Light & Coherence part 2: Spatial Coherence (and the Double Slit Experiment)

[@jounik]

"The famous ... bunch of slits experiment." Oh yes, I distinctly remember that one.

[@TheWyrdSmythe]

It was done by a bunch of famous scientists!

[@RealNovgorod]

It's named after the famous Dutch tulip merchant Hryydwig van Grating.

[@funkbo]

I laughed hard at this joke! Well put.

[@petevenuti7355]

Definitely a chuckle

[@NilsBerglund]

Thanks again, Jeroen, for the interesting collaboration!

[@HuygensOptics]

I really enjoyed it and the result that you created is magnificent!

[@douginorlando6260]

Nils … Your wave simulation helped make the concept intuitively obvious. No amount of hand waving could ever substitute for your contribution. Thanks from thousands who will benefit from your creation. (And thanks to Jeroen for explaining it and what it implies).

[@NilsBerglund]

@@douginorlando6260 Thanks Doug. I have always been convinced by the saying "a picture says more than a thousand words".

[@itishappy]

Then surely your 3m video (with 10,000+ pictures) must be worth at least a million! Surprised and thrilled to see two of my favorite channels working together!

[@Grateful.For.Everything]

@@itishappysame here, when I saw he linked up with Nils I knew it was gonna something cool, Nils makes awesome simulations.

[@lexscarlet]

Buddy I'm gonna be arrogant and speak for everyone when I say don't worry about the length of the videos. Your explanations are so jam-packed with info and knowledge and awesome illustrations and animations ... I can't get enough.

[@lexscarlet]

Yeah but he also very specifically says pretty sure in this video actually that he is not an expert and only took a few classes There's a reason KZbin isn't considered a primary source. I'm not exactly hitting up these videos to figure out research direction for NIF lol

[@harriehausenman8623]

Yezz! They can't be long enough 😍

[@harriehausenman8623]

@@schmetterling4477 Nah, it's not really 'wrong'. Just entangled 🤣

[@itishappy]

@@schmetterling4477 wrong how?

[@spicybaguette7706]

@Schmetter Ling What are your qualifications? I'm not trying to be condescending, but why should I "trust" you as a source of info over him?

[@32bits-of-a-bus59]

Amazing video! Thanks for calculating the size of the interference spot for the sunlight. I think that it nicely explains why an interference speckles can be seen in someone's hair on a bright sunny day but not in the room brightly illuminated with lots of light sources even if the total brightness would be comparable. Anyway, looking forwards to seeing another episode. Especially, how you will explain conservation of energy upon absorption (for a single event, the energy of the wave should be retrieved instantly from the whole sphere around the source to a single point somewhere on it, where the detection event took place).

[@troymeister100]

Absolutely brilliant! Love the sarcasm too "... made friends for life in the photonics community". Your explanations are wonderful, crisp, amusing and above all, useful. I use Zemax to model optical systems & visualise light as a wave. I don't think of it in terms of Schrodinger's equation or its quantum properties, fascinating though they are. Engineers like me use Newtonian physics/Euclidean geometry to solve what are sometimes very difficult problems, knowing relativistic terms have been omitted. Likewise, wave descriptions work, even if they are not a complete description. Your explanations are clear, your models intuitive and the science, perfectly legitimate. Please don't let the critics spoil the show!

[@douginorlando6260]

Amen brother! Our man Huygens just handed their asshats back to them. The upper quote from that “friend for life” reeks of Jungian psychology … the naysayer represses his dark side from his own conscious awareness and instead he projects his own arrogance on our man Huygens. Frankly, his “friends for life” built their careers on bullying, not science. The disparaging reaction reminds me of a trial attorney joke … “when you have the law on your side then pound on the law, when you have the facts on your side then pound on the facts, and if you have neither on your side then pound on the table”. Instead of being excited and embracing improved understanding, they are dismayed and defensive about being wrong.

[@itishappy]

​@phumgwatenagala6606 but armchair psychology is so much easier than armchair neuroscience :) people readily share comments, but balk when I ask them to put on one measly electrode

[@RealNovgorod]

Quantum electrodynamics is legit and requires the quantum nature of light (discrete energy occupations on top of a classical EM/probability field) to explain observations in strongly coupled systems. Usually these things are microscopic (quantum dots, cavity QED) or exploit "non-classical" light (which doesn't follow Poissonian statistics, cryptography buffs love it). This "quantum nature" is essentially irrelevant on the macro scale though and all "everyday" light-matter interaction can be completely described with a classical EM wave acting upon quantized electronic states in matter.

[@cbob213]

Keyboard cowboys are always the absolute worst. Comments like yours are much more the norm. I agree with your sentiments. Screw the haters.

[@luke2642]

Fantastic explanation as always, looking forward to part 3! And part 4,5 and 6 when you bring in polarisation, electromagnetics, poynting vectors and meta materials ;-) And such a great way to deal with comments, all makes for a good show! I feel you've really made inroads into wrapping up the "how big is a photon" video in a way we can understand!

[@knkyclpy]

I remember I once paid a visit to o spin-off from the university of Ghent, they made a spectroscope to check the quality of DNA preparations before the actual analysis. They used a deuterium lamp to put light thrue a sample , that was defrated by a CD like mirror to avoid using a prism. The light fel on a CCD as used in a simple scanner.

