
resources:
SEMIOTICS
A good place to start is Folding Ideas' (really old) video on signs and memes: • Folding Ideas - Memes
Here's a whole site on it when you wanna go more in depth: www.visual-memo...
DEATH OF THE AUTHOR
I'd say the best place to start would be the essay "Greatly Exaggerated" by David Foster Wallace, but it's, sadly, not online. It's in this book: www.amazon.com...
Here's a rundown of the essay: machines.planne...
Here's Roland Barthes original essay that coined the phrase: www.tbook.const...
And here's Michel Foucault's expansion of the theory: www.movementres...
ENUNCIATION THEORY
The best way to acquaint yourself with enunciation theory is to read through the glossary of Casetti's Inside the Gaze: www.amazon.com...
...but here's an article on it: francescocaset...
Laura Mandanas' take on TBG: www.autostraddl...
Liz Ryerson's take: ellaguro.blogsp...
Robert Yang's take: www.blog.radiat...

[@DJ_CULLEN]

"How unintentionally cruel it can be to make someone else responsible for your sense of self worth." This hit me like a freight train.

[@BishopCDN]

If you're still sparing with that old dog, don't beat yourself up for looking for a life-preserver while you're drowning. And if I can - try not to view your worth as something quantifiable. You may WANT intrinsic worth, or to be seen as valuable by somebody else. But I'm sure by now you've "enjoyed' the folly of that exercise. Instead, imagine we're having coffee. I tell you about Glen; "He's a brilliant dancer" I say. "It's amazing and just seeing him perform gives me life." I'm sure you have friends in your life that are just as talented as Glen here. Now, we meet again for coffee, and this time I have bad news. I tell you "Glen was in an accident, he lost his left toe, the big one. He'll never dance again." It's a tragedy to the dancing community and Glen is obviously very upset about the dancing and the foot thing. But if I THEN told you that Glen and I can't be friends anymore, you'd think I'm mad. right? "I'm no longer friends with Glen because he can't do the thing that made him really good." So; try to remember that... your value; how good or bad you are, talent and charm and all of those niggly things that keep you up. If you lack them or have them in spades. How loved you are, has almost nothing to do with all of that, and entirely to do with shared trust and respect for each other.

[@Inressa]

Tessa Rossa Jeez, dude...

[@oobernoober7617]

@Tessa Rossa yee

[@sharkofjoy]

Ah yes, the entire problem of the patriarchy.

[@oobernoober7617]

@@BishopCDN Write a book about this seriously, it sounds like it would take off and you could become a famous writer.

[@NakeyJakey]

how you explain and present ideas in this video is incredible. seriously amazing job.

[@GothGamer1919]

Holy shit never would have thought to see you here. Good tastes Jakey, coming from one of your good Ol' Hot Boys

[@abrown903]

Whoa Jakey made that comment before he blew up. Cool

[@siimseiin]

Hi, Jakey!

[@regriefing1807]

Hello!

[@AnAwesomeHobbit]

This is my favorite crossover ever

[@KydroxHD]

I walked over the game design courses of my school and one of the classrooms were watching this video

[@slyceth]

🤢

[@undeniablySomeGuy]

how did you hear them while walking over them? so loud you could hear them from the second floor?

[@IrvingIV]

​@@slycethyou okay buddy?

[@handlesarestupid739]

​@@slycethremember

[@mygills3050]

@@undeniablySomeGuy I presume they mean "walking by"

[@billyweed835]

Can I just say: I love the irony of making a game all about the impossibility of truly knowing an artist through their work, and making it something that basically tempts authorial analysis at every turn.

[@thehawkeyedone2188]

When I first played The Beginner's Guide, and the only time, I very slowly came to realize what the meta text was, and I had a very visceral feeling of "I'm an asshole for playing this." Upon further reflection I'm aware of how enormously stupid it would be for Davey Prime to basically put copywritten work up on Steam, not to mention just unfathomably not self-aware the ending monologue would be, if what Davey the Narrator is saying, I still felt like I was invading *someone's* privacy. Whether Koda is real, or Koda is Davey, or Koda doesn't exist, playing it felt like I was violating another person's very creative spark, which is kind of why I both hate and love this game. Just something to ponder.

[@rafasilva1265]

I mean the guy made Stanley parable

[@oobernoober7617]

This is why games like the beginner's guide and the stanley parable are my favorite games of all time. They don't just have great stories behind them and cool characters, they also have great lessons to learn, help people question what is and isn't moraly right and help people to empathize with specific circumstances that most people might never encounter in their life. My brain always works at a million miles an hour so I like deeper meanings behind things, lessons being taught and emotions being shared to help people understand the bigger picture. 😁😁😁😁😁😁

[@damsen978]

@@oobernoober7617 In all case those are video games for education, not as much for entertainment like most games does. Even tho Stanley Parable is very entertaining because we all like mocking the narrator until we get one of those sad endings.

[@henrynelson9301]

I was convinced it was real until one of the projects had a hidden Spec Ops The Line reference, even though it was supposed to be made years before that game came out

[@EvelynFTTE]

I remember feeling the same way, just increadibly unconfortable about experiencing this game

[@LilyGrace1990]

Love this game. I had a slightly different interpretation. I lost my twin sister before I was born, and I felt like Coda was her, and that my attempts to get close to her, a person I couldn't ever know but someone so similar to me, so intimately bonded with me, were unhealthy on my end. That my desperate attempts for validation from others are really an attempt to get her validation. I know that sounds crazy, I mean I've never spoken to her, but I've agonized over her my entire life. Every room she's not in feels wrong and empty, and family pictures make me deeply sad. But in a way, it reflected that depression I felt, that desire to add meaning to something that didn't have it and a personality to a person I could never know. It was profoundly emotional, but I'm really glad I played it. I think there isn't a correct interpretation. I think that our interpretations of this game are deeply personal to us as people. It helped me let go of my sister a bit, even though I'm never going to be completely okay with her being gone.

[@joeyzahorik6878]

Am I a Davey for replying to this?

[@BlazeDragonX]

Thank you sharing this. It is really profound.

[@Trilo-Kh2D]

after almost 5 years this is still my favourite video on youtube. nothing had topped it so far. its what motivated me into language studies, and i cant thank you enough. so, i wish you a good day and a good life.

