Pfizer is 'deeply sorry'

Pfizer, bringing discredit to pharmaceutical industry
www.pmcpa.org.uk/media/cwvkqv...
www.telegraph.co.uk/news/2024...
Senior executives used social media to promote an “unlicensed” Covid vaccine.
Pfizer found to have breached the regulatory code five times,
Prescription Medicines Code of Practice Authority (PMCPA)
Pharmaceutical watchdog,
relates to a complaint about a message posted on twitter
November 2020 by senior Pfizer employees.
COMPLAINT
the complainant alleged that it turned out that such misbehaviour was even more widespread than they had thought, extended right to the top of their UK operation and was apparently continuing to this very day.
PANEL RULING
The Panel noted Pfizer’s submission that on further investigation into this complaint four other Pfizer UK colleagues, including another senior colleague in the UK organisation, had re-tweeted the same post.
The Panel queried whether a social media platform, such as Twitter was the appropriate forum to share such information.
The Panel noted the tweet contained limited information regarding the efficacy of the vaccine candidate with no safety information provided.
On the balance of probabilities, it was likely that the Pfizer UK employee’s connections would include UK members of the public as well as UK health professionals.
The Panel noted that the tweet clearly referred to the outcome of the Pfizer and BioNTech’s vaccine being developed to protect against COVID-19.
The Panel noted that Clause 3.1 prohibited the promotion of a medicine prior to the grant of its marketing authorisation.
They must not mislead either directly or by implication, by distortion, exaggeration or undue emphasis. Material must be sufficiently complete to enable the recipient to form their own opinion of the therapeutic value of the medicine.
It must not be stated that a product has no adverse reactions, toxic hazards or risks of addiction or dependency. The Panel noted the tweet made no reference to adverse events and was therefore concerned that important safety information relating to the vaccine candidate was not provided and ruled a breach of Clause 7.9 of the 2019 Code as acknowledged by Pfizer.
The Panel noted Pfizer stated that the senior employee whose re-tweet was the subject of this complaint had completed the social media training module in October 2019.
Activity which was clearly outside of company policy had not been taken down or deleted.
‘Unlicensed medicine proactively disseminated’
“unlicensed medicine being proactively disseminated on Twitter to health professions and members of the public in the UK”.
Pfizer UK spokesman
“fully recognises and accepts the issues highlighted by this PMCPA ruling”,
“deeply sorry”.
Pfizer
‘Accidental and unintentional’
Sixth time Pfizer has been reprimanded by the regulator over its promotion of the Covid-19 vaccine.
Ben Kingsley, UsForThem
“It’s astonishing how many times Pfizer’s senior executives have been found guilty of serious regulatory offences - in this case including the most serious offence of all under the UK Code of Practice.
“Yet the consequences for Pfizer and the individuals concerned continue to be derisory. This hopeless system of regulation for a multi-billion dollar life and death industry has become a sham, in dire need of reform.”

[@antheablackmore5838]

Deeply sorry, deeply sinister and they should be deeply in jail

[@kehreyannedean6315]

🎯🎯🎯

[@Crazycatlady1968.]

AMEN.UNDER IT.❤❤

[@suzyvivian7514]

Absolutely

[@OhSoddit]

6 feet deeply :)

[@suetipping4841]

Amen. Pray for Nuremberg Trials.

[@positivityleads2success]

Don’t forget Bill Gate who funded, promoted and made Billions of dollars off of it!

[@darrelltregear756]

And all your favourite celebrities

[@tobywinter1]

Yes NEVER forget.

[@tolukayode9487]

Big money and deep state rule the Western world 😢😢😢

[@AnAn-xp8xu]

Juist Dat is een grote schoft en geldwolf

[@7owlfthr]

NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.

[@GU__NI]

Deply sorry, it would be laughable if it wasn't so sad.

[@sallymerrell4491]

The only thing they are "deeply sorry" for is that they got caught.

[@BabyGirl-yf6ss]

I feel like they were dissatisfied with the outcome. Wanted more victims

[@words-island1011]

😂😂 don't worry some may still want to be subjects

[@evapinter6384]

They didn't get caught the NHS still advertising as safe. It is really making me angry.

[@stephenzimmerman5517]

They no longer care because they are not going to be held accountable. They believe that they are untouchable because they now control the DOJ and the FBI.