[@SuperSquark]

"I feel you've really made inroads into wrapping up the "how big is a photon" video in a way we can understand!" How big is the field of light? Its an exponentially expanding area of wavyness.....C^2. Square meters per second squared. The waves have a length and periodicity. We call each wave a photon.

[@luke2642]

@@SuperSquark Each wave isn't a photon, no. All you can say is each emission/absorption event "involves" a photon. It's exactly the issue he was describing at the end, the difference in language when talking about light fields vs emission/absorption events. Have you watched his "how big is a photon" video? A continuous wave type laser gives very unintuitive results compared to a spontaneous emission type, and you would end up concluding a photon of wavelength 600nm is actually ~meter long, which is very strange! Thousands of millions of wavelengths!

[@Pidrittel]

[s] I am not disappointed at you sir. I genuinely enjoy your videos in Optics, but somehow along the way I think you got the idea that you can authoritatively enlarge my view about things clearly already taught to me in university. Why are you trying to explain quantum phenomena in a very comprehensive and nicely visualized way as a classical wave? Unless you think you are doing it better than all the scientific community as a whole. We all think that. It's easy to understand why... if you ever tried to open a book on quantum electrodynamics, then it would struck you right away that you would never understand what "light" means. It's way beyond the paygrade of a simple QED book anyway. Chances are, that it was never intended as such, though. [\s] I genuinely love this channel as it is a whole "what i missed during 6 years of studying physics" course and I think your way of putting topics like this one (coherence) in a new "light" (pun intended) is super valuable. Also I think you very well point out how you can understand very deep experiments in optics fully without any need for quantization, spooky action at a distance, uncertainty relations and all the other fancy quantum stuff that even my theoretical physics professors never could convincingly present as it would have required a whole additional degree in maths including functional analysis, differential geometry, and all the other math concepts no one truly has time for in a physics degree. Looking forward to part 3! :)

[@5ty717]

One of the greatest Dutch scientists ever… there is a long line of brilliant Dutchies… really ive always noticed in maths physics etc… another great insightful piece. Thank you…

[@donlouden8850]

Baby's first words / did you hear that Helen learns fast eh

[@dominicestebanrice7460]

Astonishing how excellent and thought provoking the content on this channel is.

[@JakeDownsWuzHere]

love your content. the pixelated user avatar representing the quantum-mechanically minded person was a nice touch

[@LesLaboratory]

Great as always! There is immense value and understanding to be had in embracing the idea that light is a wave. It's rather odd that the comments section ended up so polarised 😁 , given that wave-particle duality is a thing. Making friends is fun! Keep it up!

[@HuygensOptics]

Thanks Les. Stating that the EM field is not quantized into photons hits a sensitive spot with some people. I think that in the end the photon is just a mathematical construct to explain experiments. Especially in highly attenuated laser beams, it becomes increasingly difficult to think in terms of individual photons in combination with the coherence properties of the light. I guess it's best to consider the photon as nothing more than the energy transferred between EM radiation and matter.

[@harriehausenman8623]

@@HuygensOptics To me, it's more of a discourse, pondering about the various options that present themselves, getting some historical context (which was, as always, prilliantly researched, thank you well!) and actually doing some fascinating experiments. In contrast to so many legacy-media content, i never have the feeling to be actually sold any opinion or mind-set, which is also is stark contrast to funding in academic environments 😉

[@LesLaboratory]

@@HuygensOptics Agreed, the quantum nature of the photon seems to be important only during its interaction with matter, and even, then there are circumstances (namely non-linear interactions) where the wave model seems to be a good fit. Regardless, keep up the work!

[@Veptis]

I really enjoy how the "there is no destructive interference" statement shows true with this visualization.

[@MissNorington]

11:50 Loved it! 12:35 Again, this is exactly what has bugged me for more than a year trying to find truths from KZbin videos.

[@LouisEguchiWale]

The absolute best explanation on the internet

[@ImRyozanpaku]

Absolutely fantastic video! Thank you for the beautiful content. In my opinion, your intuitive explanations, visuals, experimental and numerical test cases, and occasional humor jab, make this the best optics communication channel, and it's quickly becoming my favorite science channel on this platform. I've been a long-time fan and can't wait for the next chapter!

[@cest7343]

This is in my opinion, top notch science. Highly appreciated for sharing, kind sir.

[@XephiusExperiment]

Another great video. Looking forward to part 3. It would be great to hear you explain atmospheric optical phenomenon some day. Your videos do a great job of providing relevant context to understand the subject. Thank you.🔭🌙

[@peetiegonzalez1845]

The famous "buncha slits experiment" indeed.

[@John-xl5bx]

Bravo! Even though I already knew every fact you presented, the manner in which you do so is intellectually provocative. Bravo, and I look forward to the next chapter.

[@antoniolewis1016]

looking forward to your next video - I appreciate your somewhat unorthodox experimental insight.

[@byronwatkins2565]

VERY good job explaining how an extended source creates variations in phase! The double-slit name is more than metaphor; two slits contain the essential physics. Analyzing Young's actual experiment is quite difficult because there is effectively a continuous distribution of emitters on each side of the card and the amplitudes of the various colors depend on position. This is in addition to the fact (as you pointed out) that each of their phases varies due to the properties of the sun. I don't believe there is yet a closed solution to this problem for comparison to Young's data... numerical solvers on modern computers were not available to Young. Two point sources emitting in phase predict the correct spacing for all colors as Young demonstrated.