[@stretchyone]

It remains mine still, and I'm sharing it more and more frequently since the dawn of generative LLMs.

[@phobiandarkmoon]

My initial take was that Coda and Davey were two parts of the author's personality, with Coda being his creativite, fun side and Davey being his needy, responsible side that held Coda in check, ultimately depressing the author. Interesting to hear other readings

[@FloraOfTheCats]

@@giraffejuice thats the lovely thing about art isn't it? (so long as the event horizon of pretentiousness isn't reached) different interpretations create fascinating discussions, which can be baked into a game to make meta-criticism, and so to the final layer of irony. oops, nerd rant, tl;dr, lifes good with a good book ;)

[@seraphina985]

In that sense it could also somewhat represent the competing pressures on artists creativity in general, ie things like the need to balance the desire for self expression with the economic pressures of needing to turn the time investment into food on the table etc. Hell even more meta that is in essence a reflection of the human condition the constant balance between our own desires and goals with the need to actually function in a society full of other agents with their own desires and goals.

[@ComplexConfiguration]

you were right. there was no "real" coda but davey himself..

[@roberttwombly3188]

O😮Nr😮36=Niaaaa2ˇn2Ouro+Koui|R😮O+Rnrnnùnù^😮Ai😅Runl😮Noir😮N¶Nn±+¿U😮-😮Ean😮😢¶Nvou😮😮]

[@MarkusManon]

"The next time you hear someone wondering aloud, 'Can games ever be art?', think on the fact that I just spent *half an hour* making sense of [a video game] using [art theory.]" And that was the exact moment I hit the like button, this video is amazing

[@JossCard42]

I actually ended up writing Davey via that email address he gives at the beginning of the game. It was more a cathartic exercise for me than a legitimate attempt to reach the creator. Afterwards, I ended up reading a blog entry about how much of the game could be interpreted as celebrity worship. The kinds of people who are obsessed with an artist's work, and because of what they read into it, believe that they are kindred spirits or have some sort of special connection. She mentioned that she'd encountered what Coda must have encountered dozens of times, with fans of hers whom she had not met before, gushing extremely personal stories to her, and how awkward she felt (and sometimes scared) by the extreme one-sided-ness of that relationship. How violating it felt when fans would approach her at conventions using her real name, though they hadn't ever been introduced before and that the person they felt close to was a fictional persona that had a separate name. This immediately made me feel regretful for writing to Davey, since I felt that The Beginner's Guide was, at least in some part, a narrative pointing out the amount of people who felt like they were entitled to Davey's time, simply through the act of "being a fan". In a sense, I feel like I "lost" the game of The Beginner's Guide simply by writing to Davey, even though, at the time, I knew full well that both the Davey Narrator and Coda were, in all likelihood, fictional characters (or at least, mostly fictional). Obviously, any great work is open to interpretation, and that's fine and dandy. You can't be an artist (or at least not a good artist) without allowing your work to be interpreted however people want to interpret it. The more an author tries to play God in their own published world, the more they end up alienating fans. I think about authors like J.K. Rowling who have spent the last decade releasing revisionist pieces to help "explain" her story (which had finished at that point) but which, at the time, weren't important to the characters or the plot of the story.

[@martinnestorov705]

Did Davey reply? Also, very nicely said :)

[@JossCard42]

No... No reply.

[@dragonking2192]

why are you saying she???

[@JossCard42]

Because the author of the blog is a woman.

[@schroeder666]

I think a lot of passionate people have written exactly that kind of "unwelcome" message to a creator. I know I have. But the lesson is an odd one, if you look more closely at it. The world is comprised of fictions and projections constantly. When a child looks at his father, he's not "right" to read an entire underworld's worth of emotion into his father. What the child is, is a human being - vulnerable, in a limited world, carrying around an unconscious full of fear and potential. The father holds the illusion of father and lets the child's belief play across him, while protecting him and not really superimposing too much of himself onto the child's dream, if possible, while cultivating maximum potential. The child does the same thing in return, letting the father experience a plunge into his own dead, numb childhood. The artist, like the father in those situations, shouldn't feel assaulted, if possible - at least, in my opinion. They should just know that they aren't talking to a real person, but instead a person lost in a dream. Let the dream play out safely, if you can. If the person thinks you're a superhero, or a worthless whore - whatever the case may be - it really has nothing to do with you. It's hard to note this and not feel a sense of disdain or contempt or loneliness, but this is life - a world full of people lost in dreams. It's not celebrity worship, per se, but people lost in a world of mediated images that seem like the same thing as reality. I think it's cool that you made this "mistake", and met yourself in the form of a terror of shame (you didn't really meet some disappointed Davey - you disappointed the new, insightful you), and then felt ashamed. You had the brutal opportunity to abruptly awaken from a dream. Look at the hideous state of electoral politics - many people don't awaken from dreams. No matter how rude an awakening can be, I think we should take what we can from it, and be grateful.

[@CitanulsPumpkin]

For the "can games be art?" hypothetical at the very end, I think the Penny Arcade guys said it best a few years ago. "If a hundred artists are working together for over a year, how can the end result of their work be anything other than art?"

[@WhiteWizard42]

Your explanation of translating everything into and out of a shared language reminded me of a Douglas Adams quote: “You cannot see what I see because you see what you see. You cannot know what I know because you know what you know. What I see and what I know cannot be added to what you see and what you know because they are not of the same kind. Neither can it replace what you see and what you know, because that would be to replace you yourself."

[@gamerman3434]

For my first play-through of the beginner's guide I actually emphasized with narrator. In more ways then one I was him. When he broke down at the end I cried. I followed him, trying to understand his friend's work. I more or less latched onto concepts that reminded me of my battle with depression, of losing friends, needing to feel validated, feeling like whatever I did..it wasn't going to be enough. But at the same time I ignored many of the other game's themes. meaning in a way, like the narrator, I cherry picked what I wanted in my attempt to gain meaning

[@Coulroperation]

Wish my teachers would've played the Beginner's Guide/watched this video. Nothing I hated more in literary classes than talking about what "definitely must've been going on inside the mind of the author, based on their work". Maybe he just likes making prisons.

[@sinistar99]

Notty Rainbow I used to put bars in levels because I love how shadows crawl across them on the floors and walls if you have a point light.