[@JaneJones-lg3bd]

Anyone who has researched the legal history of Pfizer, will see that they are anything but trustworthy. I am so glad that I did that in the beginning. The largest damage settlement in history was levied against Pfizer for false advertising of one of their drugs.

[@workaholic5318]

Pfizer is "deeply sorry". Not yet... Let's not forget that virtually every western government was complicit in this.

[@marleneholloway7775]

Australia certainly was a lot of crooks here.

[@StirlingLighthouse]

Canada 🇨🇦 too. All should be held responsible.

[@sneezyfido]

WHO

[@sargentpepper8931]

Because they were paid

[@laurafulton7023]

@StirlingLighthouse You mean Post National Canada comrade

[@sylviaduffin4812]

Why is this drug still being pushed on vulnerable patients then???? Government and NHS guilty of criminal acts

[@debpratt52]

Very sad.

[@kitoharveywill5766]

To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.

[@phillipsmiley5930]

see Hugo talks: Spanish Flu Bolshevik Revolution HISTORY REPEATING?

[@7owlfthr]

They push it period. Signs in "doctors'" offices, pharmacies. "Get your free covid shot here". They really think we're that stupid. INSULTING!

[@whojanson6751]

Slowly... the people starting to realize what the pharmaceutical industry and the governments ACTUALLY is about. In reality.

[@michelled1475]

Deeply sorry enough to forfeit all their assets, and go to jail?

[@AdriOnFilms]

👏👍

[@gabrieldaniels6191]

Ahh…. No!!! But they owe me nothing as I never took it. I knew it was some bull💩 from the beginning 🤷🏿

[@troubleshooter166]

But there were people, such as nurses and teachers who had to lose their jobs because of the vaccine

[@peterborelli3877]

No one goes to jail. Please read my other post about Pfizer.

[@mariesi85]

Jail isnt adequate punishment for the millions of people that were killed and others who are permanently disabled. and suffering.

[@dawndoughty2170]

" I'm sorry" while rolling around in their billions!

[@laurenced2916]

Deeply guilty of mass murder

[@dicktracy3787]

hear hear

[@Plisken65]

But who ordered it? Adolf Schwaab?

[@1cyanideghost]

My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+. He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.

[@laurenced2916]

@@Plisken65 One of that lot

[@virginiemasai9024]

They feel no guilt, fhey are evil

[@johnd9024]

Crimes against humanity! Jail time!

[@sosogreen345]

Deeply sorry they were exposed !

[@shioq.]

corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.

[@firetruck988]

Don't be anti-Semitic.

You've got to prove it in a court of law first. And remember the manufacturers have legal indemnity.

[@mariocooldude9092]

CEO of Pfizer is ✡️....CDC director is ✡️...COVID Czar was ✡️... coincidence 🤔???

[@hansa6153]

It’s also so shameful that the politicians in Britain would not listen to Andrew Bridgen. He was trying to save lives.

[@johndalzell904]

I agree. There was only a handful in parliament to attend and give support to Andrew Bridgen's session. They want to distance themselves from any personal responsibility in pushing these terrible products. They think the best strategy is to hide behind a wall of silence, but finally after 4 long years of lies and severe punishment for dissidents, the truth is coming out. And now even watchdogs feel emboldened enough to start criticising. Long may this continue.

[@ruthfullmer3317]

I will never believe they are deeply sorry. They are a joke and a disgrace

[@svenp6504]

A corporation isn't a human. It can't be 'sorry' any more than fire can be.

[@stephenking4170]

Crocodile tears . It's just dancing on the graves of those who succumbed to their "medicine". There were two in my small community that I know of.

[@jharvey9898]

Deeply sorry, yeah after they were exposed. They should all be in jail.

[@user-vs6xj2qe2g]

that's anti-semitic

[@mimikhan9546]

@@user-vs6xj2qe2g Lol.

[@colty7764]

they supported pseudo-science while suppressing (with a lot of help) real evidence based science

[@kehreyannedean6315]

🎯🎯🎯

[@moeiscool]

worse. history hasn't been happy with them multiple times. they were expelled over 100 times from almost every nation for behaviour like this.