[@Mustombrider]

Wow mind blowing content as usual. Really made me ponder about the implications of these phenomenon. Thank you for your time and hard work to explain everything.

[@hamjudo]

The most amazing thing is that physicists get the exact same numerical results when modeling the transmission of light whether they model light as particles or waves when a system is simple enough for a complete quantum analysis. These results also agree with experiments. As stated in the video, the emission and detection of the light is purely a quantized statistical phenomenon. From a practical point of view, the math for building a complete quantum physics model isn't feasible for any but the simplest systems. Thus, the complete math is usually first experimentally verified with microwaves, because actual visible light waves are too damn small. As the video explained, emission and detection of light is the realm of quantum physicists, everything else is modeled as waves. This applies even when quantum physicists are the ones designing an experimental apparatus.

[@ironnmyth]

Finally! Someone made me understand how we can do interferometry with stars that have billions of independent and random emissions. Thank you very much!!!

[@Koishichan]

I love it when an experiment or metaphor that never made mush sense to me turns out to be so misrepresentative of the original demonstration which, when explained accurately, makes much more sense. Although it's also frustrating to learn then several generations of students were shown a confusing demonstration that propagated so much misunderstanding. I love your videos! Despite what others may say, it's clear you are very intelligent and well studied and have immense practical experience with optics. (I'd love to hear more about the work you did with lenses and optics.) It's worth remembering that we do not as yet have any completely accurate model of electromagnetism, Optics, or Quantum Mechanics, and any self respecting scientist would not seek to diminish the knowledge seeking of others.

[@BartSliggers]

If you ask a physics teacher; But what IS a field really ? They all go : “Well you sprinkle some iron filings on a sheet of paper… “or”Once upon a time there was a great mathematician”

[@gcewing]

Or ask a farmer: "Well, you fence off an area of grass and put some cows on it..." Since cows come in discrete units, it's a quantum field! And sometimes a cow and an anti-cow (also known as a bull) come together and produce another cow, so one can draw Feynman diagrams of the possible interactions between cows. Hmmm, maybe this is the shared metaphor we're looking for...

[@zanepeterkovic9553]

Great video, extremely excited for part 3.

[@ZauberTocc]

Loving your videos, thank you very much. I got quite a number of aha-moments out of them, very clear, a treat to follow.

[@siirmartin403]

Wow, I literally found your channel yesterday and I was wondering when the spatial coherence video was coming out 😃

[@derrekwilson229]

Very beautiful explanation of the emergence of coherence. Let the haters hate. I have a PhD in atomic, molecular, and optical physics and I was 'unphased' by your classical descriptions. These are tools in a toolbox, and we frequently exchange between physical pictures as we see fit.

[@schmetterling4477]

Coherence is a simple geometry effect. It has nothing to do with the classical/quantum description. A physicist should know that. I kind of doubt that non-physicists have the necessary intuition for these things, though.

[@Brunoscaramuzzi]

Cant wait for part 3!! You are presenting another way to see how light behaves and it is very brave from your part. Dont bother about this silly comments. It is so fascinating to watch your videos. Keep it up and keep it coming!! Thank you so much!!

[@lordofelectrons4513]

Many thumbs up since I will watch this video many times thus arriving at a more coherent understanding of the material presented.

[@fredinit]

Another fantastic video. Like others, can't wait until part 3.

[@EngineerNick]

Absolutely brilliant video thank you :) I have not passed any quantum mechanics exams, but I find your description of light much more useful than the mysticism and metaphor surrounding quantum explanations. I get frustrated by physics videos which do not show an experimental apparatus or even bother to explain 'measurements'. I think they have spent too long in math-land.

[@faezeakbari1034]

I deeply appreciate you for these useful contents. Keep going please

[@gertebert]

Jeroen, heb je kanaal pas ontdekt en ben meteen aan het binge-watchen geslagen!

[@matthiasbanet74]

Great video! Always exciting to dive into these topics

[@glentyan2505]

A very well thought out explanation of the most difficult of subjects as usual. I would like to add with some humour that the atmosphere is to viewing steady starlight what Ducks are to a flat calm pond.

[@victormultanen1981]

very welcommed video and topic to discuss! I apprecciate your effort to review this.

[@Zenodilodon]

Fantastic video! I love that you took the time to discus the electron based experiment, never thought to look into it but makes perfect sense. I should look into how they tested molecules too. Optics never gets boring, always new things. Looking forward to more videos. I picked up 2 decently large 543nm helium neon lasers, I want to do some interference tests. You discussed a few thoughts in a previous video which got me thinking a bit. I bet you would get excellent diffraction from an old car overhead incandescent light or fuse shaped one. the thin wire in a line if cropped correct could make for nice single axis light.

[@tjmozdzen]

I find it helpful to sometimes think of the Efield as a probability distribution function more so than an electric field. When doing that, I find it less mind boggling to think of a non-zero probability in both possible light paths.