[@andeggbreaks]

Maybe the curtains were just blue

[@averageloser8749]

On the bright side you got that smug feeling when you know more than the person being paid to know more than you Oh wait you get that all the time regardless? Ok den.

[@doom_delrey9736]

As someone who is pursuing an English degree, it's not always about what the author intends when we analyze stuff. It can be about what we see in the work as well. In fact, a very popular literary theory called "Death of the Author" advocates the idea of divorcing a creator from any work they create, so that the work can stand for itself, without the creator having an authoritative say over it. So maybe Coda just liked making prisons. But the creator's say is not the end-all be-all of what something means. Because the whole reason we find stories touching and compelling is because of how we *choose* view and interact with them, not how the author *intended* for us to view and interact with them. Just to be clear, I don't entirely agree with "Death of the Author" theory and think that what the creator intends is important, but it probably shouldn't be absolutely authoritative. As nice as the idea of having an absolute arbiter of truth in interpretation, it also limits our abilities to connect with things and have exciting experiences with them.

[@ianbehrstock]

But I don’t want anyone telling me how I should interpret it, regardless of what it means for/about the author

[@gghelis]

Me: well, this is gonna be interesting. *opens the video* Video: we're gonna spoil the ending for "Sopranos" for some reason, so don't say I didn't warn you. Me: goddamnit. *closes the video*

[@InnuendoStudios]

You've had 9 years!

[@owenmacdonald7428]

Same thing happened to me when I tried to watch this initially! Had to wait a few weeks to watch this :/

[@owenmacdonald7428]

+Innuendo Studios Some of your subscribers are only 18 and were not aware of the Sopranos aged 9 ;) Great video nonetheless, I'm looking forward to the next one!

[@VashdaCrash]

gghelis I though the same, but then I said, "screw it" and saw it anyway. I'm a little tired of crime serials, so it doesn't bother me too much.

[@PKToysoldier]

I got to this point and unfortunately stopped as well. Does anyone know if there is a block of time where the Sopranos is talked about then moves on that can be skipped or does it integrate with a lot of the content continually after?

[@ivesbarrera]

I return to this video every couple weeks. This is perhaps the single most influential piece of critical writing on my thought process regarding the creation and consumption of art. It is often said that the true test of one's understanding of a mode of thought is the ability to explain it to the layperson. Thank you for taking the time to share this with all of us.

[@bigejay100able]

I was supposed to go to bed 4 hours ago but then I ran into your videos and I literally just had the thought that before this I’ve been just listening to the equivalent of junk food whilst being in the verge of diabetics

[@JordanSullivanadventures]

SAaaaaammmmmeeee

[@Victor-um9ce]

Something I think we all can agree upon is that Davey Prime is very good at voice acting.

[@natorousab]

Yeah I really enjoyed that aspect- especially the expressiveness that went into the latter monologue

[@ChimeraReiax]

Your ability to have a deep read in any work of fiction is incredibly impressive, and you always seem to have a very insightful explination to your points. This video, along with your phil fish and Melee epsiodes, are some of my favorite things to listen to just to hear you explain your point, since you do such a great job of doing that :)

[@owenmacdonald7428]

I think I've rewatched all his videos a few times each, he is just amazing! The Melee episode was fantastic, as was the Walking Dead one, but I think for me my favourite is the Advanced Warfare video. Regardless, it's a world class channel IMO :)

[@nintendude794]

I love everything I've seen, except for 5 of the 6 Angry Jack & Anita vids. (Part 2 works well in other contexts, when you ignore the blip about Anita at the finish.) He's wrong about Anita, and about why Jack is Angry. That series defeats its own purpose by the end anyways.

[@nintendude794]

I've rewatched This Is Phil Fish and Blood Is Compulsory the most. Aside from Angry Jack part 2. I've been meaning to watch the rest of his stuff. The Beginner's Guide I'm DEFINITELY excited to hear his take on.

[@owenmacdonald7428]

+Hunter Short That's a shame - I think his stuff about social issues in video game media is really strong! Certainly his outlook make a lot of sense to me - I think the series is probably up there with his best too, but we were listing individual videos rather than the whole series collectively :)

[@nintend8232]

the irony that this video points out has broken my brain apart because now I question myself before deciding whether your opinion is genuine and you just missed the point OR is it that you did get it and left your comment as a meta~joke to further the message of this video. Who Cares...?

[@julianbell9161]

Halfway through the game, I thought the final reveal of the game was going to be that Coda killed himself and Davey was beating himself up for not doing anything to stop it. However, to me, it’s clear that Coda and Davey are the same person. Coda is the creative genius part of Davey, the one that makes all these little abstract games for no one else other than himself. Davey represents the part of himself that seeks approval and praise. He decided to start showing people his avant garde games and people really liked them. This caused an internal alienation in himself between Coda and Davey, the part of him that created for creation sake with no intent of receiving any recognition for it, and the part of him that is full of imposter syndrome and desperately seeks approval from others. This ultimately causes a rift between these two personalities and causes Davey to fall into a depression that prevents him from making any more of these types of games. The creative part of him rejects him completely, and it breaks him, thus all he is left with is his imposter syndrome and an inability to create. This is why he released the Beginner’s Guide, it’s his imposter syndrome self doing the only thing he knows how to do: seek validation from others hoping it will re stimulate Coda, the creative part of him.

[@hariman7727]

Davey is a leech, attempting to garner himself fame and success by latching onto someone more creative than him. And now he doesn't understand why he was rejected, and is begging for the person he abused to come back.

[@FreshTillDeath56]

That's a great reading of it.

[@BeInvoked]

This was the best possible use of my lunch break ever

[@MyJW24]

This actually helped me a lot to understand my Communications class. Even though that wasn't your intention, thank you! You've sent me on a lot of interesting thought experiments.

[@tremolo2109]

I recently found your channel and... Why the fuck aren't you more popular? High quality content that has something to say and says it effectively

[@InnuendoStudios]

I spent 32 minutes talking about semiotics and enunciation theory in the context of an obscure indie game. Why am I popular at all?!?!

[@ashnatale4089]

hey! semiotics are sexy. beats another "dudebros eating gross things/hilarious gaming channels" any day

[@Rwdphotos]

@@InnuendoStudiosit’s like taking my mind to a nice restaurant, especially after it has gotten so used to fast food. It has a lovely presentation and was full of complex flavors that enhance each other rather than overwhelm. Michelin star worthy.