[@leegary3941]

If they're so deeply sorry, the mRNA crap should be pulled from the shelves. Stop pushing it on people. 😡

[@Freedom-8910]

AND CHILDREN 🤬

[@jared1512]

Still mandated in USA for medical staffs!

[@whorn9295]

​@@jared1512insanity at its finest

[@Claire-sj9mp]

@@Freedom-8910 it's in all the chdhood vaccines..all mrna

[@maryhall3722]

What? And waste even more of the taxpayer's money? On top of all the backhanded to Boris's mates for out of date PPE.

[@Helena_USA]

First time here and glad to say I'm 67 years old (feeling like 45) and I refused to take the sting 🐝

[@capnphuktard5445]

They still put me in jail in Illinois for protesting against them giving it to children...Where's my apology?

[@lovetruth5518]

👏🏼👏🏼👏🏼👏🏼I BLESS YOU IN THE NAME OF JESUS CHRIST OF NAZARETH! You will be noticed in heaven mate.💝🙏

[@Hollyucinogen]

I was in a care home and they took away all of my clothes and wouldn't let me shower for 4 days because I refused to get a 3rd vaccine. In the province next to mine (Québec), a bunch of people died because they lived in care homes that were locked down for 2 years. Where are our apologies? 🤔

[@hibbo1351]

You don't get an apology. It's going to be okay though. When am I supposed to drop dead from the vaccine that I took

[@hibbo1351]

​@@lovetruth5518lol you sound like someone who was religiously indoctrinated by your parents moments after you emerged from the womb

[@sean-bz7gw]

I worked in construction in helathcare.. got t hurt at work and then fired for no vaccine lost everything I had and got nothing. Went from hero to zero! Wheres my apology!

[@veronicat6031]

The only thing they're "deeply sorry for is they got caught. 😡

[@Mosegaard1976]

Exactly!

[@roksannastephens4375]

ABSOLUTELY!!!!!

[@athelwulfgalland]

Precisely.

[@Ac0ustics0ul]

How exactly did they not expect this very obvious and recent trail to be traced?

[@batchimegdamdindorj8557]

Fortunately truth catches up sometimes it just takes a bit of time

[@davidhamtaro]

Not promoting unlicensed medicine. MANDATING unlicensed medicine.

[@marjengle1150]

That is absolutely right!!!

[@happyrecluse2849]

And here in Chanada we have the persecuted Convoy Truckers to prove it.

[@j_3.16]

Yes!

[@ruthellenhudson9270]

Yup. I was mandated.

[@CK-vp6hh]

I agree with you but they didn’t actually mandate- our government did. And they need to be held as complicit in this.

[@AndrewGeerlings]

Deeply sorry. Sure. Not of the many many Billions of US$ they made.

[@dionechanslor1147]

Sorry they got caught.

[@neon7710]

It's not about money. Plp don't get it

[@neon7710]

It's about culling. H.Kissenger's paper in 1973 reveals all.

[@TJB-zt9tx]

They should be deeply sued.

[@HS-cf8lz]

Start petition please. Defund them

[@Hollyucinogen]

In my country (Canada), people have already successfully sued them to the tune of nearly $2.8 million since they started accepting claims in June 2021. It is possible.

[@MrDoboz]

@@Hollyucinogen pocket change

[@Hollyucinogen]

@@MrDoboz Yeah, some of the people who sued are now permanently disabled (i.e., Guillan-Barré syndrome, Bell's Palsy, chronic fatigue syndrome, small fiber neuropathy, blood clots in the brain, etc) and can no longer work.

[@britt6579]

Dont forget the doctors who were fired for not complying with their criminal acts.

[@Opinlinz]

Don't forget the doctors who promoted it and pushed it onto people

[@grantperkins368]

Both. The underlying nexus between the WHO (not the band), Gates, Fauci, Pfizerman and his squeeze, the Biden Crime Syndicate and the Pfizer funded media,needs total reconsideration in the light of recent events. It boils down to: Drugs for what? For health? Or for profit?

[@gailny]

I hope the doctors sue them

[@lsmith495]

I was forced to leave my job of 22 years 😡

[@pugsymalone6539]

​@lsmith495 if you left your job, but still have a clean bloodstream, then you can rest easy. You will be a survivor, while the righteously indignant will all be gone soon, if not already.