[@airman2468]

I'm really digging this deeper dive into your thinking. I hope you can take people's (and my) criticism of the ideas with a grain of salt, as the burden of proof seems always to lie with those challenging accepted theory, and those already accepting current theory are often not burdened with rigorous defense, making it inherently easy to be lazier. All the best physicists I have known would not claim quantization of the energy itself (which seems impossible to observe), but some kind of quantization within the mechanisms of "measurement" (absorption, etc.). Calling the energy itself "quantized" seemed more of a shorthand for these observations. Maybe it was just the people I was around (quantum ultracold gas, QIS research, etc.). But to your credit, those same physicists believed any attempt to interpret something without being able to separate one result from another is a waste of time. Good for scientific rigor, maybe bad for interpreting stuff, but there's the rub. I am excited to see how you can differentiate your interpretation from other ones via experimental results, or if that is on the horizon here. If it is mostly a philosophical approach (Occam's Razor, or something), I am still very interested to keep hearing how you arrived at your conclusions. I would be very curious to see how you approach other, non-EM phenomena within QM. QCD, maybe. Or a coherence-only interpretation of a Bose-Einstein condensate. Looking forward to seeing what you consider to be a "particle" as well. I have watched people hold single atoms with beams of light and watched clouds of atoms become coherent waves. I am the first to admit I do not understand what that really means, but interpretation always seemed outside the scope of the field. Historical attempts to interpret the meaning have obfuscated all of the very real progress we have achieved. Any of us worth our salt are more stimulated by sensible disagreement in science than by mindless agreement, so I hope any reasonable criticism of your ideas is only motivating to you. I really do not condone the personal attacks, though, however much of a historical precedent that argumentation style has had in science. Still intrigued, still subscribed. Keep 'em coming!

[@Hailfire08]

I'm pretty sure it is the energy itself that's quantised; in general, the Hamiltonian of quantum mechanics has some set of discrete allowed energy states, and you can't get between those because there simply aren't states there to be in. The expectation value of the energy can take any value, maybe that's what you mean, but any stationary state has a quantised energy, and interactions will occur to take you from one stationary state to another and so release that quantised energy difference between them

[@narfwhals7843]

Energy itself is not quantized. You can have, in general, any energy. What is quantized is energy _per frequency_ . This implies quantized energies of systems that are restricted to certain frequencies, like the quantum harmonic oscillator.

[@dynapb]

Thanks for another great video, I love the way you explain things with great demonstrations! Can't wait to see if you can develop a "suitable common metaphor" for everyone in part 3! In my view everything is waves anyway, even the quantum photon is a specialized localized wave. So in general I think that it would be difficult to show a way that light can be both emitted and absorbed by an atom without being quantized. It is the specialized properties of the photon wave that make it appear as 'EM Radiation' on a macro scale.

[@phy6geniuxYTcreations]

Amazing sequel! Will wait for part 3!

[@CarlJdP]

@HuygensOptics, thank you for all the effort you put into these videos, I enjoy your the presentation technique and visualisations very much, it's makes some of the more difficult multi-factor/variable phenomena easier to grasp. Greetings from South Africa 🇿🇦

Amazing video, very explanative. Thank you!

[@JaySmith91]

Thank you very much for this series; great visualizations.

[@seventhtenth]

he went off at the end 😂 i love your videos, been out of school but I still want to do photonics/optics, nice coherence video :)

[@FunkyDexter]

I waited so long to get an explanation on the quantized nature of light! Hopefully the next part won't take as long.

[@michaelhaardt5988]

That is a great episode and I am looking forward to the next part. I was happy with viewing light as radiation, knowing on a smaller scale there is quantum mechanics that I don't understand and that does not show in my world, until I saw your video about the size of a photon. Now it is "radiation in my world but really quantum mechanics that I still don't understand has crept in my world, too". :)

[@8pelagic610]

Fabulous lecture series. Thanks so much.

[@gregoryallen0001]

amaaaazing 4 clarity thank you!!!

[@KevinJudd-au]

I studied Pure Mathematics and Mathematical Physics, although I eventually became a Professor of Applied Mathematics. I have never really bought into the dogma of quantum mechanics. In my view QM is not "truth"; it is just a very good model of reality. If you strip away the dogma and late 19th century mysticism, then the mathematics of QM provides a probabilistic description of certain phenomena. I don't have a better mathematical model to offer, but unless young scientists question dogma there is no way to a deeper understanding. Your videos are a wonderful demonstration of scientific inquiry; your critics are dogmatists who I suggest display less of understanding of scientific process than you do.

[@HuygensOptics]

True. I guess when one is not allowed to question existing theories, that is the end of science.

[@Zzzooooppp]

You know they say Genius is approaching things with the curiousity of a child, but there should be a converse corollary that approaching wild phenomena with the unsurprised boredom of an old man is stupidity; if QM isn’t setting alarm bells off in your head, you aren’t actually engaging with it

[@tissuepaper9962]

@@Zzzooooppp I know this is a nitpick, please take it as a friendly correction and not an insult. I think you mean "converse", not "counter".

[@Zzzooooppp]

@@tissuepaper9962 thanks! Edited!

[@davidhand9721]

I thought like this a long while ago. Then, I learned about the Everett interpretation, and all of QM actually makes quite perfect sense. All of the jarring aspects of QM arise in the contradiction between the axioms, specifically the Schrodinger equation and the Born rule. If you just apply QM and the Schrodinger equation uniformly instead of arbitrarily asserting that the theory is somehow magically inapplicable to observers, you don't need the Born rule, and the contradiction is gone. There is only one wavefunction, a continuous set of fields with no mysterious stochastic leaps, but we, too, are embedded in it. Because of course we are.