[@_Baku]

I find it ironic that some people played the game, watched this video, and yet still felt the need to offer the exact kind of authoritative opinion on what Davey Prime intended you to take away from the game that was criticized in both. Generally, unnuanced but cool-sounding theories like "You are Davey" or "You are Coda" or "Coda is Davey Prime" (admittedly I'm over simplifying a touch) which aren't so much surmised from the text, but presupposed and rationalized afterwards, in the exact same way Davey the Narrator does with Coda's games.

[@smileyp4535]

People just gotta narrativize things, not necessarily bad, sometimes good. But for better or worse, that's the way it is

[@hariman7727]

It's pretty obvious that Davey is a leech of a person who tried to ride someone else's creative ability to fame, but the person they were abusing to get famous caught onto the grift and cut the leech out of his life. If you know anybody who has achieved even moderate creative success, or have achieved moderate creative success yourself, you see people like that all the time. People who want to have success without the work, so they attempt to attach themselves to someone more successful. The sad thing is, if a leech like that does successfully attach themselves to a creative, it typically hinders and possibly destroys the works in question and the creative's ability to create.

[@avivastudios2311]

That's how our minds work.

[@haimishmichellema7597]

Simmel's sociological works never quite clicked until I watched this. Your breakdown and your use of pictures and the examples you present make the complex metaprocess of storytelling so much more intuitive!

[@6pades]

coming back to this video every so often because i just love it so much

[@2bsirius]

This was like a playable Borges short story

[@jameslaw6945]

Which makes it all the better when he mentions Robert Yang who actually made a game adaptation of a Borges short story.

[@2bsirius]

Yup, delicious. I did not know that factoid. Now I'll have to check it out. Thanks...

[@SimonPiano42]

what's it called?

[@jameslaw6945]

It's been a while since I played it, but I'm pretty sure that 'Intimate, Infinite" is the game I played after looking it up again.

[@vaiyt]

This reminds me of how the second part of Don Quixote is a commentary on the people that read the first (and on the smartass who tried to publish an unofficial Part 2 before Cervantes was done with the real one). Which then leads to the fact that Jorge Luis Borges wrote a story called "Pierre Menard, Author Of The Quixote", in which an author studies Don Quixote so thoroughly he manages to reverse-engineer it word by word, creating a work that, argues the narrator, is superior to Cervantes' version because of context and authorial perspective, even though the words are identical.

[@3112Shadow]

Hey, so I had this whole thing written out - three paragraphs - but here are the basics: 1. ExtraCredits sent me 2. I like your stuff 3. subscribed

[@blockmaster51]

Same here

[@JulianSloman]

what's ExtraCredits? a channel?

[@TheRealPairjax]

Yes.

[@OutcastAngelV]

Did you ever find out that Light was the killer?!?!? (spoiler alert)

[@General12th]

+Julian Sloman Why didn't you look it up? You spent time writing a comment _hoping_ for a response instead of looking it up and actually _getting_ a response.

[@mehblahwhatever]

I don't know why I found that Twitter edit so hilarious.

[@NathanielJordan85]

The comedic timing of that cutaway was exquisite, frankly...

[@marshallbradshaw3817]

For me, seeing the face, movement, and home of the narrator (after such a long video of only narration (about how messy things get when you try to use the narrator as a window into the author)) was transgressive. I feel a little naughty for having rewatched that part, maybe sorta definitely looking for clues about the author, despite everything I just watched. To me, it's a counter-argument. I was dared not to make a big deal of the author, and I failed. And then I giggled.

[@NathanielJordan85]

Yeah, that choice has some layers of complexity to it when you consider that it serves as bait to attempt to interpret the video's creator through that cutaway joke. It's an interesting opportunity to reflect on the content of the video in that temptation (intentional or not).

[@AdobadoFantastico]

I like that the conversations in response to this video are so thoughtful. I definitely did not think to try to probe into the author more in that shot. But I definitely feel similarly about it being a conscious tease. Applying all the things he was talking about to the very idea of his autobio text on twitter is interesting....that text could easily be seen as a narrative about himself. Not only did he write an expressive statement about himself, but he's updating it. He's obviously updating that text in anticipation of our thoughts on his character....or is he? Is it there to preemptively deflect those accusations? Isn't pretentiousness entirely about perception? Maybe it isn't, because it's an accusation, but it's an accusation of a specific thing going on in his mind that is possibly objectively true and he is writing something that acknowledges....oh, look at me trying to probe into the author. Also, does that count as a sort of 4th wall break? He's....sort of referring to things outside the bounds of the video's subject and kind of maybe referring to his "actual" self? Or referring to the representation of him that most of the viewers probably spend most of their time thinking of?

[@fullmetalsnowflake2508]

I always feel like Ian *nails* the structure and rhythm of his vids in setting up earned emotional responses/ blue sky views/ comedic breaks etc. I laughed a lot too, and it's a simple joke but it feels like it comes at just the right time.

[@Ikcatcher]

This video honestly perfectly describes the issues I have with writing. No matter how well I may write something, there will always be someone who will completely miss the point.

[@FrankieSmileShow]

Excellent video, very well put. There needs to be a distinction made between interpreting an author's possible intention with a work, and diagnosing them or imposing some hidden agenda upon them. One needs to be just a little humble and realize people are more complex than to be entirely defined by their work. A horribly depressing game could reflect a deeply depressed author sure, but could also just be inspired of a rainy day, or one event from their life that no longer affects them but left them with an evocative memory, or maybe a strange dream that simply sparked an idea which grew and evolved, or could even be inspired of several other games, movies, books which left a strong impression on the author. My interpretation of The Beginner's Guide is no doubt affected by my own experience, being a game developer myself. I feel Davey Wreden wanted to express to the player some personal issues he his having about validation and work, and how the success of the Stanley Parable might have perhaps irreversibly transformed him. Maybe he remembers caring very little about validation, awards, but now that he has had such an intense taste of it, maybe it feels like the artist he used to be has become so alien to the artist he is now, that he may as well be another person. So he made a game that shows what a relationship between his current self and someone like a (perhaps idealized) version of his past self might look like. How he looks to force meaning and art onto things to fit neatly in with the Artist role he is given, where his past self was just creating for fun. How he now seeks attention and validation, where his past self made countless games he had never even shown anyone. Maybe he can't even imagine creating something for himself alone anymore, maybe he genuinely feels like that would be a waste of time, but remembers a time when he would have not felt that way, and finds that change in himself to be troubling. Now, is that what the actual intention was? I can't be sure. I think that is all supported and alluded to in the text (one game has the player, just freed from a prison, literally speak to their past self who is still captive. The narrator also several times alludes to "having a dialogue with only yourself" and presents this as being unhealthy), but not really in any unambiguous way, and my reading of it is no doubt affected by my own past experiences. Maybe that reading, just like Wreden Narrator's reading of Coda's work in the beginner's guide, really says more about me than about the author.