[@markzbikowski4397]

So remember when Bill Gates said we need to de-populate? 🤔

[@pennykoncz9683]

Bill Gates roots run DEEP on population control! His father was the head of Planned Parenthood. Population control has been an enduring preoccupation of Gates philanthropy since the BEGINNING.

[@buffaloguts3459]

And they said on a stage they needed a pandemic to get mRNA into everyone.

[@notimportant3820]

Yeah, on a Ted talk even. Right out there for all the carbon he wants to eliminate to watch. I don't and won't trust his fake "meat" either.

[@mikemichaels2914]

Whats that got 2 do with the price of Computers

[@garremannen]

Remember that the Bill and Melinda Gates foundation was originally called B and M G foundation for population control?

[@Julie-ub1zi]

Not sorry enough to call for a stop to the insanity.

[@user-qp3wt5qe9g]

Deeply sorry - that is what we are. They need to be charged with crimes against humanity.

[@rosebud2222]

Sorry won't save those that planned that mass Genocide,they know who you are where you are and what you did,all those that pushed and administered the bio vax will be tried and executed for crimes against humanity,many have already been dealt with,this included our corrupt Governments WHO EU UN NATO & Doctors & Nurses. Military have been activate camps are prepared & ready.

[@kilnmaster]

And the "drug pushers", Fauci for sure and all the country leaders who forced us to either take the shot or not travel.

[@HS-cf8lz]

Start petition please.

[@wecanonlywish9194]

And it doesn't even mention the heavily political involvement. Pfizer can just say sorry, while pocketing upwards of TWENTY+BILLION dollars.

[@DARANGULAFILM]

The old-old story that sorry costs nothing.

[@TheDextermat]

Blood on their hands, billions in profit made on human suffering and unsafe trials on human. Apology not accepted, get fined and jail! They are criminals! Thank you for exposing these corrupted hypocrites.

[@soulwarrior7721]

Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it. This wasnt just 1 company doing this..

[@LTPottenger]

Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs. Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells. Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin! Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm. Fasts from 36-96 h increase metabolic rate due to norepinephrine release! Clots and plaques are removed over time due to accelerated phsocytosis. Fasting improves your circadian rhythm to normal over time. Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body. T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself! Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools. Fasting can help with MS, Depression, BPD, Autism and seizures. When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate. The hunger hormone ghrelin also lowers with extended fasting and rises from dieting. What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting. Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building. Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses. Lowering insulin via fasting virtually eliminates chronic inflammation in the body. Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue! Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women. It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention! 24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function. Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized. Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids. Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers. When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with. Fasting increases telomere length, negating some of the effects of aging at a cellular level. When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer. A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs. Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting! Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits. Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice. Resources: www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/ www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/ www.sciencedirect.com/science/article/pii/S0005272806000223 www.clinicaltrials.gov/ct2/show/NCT04375657 www.nejm.org/doi/full/10.1056/NEJMc2001176 pubmed.ncbi.nlm.nih.gov/31877297/ www.ncbi.nlm.nih.gov/gene/25712 pubmed.ncbi.nlm.nih.gov/20921964/ pubmed.ncbi.nlm.nih.gov/29727683/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/ pubmed.ncbi.nlm.nih.gov/33530881/ www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf pubmed.ncbi.nlm.nih.gov/27569118/ www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7 clinical.diabetesjournals.org/content/36/3/217 www.ncbi.nlm.nih.gov/pubmed/23876457 www.sciencedirect.com/science/article/pii/S1931312809002832 pubmed.ncbi.nlm.nih.gov/15522942/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/ www.ncbi.nlm.nih.gov/pubmed/10859646 www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/ www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue pubmed.ncbi.nlm.nih.gov/28235195/ www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/ www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html www.cell.com/cell/fulltext/S0092-8674(19)30849-9 onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x pubmed.ncbi.nlm.nih.gov/25909219/ repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/ academic.oup.com/ajcn/article/81/1/69/4607679 www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/ pubmed.ncbi.nlm.nih.gov/7714088/ www.nejm.org/doi/full/10.1056/NEJMoa012908 pubmed.ncbi.nlm.nih.gov/23707514/ pubmed.ncbi.nlm.nih.gov/23408502/ faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10 www.biorxiv.org/node/93305.full www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart pubmed.ncbi.nlm.nih.gov/20102774/ n.neurology.org/content/88/16_Supplement/P3.090 pubmed.ncbi.nlm.nih.gov/6859089/ www.ncbi.nlm.nih.gov/pubmed/10232622 www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/ www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/ europepmc.org/article/MED/22402737?javascript_support=no pubmed.ncbi.nlm.nih.gov/2518860/ www.ncbi.nlm.nih.gov/pubmed/24905167 www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/ pubmed.ncbi.nlm.nih.gov/31890243/ www.ncbi.nlm.nih.gov/pubmed/25686106 pubmed.ncbi.nlm.nih.gov/21410865/ This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed! My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.