[@48ford8n]

There are two types of people, those that don’t understand Quantum Mechanics and those that don’t realize they don’t understand Quantum Mechanics.

[@c2h5oh77]

Quantum mechanics are cat tricks

[@TheErlias]

Regarding the discussion you mentioned about the nature of light: It helped me to realize, that there is no possible way to measure the electromagnetic wave itself. In any apparatus or with any experiment, you only see the effect of the quantized particle interaction. So in a way, the electromagnetic wave is not a real physical entity that exists. It is "only" the mathematical construct that helps us calculate the probability of where to expect certain quantized particle interactions. A lot of philosophical questions regarding light then become demystified.

[@JarvisTastic]

This mindset is the only way I could reason my way through my graduate level quantum mechanics course.

[@volbla]

That's a great insight. I wonder if it's possible to devise experiments for testing light's interaction with itself. The final measurement would obviously be through matter interaction, but maybe you could predict different outcomes based on what happens before the measurement? That's if light even can interact with itself. The little squirrel in my head says no.

[@drdca8263]

@@volbla There’s the Schwinger limit. Beyond a certain energy level, QED predicts that the EM field “becomes non-linear” (quotation marks because I’ uncertain as to precisely what that means, though I have a general idea), and “light” can interact with “light”. Though, this is described as happening “because of” virtual electron positron pairs (though whether these virtual particles are ontologically real is, another question) In Maxwell’s equations, they are entirely linear, and so they predict that light cannot interact with light (because a linear combination of solutions will be a solution). The energy levels needed for light to have a non-negligible interaction with light, are, aiui, very large. Wikipedia says “In 2019, the ATLAS experiment at the LHC announced the first definitive observation of photon-photon scattering, observed in lead ion collisions that produced fields as large as 10^25 V/m, well in excess of the Schwinger limit.” Edit: I guess I should maybe mention that there isn’t like, a photon-photon direct interaction term.

[@volbla]

@@drdca8263 Cool! Though idk if that tells us anything about any wave-particle distinction.

[@martinharris540]

Great video, I look forward to part 3.

[@jupa7166]

I'm glad to be subscribed. That white light interference pattern - I've seen it in a microscopy book by professor Pluta AND with my eye in a pupil of a microscope objective with dic illumination. Fascinating!

[@ostanin_vadym]

Thank you for a very interesting video related to LIGHT.

[@carlbrenninkmeijer8925]

Thanks a lot, so fascinating and clear.

[@ghlscitel6714]

Just brilliant!

[@yoavzack]

Should you ask someone well versed in 2nd quantization of the EM field and quantum field theory (which I can't say that I am yet), they will probably say that yes, light is indeed a wave phenomenon. The quantized phenomena is a result of complex interactions between continuous fields and matter. It just so happens that the most convenient way of dealing with EM fields is to work in a basis of quantized functions which we call photons, because these "amount of field" are removed or added to the world when the field interacts with matter.

[@gingermany6223]

Another great video! As an engineer I’m usually only concerned with modeling light in a way that is “good enough” for the application at hand. For years before we got high NA imaging a lot of the simulations only assumed normal incident of light for reflectivity calculations because it was simpler to do.

[@gingermany6223]

@@schmetterling4477 haha! you probably don't want to know that LCD display alignment panels were made using cat hair brushes until recently as well!

[@Andorianin]

Очень грамотное видео, с нотками юмора, спасибо друг!

[@tjmozdzen]

Nice video. It's always nice to be able to look at things from various viewpoints to see what the elephant looks like front, side, rear, and back. Sorry about all of the critics.

[@HuygensOptics]

In fact, I don't mind the criticism at all. Because it makes me consider different angles and perspectives that I haven't thought of. I can only encourage people to give feedback, either positive or negative. Discussion is necessary for progress and I never take these things very personal.

[@harriehausenman8623]

So true. I love the elephant analogy 😄🐘

[@AdityaPatwardhanJ]

The "Couger" line was outright hilarous!

[@doctorscoot]

just prior to 21m18s, I agree with you. Quantum mechanics describes the interactions. 'Photons' are the name of the virtual particle the quantum physicists use to talk about those interactions. But it's not the only perspective; the classical continuous linear equation driven world seems to persist around us despite the efforts of the quantum supremacists (lol). The Schrödinger equation is a wave equation over time, after all, until you magically deconstruct it via 'collapse', exactly what that is or means was the type of serious question most of the grad students were discouraged to explore;;; "Copenhagen has spoken, and it's near certain career death -- adjust your priors and get on with the matrix calculus and Feynman diagrams!" Anyway no-one has quantised gravity yet so all these quantum interactions occur 'in' or 'against' the background of a 'classical' spacetime structure as described by Einstein's General Theory of Relativity. Thank you for the really interesting pair of videos (so far). Already a trio really, I went back and re-started at the 'Size of a Photon' video and have watched all three over the past day. Really appreciate your efforts; great content thanks!