[@KittydogCrystal]

this video helped me a lot to give me words for the seperation of 'author' and 'narrator'. as a content creator who grew up posting online as a kid, i unknowingly saw myself (the author) and my own narration (my content) as one and the same for the longest time, causing complications with my self identity. that distinction is something that i'd only made recently, but this video helped give me the words for it, and further understand how to deal with it.

[@Torthrodhel]

As a songwriter, I really appreciate that bit about how imperfect the act of conveying ideas necessarily is. This bunch of frequencies in these arrangements somehow makes me feel something? Something I can't really identify. And I write what I enjoy listening to and just hope others will latch on too, because shared general similarity among humans. I often feel like more of a chaos magician than an art scientist. I don't really figure out so much as feel. Even what can be figured out is so clumsily sitting atop a giant mound of so many shrugs that can never be unshrugged. It's pretty fun honestly. :)

[@loorthedarkelf8353]

Back again, trying to think of something relevant for the comment. The reason I watched again is because I recommended this video to my mother, who was the person in my life who originally got me into writing as a way to process my emotions when I was an angry teenager. I feel she'd find this video interesting, and whenever I recommend a video to someone I go and watch it again in case they have any questions. Like to have it fresh on my brain, and I guess I also engage in imagining myself as someone new to the video. In that way I'm looking for things that might need additional explanation before the question is asked. Fascinating how many authors I know who have anxiety, and had to serve an abusive figure in their life. They spend a lot of their time imagining someone else's needs.

[@rairaur2234]

Seven years later, it is still one of the most memorable videos that I have found on KZbin. Truth be told, the ideas and explanations presented here kickstarted my journey into analysing entertainment works. Thanks forever.

[@TheTNTerminator]

"We need to go deeper"

[@kimeiga]

This is the second time I've watched this, the first time being a few months ago. I got to say, I really appreciated how in depth you were when analyzing the relationship between author and reader. Often times, I feel uncomfortable when reading a story or account of something, but I haven't before had the tools to describe precisely what part of the pipeline of the telling of the story I'm at odds with. Thank you very much :)

[@kamillayessenova4482]

Oh my god a whole essay on my favorite game. Subbed.

[@noidea176]

I don’t know why, but I keep coming back to this video.

[@VerbDoesStuff]

You keep beginning again

[@ruzgar1372]

Sometimes the algorithm blesses you with these beautiful videos.

[@isaacjones6323]

Ugh thank you. I remember the first day I played this game and the feeling I got when the game was over. I was shook. It affected me physically for 2 days. Still one of my favorite games ever made

[@brendan8672]

“We have a hand in the construction of meaning” so well spoken

[@DRUZYDAY]

I know this is an old video, but it was a wonderful essay on the nature of the artist and their audience. I've been thinking about that a lot lately.

[@codaclownery]

MY GOD, THis is the most beautiful video I've ever seen. You have to be some kind of mind god or something. I remember watching this for the first time months ago, I was drawing something, I don't remember what, and was half asleep. I was previously watching Jacksepticeye play this game and I saw this video in the suggestions so I clicked on it kinda expecting it to be some no-thought-at-all-opinionated-nonsense but BOY was I wrong! I was just listening at first taking occasional glances at my phone. But then the part about how the "tree" in someone's head is always going to be different than the teller's (your) tree so I picked up my phone and decided to actually listen to the video. I honestly fell head over heels with it and subscribed but I did what I always do and decided not to watch any of your other videos because I didn't see any other games I was into, so I eventually decided to unsubscribe and forgot about it. Then while I was watching a no commentary playthrough of it (the game) I saw this video and thought to myself "Hey, isn't this that cool video that had the tree thingy in it? Might as well watch it even though I've seen it already." And I've fallen in love all over again, It's just SO GOOD. After I'm done with this beast of a comment (Sorry, by the way.) I am going to go to your channel and watch more of your videos. Thank you and bonne chance!

[@fairawenplays727]

You need to be far more popular than you are. I adore your work. I've come back to this episode time and time again. I've shown this episode to dozens of people. You. Are. Amazing. I hope you continue to release episodes of your critical analyses. :)

[@GuitarbenderS]

i know this video's several years old but i just wanna show my appreciation for it here by saying it's one of my favorite things ever. the analytical and communicative chops it presents us with feel to me like some kind of magic in how crystal clear it manages to be while also talking about complex themes (and talking about talking about them). and specifically, it's also a gorgeous portrait of game narrative design in general. i come back to it every once and again to beam its communication expertise into my brain so i can end up with a more facsimile looking tree each time.

[@catcatcatcatcatcatcatcatcatca]

While really eye-opening, because I haven't heard the idea of these "private languages" the part one felt almost cruel. You made me feel genuine connection, through internet, two years after you did your part of it, explaining how inperfect that said connection is and always will be. And I can never explain how that experience was for me, precisely for the reason you said to make me feeling that way.

[@cactusguy4363]

Even 4 years later, I find myself coming back to this video. It just makes so much sense in too many ways.