[@saraandivanevans6881]

Money, money, money

[@bonsense7004]

And not for the first time. Look at all the pharmacorporations that have already been sued. Pharma and chemics aren't the most trustworthy companies..

[@runee60]

Absolutely.

[@Milestonemonger]

The politicians who forced us to jab and quarantine or face jail time must also be punished.

[@mickzed6746]

Gallows

[@johnpenguinthe3rd13]

Don't forget to include the businesses and bosses who coerced employees into getting it or they were fired. They need to be put on trial as well.

[@michellefernandez6920]

Give them all the vaccine and every booster. They’re safe, right? Why not?

[@carouselcakes6237]

Nobody was forced in the Uk. However if you’re elsewhere you have my deepest sympathy.

[@jodiekohut9443]

And employers

[@RhiannonRaven]

Andrew Bridgen is a hero and so is Dr. John Campbell. The fact that he is the only member of parliament, the so called representatives of the British people, standing up and saying what should have been said by all of them long ago, tells is everything we need to know about the state of British politics. Shame on them. Truth will out.

[@heidichristine2691]

Deeply sorry. Deeply sorry they are now exposed!!

[@HS-cf8lz]

Start petition please. Defund them

[@Chuck_W59]

Apology NOT accepted. Go directly to jail.. do not pass go.. do not collect another dime!

[@PB4U]

They are NOT sorry.

[@reneschellevis7897]

Sorry, as in wiping their tears with dollar bills ?

[@SALTYCOMBATDIVER-ExInstructor]

Not sorry enough. They can be sorry, but unless they are held accountable they will do it again and 'feel sorry' while being richer.

[@pinoygal6232]

"And they would not repent of their pharmakea"

[@jbartmontage6737]

Fake wars, fake vaccines, fake sugar, fake people - it´s everywhere....

[@ruspagamer7248]

Of course not. They knew this would happen, but you know, you can't just say "Haha in your ass" to the public

[@Collette1968]

If we do something wrong, we get consequences .yet they don't, we need to see justice for all who passed away including my Dad

[@Maria-qn6fe]

May Devine justice prevail for all parties involved and the victims

[@mpat100]

divine justice

[@debbieclougherty3171]

Sorry my arse!! The NHS are still offering it to pregnant women!! 🤬🤬

[@VL-qy4fc]

It's madness, isn't it! Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.

[@Elleliza3501]

It's maddening!!!!

[@carmeez424]

Same in the states.

[@bridiesmith5110]

And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.

[@thefloatingapothecaryroman16]

​@@VL-qy4fcyep, but ok to vape

[@holidayhouse03]

Millions of Dead Billions of Wounded Trillions of Profit

[@michelleduncan9965]

Well said & spot on holiday.

[@thominaduncanson7596]

Met all the goals.

[@TransitionedToAShark]

@@thominaduncanson7596billions is the goal

[@lisavanoni6552]

Where is Gates, Tech execs, Mockingbird media, and WHO loud mouths!

[@jamesrussel1133]

And that’s just the result of Johns misinformation and anti vax grifting, Lol

[@xrpbuzzlightyear8595]

Shoutout to all of us who refused to be an experiment. We won’t fold under pressure!!!

[@SandyOhNo]

Unfortunately, some of us would've lost our jobs and profession in heakthcare if we didn't take the 1st, 2nd, and 3rd vaccine. Thank goodness I dinner have any adverse reactions.

[@patriot6285]

@@SandyOhNo Wrong viewpoint, there will be long term consequences.

[@-_Blitz_-]

@@patriot6285prove it

[@erwee7329]

He who wants to be deceived let them be...

[@ShaquilleOatmeal730]

​@@SandyOhNoand. You chose money over health.