[@doctorscoot]

@@schmetterling4477 well, the latter set contains the entire world's population less maybe two or three people after all! and yeah, to say, for example, oh no, there's no Copenhagen-style collapse of the wave function into one choice or the other and the wave 'really' just carries on being a Schrödinger equation-driven wave over time with all its infinitude of probability states carried within its quantum-branching Everett many worlds of mathematical purity ... isn't really any better, imho. It's quantum computing that will likely provide the first real clue, I think.

[@das250250]

You are on the right path here . Quantum mechanics will be replaced with a different understanding once time is viewed differently .

[@harriehausenman8623]

Wow. the engagement really IS strong in this one. I think you should make a whole video dedicated to creating comments 😇

[@Krzysztof_z_Bagien]

Ah, yes, the Famous Bunch Of Slits Experiment, this one never gets old :D

[@cornoc]

keep doing what you're doing boss, you make optics approachable and interesting even though it was not my favorite topic in physics class

[@cornoc]

@@schmetterling4477 you can disagree with what he's saying about the quantum nature of light but most of his videos are pretty standard optics theory, so i think you're being pretty unfair

[@catcatcatcatcatcatcatcatcatca]

I love this video! Especially the discussion at the end. I don’t study physics (only electronics), but I like the subject overall. I also like philosphy. And whenever quantum physics comes up some very existential questions seem to lurk under the surface. For example the definition of light from classical perspective is nowdays understood as something we can not interract with. So is it real? Some want to see it as just a helpful abstraction and insist the light had to behave in a manner we could have interracted with at any point if we chose to do so. What the light does when we don’t interract with it is probabilistic mostly because there is no material basis on commenting on it as something real. From this perspective the light was for the whole duration of the experiment a single photon, because thats the only kind of light we could ever truly study. Even if the mathematical model seems to act more consistently than our particles, the particles are real, and math stays as math. We could adopt a polar opposite position and see the wave-function of light like Platon saw ideas. The wavefunction is the real underlying reality, but we can only interract with it through this imperfect, quantised interraction. We seemingly can choose when we interract with the wave, but the wave acts like it already knew our choice. Maybe our free will exists in this ideal reality outside the cave, or the world is superdeterministic: either way the light from this perspective doesn’t facilitate the choices we could have made, but didn’t. From this perspective our experience of interacting through quantised events is just a shadow of the real world, and photons are the manifestation of it. They are like pixels, and while we never can see anything but pixels we can reason about what they represent. That reality is the real reality, while the world we experience is limited by many different filters: our culture, senses, past experiences and how photons are absorbed and emitted. This perspective also is very indifferent to the fact that if the light as a wavefunction was deterministic, it violates the axiom of free choice. If our experienced world isn’t the real reality, having free will on the level of particle interactions isn’t very meaningful. And in the case our world is just a shadow theathre, we can find comfort in the fact that shadows can seemingly move faster than light.

[@LowtechLLC]

Great video! Thank you!

[@cafebrasileiro]

Wonderful videos Jeroen, i'm eagerly waiting for part 3 ! :D Are you maybe planing on discussing W. E. Lamb's paper called "Anti-Photon" anytime soon? It seems to me that your video and the paper are both presenting the same perspective on light.

[@cafebrasileiro]

​@@schmetterling4477 I don't know man. Photons are significantly different from other elementary interactions. There is no such a thing as "the reference frame of a photon", relativity forbids this, also photons are not localized like electrons are (but you could say that this is the same argument). So there are some good reasons to admit that photons and matter waves are substancially different. If you take mass out of quantum mechanics then it's just regular wave mechanics... So yeah, I would argue that Lamb has a point.

[@PaulHuininken]

Fantastisch!

[@DougMayhew-ds3ug]

One other idea that is often overlooked is that perhaps time also gets stretched out or squeezed in some harmonic relation to scale, and might be different at atomic scales and smaller. It would be interesting to run different sweeps or models based on golden-section ratios to see if any phase nodes appear at those scales. One would also do the same with space, warping it along golden section ratios, trying different complementary mirror spirals reflecting the ones applied to time. Finally one could search fractal versions of the same idea, to see what pops up. The harmony of the system as a whole must be paramount, as with the solar system orbits. Treat it as a coherent system and play with these kind of variables. You are looking for modes that might trap resonant energy, based on electromagnetic parameters of free space, which might change at different scales. You might find the periodic table pop up while traveling down that road, lol. Now there’s an assignment for your graphics guy.

[@ptonpc]

Thanks for this.

[@ugarit5404]

I would look forward to you for a video about light dispersion (very underlooked fenomen from an atomic/cuantic perspective) and your view and explanation about it,chromatic aberration and maybe you could try making an achromatic doublet 1800s style,i think it could be a nice little project for you!

[@borisbritva1665]

Just found out that metalenses exist. I read a few articles, but found that nobody on KZbin made a video on them as good as you could do. This could be an interesting topic

[@mvadu]

I wish I had you as my physics professor when I studied "introduction to quantum physics" and "light propagation" some 20 years ago..