[@takke9830]

My personal interpretation aas different at first. But the more I thought about it, the more it began to become a clear message. Since Davie used his own name and identity at the start. I couldn‘t help but assume that he‘d want us to do what he did to the Koda person. He eroded the abstract narrator to make it hard not to interpret it being about him. And to me at least what I got was that Koda‘s games are personal games Davie made probably before the stanley parabel and when making the beginner‘s guide, he probably realized that he wanted to tell a more personal story in the new game but as he did he ran into a spiral of struggle that I as an artist also deeply relate to. Davie is showing us these games a friend of his made but this friend is only expressed through the games. Koda is pretty much the games. It‘s what we get to see of that person. And Davie is telling us what it all means while by doing so he‘s also taking away our own agency to interpret it. It feels like a commentary on how ppl talk about art. And Davie reading into them this way also is something a game dev can‘t avoid by sharing games. And there‘s issues that can hurt. Having to squander a big part of a game cause it‘s too tedious or confusing. There‘s all these nuances and barriers he changes for us to progress. But it also comes off like he‘s showing us personal games he made for himself while struggling to come to terms with how vulnerable that is. And how painful it is to see ppl interpret it in ways that may not apply to your own intent. It feels like a study of learning to be yourself in your art. And showing yourself in your art. And how difficult that is. And how you want to stop cause you start having bad feelings about it and about the fact that your privacy is being invaded by yourself chosing to put it out there. It‘s the plight of making art that is personal. Painfully personal. And maybe the Beginners guide was in a way about Davie trying to make a more personal game by showing us a collection of private games he made for himself to make us learn about him while also simultaniously showing us how difficult that is for him. And I relate to that. Be it from a real place or a fictional one. I mean the game‘s just great in how it lets us see into a world with basically a tour guide who ends up at the end getting into personal beef with the art itself because of the way he explains it to us. But that‘s just my take on it. As an artist. It‘s a really imteresting game and I do love it. Even though it is so meta and confusing.

[@MonstersofHope]

Maybe there's a balance between the artist and art, where choosing which pieces of ourselves to share can maybe get twisted or turned into, say, monsters. Hence that responsibility. Thanks for the thinks! : )

[@Ruminations09]

It's amazing that KZbin still hasn't learned that I want to see this channel's videos. I've watched the Phil Fish and Melee videos at least 5 times each, yet I still have to actively check your channel to see if you've posted new videos; which inevitably causes me to be months late to each one.

[@malcolmwright5793]

The algorithm hates channels that don't post numerous videos at least semi-regularly, and it doesn't help that it prioritises videos that have been submitted recently, further exasperating the issue of content creators with irregular video release schedule being disfavoured by the code that doesn't differentiate between content that took weeks to create and that which can be crapped out with ease.

[@chairsrawesome6376]

Jesus Christ your explanation of language is amazing holy crap. I’m just going to ponder language forever now. Thank you for making this it blew my mind and I’m not even done with the video yet

[@Packbat]

I realize that the message you are communicating because of and illustrated by The Beginner's Guide isn't actually simple, but it felt that way watching your video. That was a clear, vivid, informative, and entertaining presentation. I think I now have a better framework with which to consider the relationships between what happens in the author's head while creating a work, the work itself, what happens in _my_ head reading it, and what happens in any other person's head when they read it.

[@cheekyvibes]

This is such an eloquent, well-thought out video. Is the title a play on The Artist is Present by Marina Abramovic?

[@InnuendoStudios]

Yup. :)

[@InnuendoStudios]

There's an Abramovic cameo at 12:24

[@chrkrngl]

she's probably also absent while spirit cooking with skippy podesta.

[@Ulindria]

funnily enough, while I didn't play beginners guide myself, I watched a let's play of it, I did get the same sense of the story being about the dissolution of a friendship as well, although my understanding of it was less about artistic creativity being a crutch for one party of the relationship and a burden for the other, but rather about a relationship falling apart because of a deep, near obsessive need for emotional and intellectual intimacy bordering on codependency. I probably got this reading through some of my own experiences with friendships falling apart for exactly that reason, and like you said that understanding is mine, and the emotions it dragged out of the deepest parts of me is something only I can experience. whatever this story was trying to say about story telling and narrative and authorship, to me that pales in comparison to how it managed to give voice to some of my own what doubts and fears, and reveal a flaw I didn't even know I had. For that reason, the beginner's guide will always hold a special, if gingerly touched, place in my heart.

[@dontchewglass]

I've been wanting to make video essays, and stuff like this is why. It presents all this complex stuff rooted in postmodern and linguistic theory, etc, but in a way that makes it accessible that Foucault and Barthes never really did (at least translated into English). I've been reading more into philosophy, especially as it relates to art criticism and historiography, especially because that's what I'm studying in college rn. I definitely want to work on writing insightful and accessible introductions to complex topics, while trusting that the audience can digest, and further interpret and think about these ideas. You do that wonderfully in this video.

[@Werewolf906]

I don't think when coda asks Davey to 'stop putting lamp posts in my games' it literally means that Davey edited the games and added the lamp posts, I think it means that Davey's obsession and analysis of Coda's games was shaping the way Coda was creating them, influencing them into being something they had never artistically intended to be in the first place. So Davey thinks that the games needs a structure and some form of uniformity to make them 'work', and this idea and pressure ends up corrupting Coda's creative process, meaning Davey's idea of what is 'right' ends up influencing Coda away from his original artistic vision. The lamp posts are meant to symbolise the unhelpful influence of a player on a game creators artistic process. If it was meant that Davey had literally been editing the games to include the lamp posts, then why wouldn't he have included the lamp posts in the earlier games he showed us? It doesn't quite add up and would make his character inconsistent.

[@personette3226]

There might be some relationship to "lampshading", which is a narrative technique. I just googled up a definition because that's quicker than trying to explain it myself: "A word used for situations in media- mostly in comics and television- where the concerns, criticisms and arguments of the audience are answered in the text itself to assuage any disbelief and therefore frustration a reader or viewer might possess. By underscoring points of possible contention, usually humorously, the suspension of disbelief is retained. Often used to account for implausible developments, ridiculous motivations, bizarre twists and illogical situations, a lampshade can also cover obviously cribbed plot elements by having the author acknowledge through a character that "This is just like..." A lampshade can be used to explain threads that may have lain dormant, and often prods at the fourth wall by having characters address the audience, or realities outside their own existence. Also known as Spotlighting, sometimes as 'Cousin Larry Trick'. See TVTropes for more information." You might quibble about the difference between lampPOST and lampSHADE but I've also heard it referred to as "hanging a lantern". So the exact form the light takes doesn't matter.

[@droidBasher]

I find that interpretation unlikely, but of non-zero probability. I will adjust my priors accordingly. The simpler explanation of the timing is just that Davey didn't feel that the lampposts fit the earlier levels, or that he thought of the idea of lampposts partway through the sequence of levels. I think in-universe that Colah makes a level, Davey edits it, then Davey distributes it to a small audience (not to the players of The Beginners Guide but some fictional audience). So even if Davey wanted to put lampposts in all of the levels, he can't go back and change the first games without revealing that he is revising work that isn't his. And until the very end he isn't willing to reveal his deception.

[@ebbandfloatzel]

Werewolf906 I know this is kinda old but the first time I heard of this I immediately thought of the gaming term of lamp posting: Telling the player what you mean with your game through various methods inside the game. I feel the message itself wasn't as deeply meta as the game makes itself, because the meta WAS the lamp posting. But, I haven't experienced the game myself, so I don't know.

[@onebraincell-q9f]

Well, narrator Davey wanted to get to know Coda through his games and that also meant seeing him grow which for him meant giving a meaning to all his games that he could then try to interpret so in narrator Davey's mind it would make sense for his idea of Coda to not do this from the very begining but to only come to this realization later, after that bug in the whisper machine game made him "ascend" and realize that his games could be more cohesive and have meaning. So Davey the narrator wasn't just trying to give meaning to Coda's games but also trying to get the audience to see Coda as he saw him, which would be an evolving artist who found an astounding revelation one day and tried to convey a message in all of his games from that moment forward.

[@gustavocosta7304]

finally someone said it!

[@yourgellofellow]

I had a friend where our friendship was basically The Beginner's Guide, plot beat from plot beat, emotion to emotion. You can imagine my reaction when I related with Davey, even during the final level's reveal. The Beginner's Guide is the only game I've ever cried to after watching multiple times, and it's the only game I'd recommend everyone play at some point. It's not even a game, it's just experiencing life.

[@loorthedarkelf8353]

Back again after reccomending to a writer friend after we spent an hour discussing how being a creative person has changed in the last couple decades. It was a fun discussion and they seemed enthusastic about the reccomend. See ya next year for my annual rewatch :3

[@SaltSpirits]

One of my greatest achievements in gaming will always be finding my way through that damn labyrinth before I got teleported to the end in my first ever playthrough.

[@totallynoticarus]

I'm studying linguistics and every once in a while I find this video in my recommendations again. Every time I watch it after a while, it just makes more and more sense to me as I'm learning about pragmatics and psycholinguistics. Great job on the essay! I really love this game and all the introspective ideas it represents.

[@KinSpark1]

*slow claps" That was very well put together. Normally a lot of videos that go into the details about communication and the philosophy of ideas tend to lose me in their complexity, but your arguments came through very clearly and gave me something to think about on top of my own thoughts about The Beginner's Guide. Great job.

[@Aresftfun]

dude when you said "i'm the author and you're the audience" at like 12:00 my brain went off the r a i l s

[@sponge917]

I came back and watched this again after seeing HBomberguy play this on livestream. I really appreciate how you construct your videos to be relevant as long as possible.

[@Thebdippy]

There is no deeper meaning to The Beginner's Guide, it is a true story, Davey Prime killed coda and hid his body in a swamp so he could release his games on steam. This monster can't keep pulling the wool over people's eyes.

[@MeemahSN]

and he ran, never to make another game.

[@theunfunnyjokester]

Then he backflipped all the way to work

[@ekoostic]

this is great, but frankly it's indisputable that jar jar binks is a sith lord.

[@imveryangryitsnotbutter]

It was the original intention, for sure, but it's not what we got in the final product.

[@LieseFury]

@@imveryangryitsnotbutter he can be seen using jedi mind tricks in episode 1 and afterwards is almost always at palpatine's side. his role was diminished after fan backlash but he was still depicted, however subtly, as a bad guy with force powers. meaning he was 110% a sith lord.

[@oh_bruhh]

True. Jar Jar being a Sith Lord is simply factual

[@wta1518]

I doubt it. No Sith Lord could come close to the power of Jar Jar.

[@paperferns]

I first saw this in highschool and still come back to it 5 years later. one of the best breakdowns of a video game-and authorship as a whole-that I’ve ever seen. thank you

[@vahrkalla4201]

Ian, your insight never ceases to enlighten me and enrich me. Haven't finished but it's already terrific and passionate. So weird- I made a really similar post about this game just two days ago!

[@bluemarb1e787]

I come back to this video every so often to just listen to the way that you discuss metatextual elements in such a clear way. Getting really meta can tend to make your point a bit obfuscated, and this video is a fantastic illustration of how to not lose an audience. Fantastic job.

[@spacelizbian]

It's an amazing testament to your skill as a writer that this video isn't insanely pretentious

[@jjceno6813]

I can't explain how much I love the fact that this video made such an impact on me while being about a game that was about the interpretation of someone who did not create a game about said game, and also that I am now doing the exact same thing by leaving a comment. ...ABOUT A PERSON TALKING ABOUT A PERSON WHO *implodes*

[@dashiellgillingham4579]

I just found this video, and that thing about providing blueprints through language for people to build things within their own mind, was legit the topic of my final paper for one of my English classes at my City College. I essentially called that the fundamental nature of all teaching, all language, all literature, all storytelling. Right up to the whole 'there's a separate thing that exists in reality that transmits the blueprint to people, that exists wether the author planned it's content or not.'

[@Kayizcray]

As a writing major taking a shit ton of seminar-based classes where people argue a lot about what an author of a work meant, there's also the concept of "death of the author." The idea that a good text makes you forget there's an author at all, that it shouldn't matter what the author intended - it's what is left behind if you take out the idea of an author entirely that matters. When my professors first brought it up, it rubbed me the wrong way. Context felt like it mattered to me. I create to say things to other people, I want people to try to understand deeper meanings behind what I'm saying, and sometimes, that takes getting to know the creator behind the work. This video makes me think so much more about it and I love it. I want to know what an author is trying to say, but even as clear-cut as I think some deep meaning is, I can always read it completely differently than was intended. Context is so delicately subjective - and when an author puts something into the world, it becomes a consumer's interpretation that ultimately makes it what it is. Which can be absolutely terribly terrifying and ultimately ruin it for some people who don't enjoy their own interpretation, and what makes it a masterpiece for others. I don't know how I feel about that, honestly, but it's interesting as hell. We've got so many layers we're rivaling Shrek at this point my brain hurts

[@jureigeeksoutoccasionally]

I understand the whole “who cares” thing. Technically yes he did “When we are in the same room, I feel physically ill”-R to Davey prime. But in the end, it doesn’t matter. This game truly isn’t about Coda, or R, or the Davey’s. It’s about

[@MatauReviews]

ABOUT WHAT?