[@barefootalien]

To the best of my understanding, you are correct. Nothing in quantum mechanics is _fundamentally_ quantized. Rather, it's the _interactions_ that are (mostly) quantized. The spectrum of light is truly continuous. However, with the exception of extremely long-wavelength radio waves created by large-scale movement of objects, almost all light is emitted by _atoms._ My favorite analogy is a guitar string. By itself, the string can do whatever it wants. It can vibrate, or flop or curl around without any constraints other than its own physical properties like its length, mass, thickness, etc. But _mounted on a guitar,_ now it can (ignoring brief transients) only vibrate at a specific array of quantized frequencies determined by the tuning and which fret is being played. Light, i.e. the electromagnetic field, along with all other quantum fields, are like the string. Innately, they can take any value at any point in space. However, almost all light is emitted by atoms, which are like the guitar. They only permit the light they emit to be emitted at a specific array of quantized frequencies determined by the energy levels of the electron orbitals. This confuses _so many people,_ including many, many professional scientists, let alone people in KZbin comments. There is a general truism in science that I've come to appreciate more and more as I've gotten older and wiser: everything in science is very poorly named. It's inevitable! We name things in science _just_ after their discovery, when we haven't yet fully explored them in detail... so inevitably, we name them based on some course, poorly understood, blurry _ideas_ of the thing we're naming, and then learn a lot more about it and eventually realize how badly we did in the initial naming. Quantum mechanics is no different. The thing that lead to the discovery of our current best model of how reality works was the quanta of energy packets in the photoelectric effect, among other quantized phenomena. So we named it "quantum mechanics" after those quanta. We simply didn't realize that those quanta are generated by the _constraints_ placed on the systems that generate them. Now, a century and more later, typical people hear the name "quantum mechanics", learn of its connection to quantization, and assume that _reality itself_ is quantized, to the point that you'll hear many professional physicists talk about Planck units as if they are an inherent granularity or pixelization of the universe. It goes even further! Entire theories that are held in reasonably high regard are based in part on that misunderstanding, such as the Simulation Hypothesis! I've heard many people, including its creator, speak breathlessly about how incredible a coincidence it is that when you calculate the speed of light in terms of Planck length and Planck time, and consider Planck Volumes to be universal "voxels", lo and behold, the speed of light is one voxel per tick! My god, it must be true!! Eureka! Only... of course it is. That's what Planck units _are._ They're calculated by setting certain physical constants, such as the speed of light, equal to 1, to ease calculations. Light doesn't _just happen_ to travel at one Planck Length per Planck Time at all! Rather, the speed of light _defines_ Planck Length and Planck Time, making the Eureka moment entirely tautological and trivial. Don't listen to the naysayers. You're doing a fine job, and so far, not much you've said is impacted very much at all by quantum mechanics. Remember, folks; quantum mechanics did not _invalidate_ classical mechanics. Rather, it shows us the _boundaries_ in which classical mechanics remains valid, and can explain phenomena beyond those boundaries. The difference is subtle, but it means that as long as you're inside the bounds of its validity, as we are here, you absolutely _can_ treat and analyze light with classical wave theory.

[@TheMemesofDestruction]

Nils is Awesome! ^.^

[@RichardKinch]

Area of coherence is just another expression of the numerical aperture and wavelength like the point-spread function of an imaging system, but in a reverse model projecting a source.

[@halnineooo136]

I always had the intuition that the locality or non-locality of the observations were not about the radiation but about the interaction. Thanks

[@louismathews6831]

Fantastic thank you

[@stephanelem822]

Thank a lot for your great explanation. I think the reason why the emission absorption process is required, is when the phenomena that need to be described has a size below a size of atom or a particule. I'm mostly thinking about gamma ray, when the dimension of the system does not meet the condition of the equation of the Area of Coherence ( R >> d). I'm not a physicist, but I think in high compressed solar matter, (about 200 grammes per cm³ for our sun) , the gamma ray behaviour should require that model. The emission absorption process talks about physic of environment we are not at all familiar to live in. Your videos give me an another point of view to understand the Mössbauer spectroscopy and IRMn.

[@DiffractionLimited]

Very good explaination of the subject - I really enjoy your videos and their educational value ! I recently wrote a 2D wave simulation program for a video about fiber otptics. Its quite similar to the one you use in this video. Running on the GPU it can simulate quite large grids in reasonable time - so if you need a simulation for one of your future videos let me know. I am happy to set one up for you.

[@HuygensOptics]

Thank you, I will keep this in mind. After viewing your last video I subscribed immediately!

[@DiffractionLimited]

@@HuygensOptics Thats very welcome :) There are many interesting things to come ...

[@jaydenwilson9522]

Hey sorry to be a bother! But do you know of any code similar to yours but is 3D and can be used to generate water ripples in a simulation? I'm looking at fluid dynamic simulations for video games right now and the current standard seems majorly flawed but your simulations look extremely applicable! @@DiffractionLimited

[@DougMayhew-ds3ug]