[@stegosandrosos1291]

@@MatauReviews dees nuts

[@SkyenNovaA]

So, I watched your alt right playbook a while ago and really liked it. Then years later I played (more like "experienced") The Beginners Guide. I then searched for an analysis to see what others thought and you pop up again! Glad to see you've also experienced this and I'm looking forward to hearing what you have to say about it.

[@criticalravi8741]

What a fantastic video. I'm studying German literature, and I'm just starting to notice how this discipline has so much more potential. Sure, we can discuss Goethe all day long and wonder why nobody cares much. Hell, we tell each other stories all the time, in films, music, books, personal relationships - why can't we talk about how all of this works, with present day examples? If my literature courses were more like this video, I'd be in love with it

[@starlesscitiess]

man this revitalised my interest in both my english classes. i feel that dissection of communication and translating meaning is gonna help me to conceptualise and frame my analysis a lot better now so thank you :))

[@reijamerilainen]

Omg yay, I haven't even watched it in full yet but I just had to come and comment that I got so excited as soon as I saw the notification. My favourite (at least games-related) KZbinr talking about my favourite recent game experience

[@reijamerilainen]

Btw, also Errant Signal's video about Beginner's Guide is really good. If anyone's interested.

[@SteppingStonevlogs]

+Reija Meriläinen thanks

[@sircipheredofficial]

This is still my favorite video you've ever made and it's specifically the video that influenced me to spend much more time thinking about what I'd like to say before publishing a video or post.

[@jongyon7192p]

This video is just amazing. It's like, it just went into my mind and overtook and destroyed whatever other interpretations I may have had of the game. Which is a bit worrying... But then again, I watched the video with my own interpretations of what you said and what you meant to say, right? Hmm. Anyway, I feel like your interpretation is going to become very popular, and then it's gonna be that thing where it splits in two of people who agree and people who think the 2nd most plausible explanation is true and whatever, nevermind me.

[@nicuveo]

This essay is one of my favourites, and i keep recommending it to everyone i know. The fact that it isn't at 1M views is a travesty and an injustice.

[@CaptainBagman]

So if senpai doesn't notice me then I don't exist.

[@coldDrive]

Even if senpai notices you that's not actually you he's noticing :3

[@CaptainBagman]

Generic Username That also means senpai is not the real senpai.

[@3v1l73ddy]

It depends on how you perceive his not noticing you.

[@seeranos]

More importantly, if you don't notice senpai, they don't exist either

[@VashdaCrash]

Nathan Ware You mean "he doesn't" exist either, right?

[@alydev23]

One thing that the comment on the difference between a story and an anecdote reminded me of was Randy Feltface's story about Morgan. He tells an eloquent story about needing a piece of furniture, traveling to pick it up, and meeting a man who had found out his partner was cheating and was in a real state, ending with Randy driving away as fast as he could as Morgan destroyed the house behind him. And at the end, Randy says simply, "I made it up. Doesn't feel good, does it?" I keep coming back to this video, I'm so glad it exists. I've shown it to others when I want to convey this particular thought on language.

[@FreshTillDeath56]

Me too. Art stands alone from it's artist.

[@helenasommerville]

I really needed someone to articulate their thoughts and feelings about the beginner's guide, especially those concerning the dissolution of close friendships that the game brought up. so hey, thank you

[@linky0064]

This video is absolutely fantastic. Seriously one of your best.

[@JessicaMorgani]

I still come to this video again and again

[@rakshasajakir]

Between my MA in English and my BA in linguistics, this video brought back some great memories about my studies in metatextual analysis and cognitive psychology. Thanks for the video.

[@lizziebrasileira]

I used a few parts of this video in a presentation for a translation course I took when I was an undergrad. Now, in my second degree, I'm taking a discourse analysis course and this video came to my mind again. The explanation about how language works is marvelous.

[@SpirusOfH]

Using clips from Exit Through the Giftshop and Synecdoche New York immediately tells me that you know exactly what you're talking about with this game. I'm only 10 minutes in but I already know that you "get it" in a way that many other videos about this subject matter don't.

[@TheCyberchickz]

What you said about projecting the constructed narrator onto the author actually helped me put a finger on something that had bothered me in media criticism for a while. When you analyze a story with the intent of evaluating the author’s character, its too easy to project your own hopes and fears onto their intentions.

[@Doornenstroom]

Heavy Meta is my favourite genre of music

[@hedgehog3180]

I love this video and now I'm really sad I wasn't really in a place to appreciate The Beginners Guide when it first came out but I'm gonna go play it now, and try to keep up with more meta games in general.

[@anomalapithecus]

i honestly find that diagram in part four stunningly beautiful

[@maxx8541]

When Coda said "would you stop adding lampposts to my games?" I think he meant that more in a metaphorical sense, that Davey was interpreting a point to the game where there is none. Maybe Davey forced that on the people he shared the games with, and that's why Coda is saying that. Maybe the lampposts mean nothing and Coda just thought they looked cool.

[@serenity6831]

I love the way you break down incredibly complex ideas into easily digestible fragments. I've never put too much thought into the effects of projecting too much onto the creator of certain content, nor the relationship between author and audience, but you did it so beautifully

[@cedricpicard297]

An interpretation I like that kinda does the thing of using the text to interpret the author is that Stanley Parable was originally a Half-Life 2 mod. So Davey Prime quite literally took someone else’s work, edited it to make it his own, and became immensely successful from it. In the end, Stanley Parable is undeniably its own game, but there’s a lingering influence there. There is definitely so much more to this game and you did a great job of summarizing it. Great vid!

[@goylefriend]

I played this game years ago, and always felt as though I needed closure on it that I did not get from replaying it, or stewing on it for hours, trying to dissect a message. This was everything I wanted and more - brilliantly done. Thank you.

[@foragegrasspause2gotoloop961]

I'm a speech therapist, and I have never heard these concepts so well illustrated!

[@Trynottoblink]

One of my favorite channels on KZbin. Great video essays. Keep up the good work.

[@jjtninja]

I can't agree with you more. You can't use the book as the way to read the author.

[@RydM-vd5lu]

This is one of the most well thought out, well constructed, well communicated, and down right interesting videos I’ve ever watched. I just wanted you to know that. Instant sub