To understand photons and electrons in the “wave packet”’sense, one needs to unfold the dynamics of the traveling wave packet, and how it holds itself together. The closest analogy from the classical world is some kind of vortex or vortex ring structure. But for energy to be trapped it must be more like having the containment travel along with it, so to speak, as if the reflector and the energy complement each other forming a unity, a quanta, like a standing wave structure. The best idea I heard on this channel is that at extreme frequencies, space itself begins to refract, and then reflect, electromagnetic energy, dependent on frequency. So in this sense we could have some kind of resonant structure as the photon or electron, where the impedance or related qualities of free space have certain ability to self-contain a packet of energy. Beyond this, perhaps there is energy being “fed in” to keep the particles energized, just as the pilot wave demo using silicone oil in a vibrating tub uses the vibrations to maintain the phenomena by offsetting losses due to friction. Ether this, or we are looking at a perfectly reflective system in photons or electrons, which does not lose energy. All of this points to the need to review all harmonic and dynamic theory to look for clues with fresh eyes. This naturally extends to the foundations of electromagnetic theory, again using fresh eyes and better than informed approaches. The outer realm relates to how action present in higher domains or dimensions may lawfully project down what we call a potential field, which is usually one side of a circular argument between potential and kinetic energy, or sometimes between electric and magnetic energy. These circular relations need to be looked at asking what higher principle might enable this kind of relation, and why it’s it this way and not some other. It’s like we climb to the top of causality, and find a circular argument, kind of a letdown. But progress teaches there are yet more secrets to be revealed when all appears oversimplified or incoherent. When trying to escape a circular argument, you have to see what is common to both poles from a higher hypothesis or viewpoint. This is what science is supposed to do, to ask what organizing principle lies outside the prescribed rules of the assumptions presently dominating the scientific lines of inquiry, and is a similar idea to bootstrapping. If leverages a new perspective to see what others missed, and to ultimately test new hypothesis.

[@dm3on]

Thank you very much!

[@miklov]

I've been asking people that talk a lot about quantum mechanics how we know that light is quantized and not just the interaction between light an matter in the detector but never got any good answer. I don't understand QM and if there is some easy to understand proof that light is discrete packets I'd like to understand that. But it doesn't make sense at all. To me the double slit experiment just shows me that there is some sort of energy threshold that needs to be overcome to create detection events which makes it appear quantized. Looking forward to more on this topic but I quite enjoy all your videos. Keep up the good work!

[@hexane360]

The double slit experiment doesn't prove that light is quantized. When you perform the double slit experiment with a particle however (like an electron), it proves that that particle can behave like a wave. You *can* measure the quantization of light, but it usually shows up in very subtle ways, like the distribution of events on a detector being correlated in time (bunching or anti-bunching). In pretty much all of regular optics, the classical theory works just as well as the quantum one.

[@volbla]

I'm not sure it's even possible to prove such a distinction. (We can't definitively "prove" anything in science, we can only be more or less certain, but that's beside the point.) In order to measure the properties of light we have to interact with it. How could we tell the difference between whether a property is intrinsic to the light or intrinsic to the interaction? Though i think the photoelectric effect make a compelling argument. If you shine a light on a charged metal plate, the elctrons will only escape if the frequency of the light is above a certain threshold. If it's below the threshold it doesn't matter how intense the light is. The energy an electron absorbs is independent of the energy content of the light beam! But if it's of a high enough frequency, the light source can be very dim and still eject electrons. It's as if the energy an electron absorbs doesn't depend on the total incoming energy, but rather the energy "density" of some indivisible packet of light. Planck calculated what that energy would need to be to give rise to the observed spectrum of thermal radiation. This is all still concerning interactions with electrons. But i wonder if it would be any easier to explain why interactions with continuous light is discrete, than it is to explain why light is discrete.

[@lambda4931]

Thank you

[@simonstrandgaard5503]

Beautiful patterns

[@mattwillis3219]

Yay pt3.!!!!

[@raguaviva]

Amazing, you are a genius!

[@dp3455]

glorious! keep doing it

[@jasperdegrood]

Geweldige video.

[@StefanHoffmann84]

The Hitachi Experiment always confused me, makes more sense now. Do not let the Pixelheads bother you! Great video!

[@wellscampbell9858]

Another great video! Thank you. I have one small issue, I have searched all over the web, and couldn’t find a single reference to a Bundesches-Schlitz experiment, or for that matter any record of a scientist named Bundesches, or Schlitz. No matter, I won’t be deterred and will continue my search! :)

[@harriehausenman8623]

Knowledge of the Bundesches-Schlitz experiment is suppressed by Big Fourier industry!!1!12 It's an intergalactic conspiracy against analog matrix multiplication! I'm not crazy. _*You* are crazy! 🤪 /s, obviously. But someone had to measure it first.

[@abrikos1100]

Actually, this classical explanation of light is essential for understanding QM, so thank you

[@ImTheReal]

Another great presentation! Thanks for sharing 🙏 Resonance is one path to reach the knowledge that you're looking for. If you do know what to search for, it makes easy to create a pattern to find it. 1:18 by example vs 1:24 - How do you figure out about the ducks if you are not aware of that presence and interactions? By a flat source like a surface of water, i guess that another scale of time should be added to equation. Sorry, maybe I just blurred your lenses 😅

[@pensiv]

The syncopated jazz at the end there really got me recasting this metaphor in musical terms.

[@HuygensOptics]

I guess it's the beat frequency.

[@RichardKinch]

Shadow bands during solar eclipses must have to do with the phenomenally changing area of coherence "A" of the sunlight, as the light source diameter "d" is changing from a wide disc to a thin crescent slit. The sun and moon become a giant Foucault knife-edge apparatus to test the uniformity of the earth's atmosphere.

[@HuygensOptics]

Interesting thought, I guess the area of coherence would go from circular to some weird-shaped long ellipse.

[@harriehausenman8623]

🤔