[@speakingmymind9583]

Guilty of crimes against humanity

[@David-uf8ex]

Where is Johnson where is Hancock and Blair ? They constantly pushed this junk

[@joetodd4351]

The drug companies will be the fall guys. My research has shown me that it was made to order..

[@cremvirus]

​@@joetodd4351 it was made pre covid

[@laurapearson3370]

But so did John , even urging pregnant women to take it

[@robbeales5516]

It matches their brains 🧠

[@DevineOne]

Money can make people do anything. When they have no conscious

[@TheGoul29]

Sorry for making billions of $ while ruining millions of lifes. This is just routine for them...

[@virginiacreager4331]

I thought making money is always supposed to be more important than saving lives right …?

[@sherylpayne5851]

So sorry you can't get an organ transplant unless you're "current ". So sorry it's part of the childhood immunization series. So sorry they're developing a self-replicating version for future " pandemics." So sorry they are now profiting off of the people who are now seriously ill. When are all madantes revoked?

[@BlackMan614]

That's the problem. The dopes didn't make billions. The blew it. All of it. Their stock is in the tank (been there for over a year) and have NO promising drugs in the pipeline. Disgraceful. In a normal capitalist market they would be bankrupt.

[@helentc]

Unfortunately I think this is true

[@seimela]

No one will be arrested for all this ..none of the involved parties will

[@Strepite]

Yep because we are living in a nightmare world ruled by those people

[@veramae4098]

Corporations are people. Yeah.

[@Mrch33ky]

I work at a health care company in the US and we were required to get the jab to keep our jobs. Since then I have learned there has been a wave of strokes among our work force and many have retired on disability or just retired altogether. I had to take 3 months off on medical leave myself (age 55 robustly healthy) but no blood clots or strokes affected me, just intense brain fog and body fatigue. Keep up the excellent presentations Dr. Campbell. :)

[@geoffroberts1131]

We weren't just advised to take it. We were threatened and shamed into taking it.

[@1cyanideghost]

People lost jobs, bank accounts and more.

[@laino_a]

Others were not vaccinated but were still poisoned. It seems like the flu but it is not.

[@tobywinter1]

Those of us who wanted or needed to trade were FORCED to take it.

[@EyesWideOpen...3.16]

I lost everything, career of 23 years in health and social care, sacked after working through it all and not given a s**t about, everyone had a choice, you either had a backbone and said ‘no’ v simple or succumbed to the absolutely ridiculous amount of pressures and propaganda and brainwashing from every angle, I was even called a murderer after looking after the most vulnerable in society for over 2 decades, trust in any government or medical industry and many others infact are dead, done, over, as if they weren’t to be trusted in the first place……….yr health and wellbeing and morals and integrity are priceless, obviously many live in the controlled society built around them, that’s on them……

[@lizbuckland4163]

I was told that I wouldn't be able to get my suprapubic catheter changed if I didn't have the vaccines. They had already erased my care plan once and left me with no care at all.. I have to have a potent bladder washout every week and my catheter changed every 6wks, sometimes sooner if I have an infection, all at home by district nurse. For the first 3 months I was left with nothing. I cannot do it myself due to the after effects of a small stroke in Dec 2019. That and Neuropathy (due to over 20 years of Ciprofloxacin use for kidney infections as I have complex kidney and bladder issues). The combination makes it hard to use my hands and I physically cannot do it myself. Since the vaccines I have had 2 more small or mini strokes and the Neuropathy has caused a torn rotator cuff tendon in my shoulder, affecting my hand. I already had high BP and intermittent arrhythmias, since the vaccines these have got considerably worse with exhaustion, repeated arrhythmias going on for much longer episodes, breathlessness when talking, my sats go down to 70/75 when talking so big difference. This then leads to dizziness and falls etc due to lack of blood oxygen... I wish I had never had these damn vaccines, but I would have lost all my NHS care yet again if I had. Luckily we refused them for our daughter as by then the side effects were becoming known.

[@DurzoBlunts]

Boycott pfizer and moderna

[@lisac1619]

​@@TORY-BLUEBot

[@kylegrace4718]

@@lisac1619 he is in survival mode.... probably spent his career in the sciences or pharmaceutical fields. his belief is crashing down but his arrogance and stubbornness is all he has left to cling to.... hopefully they will get a vaccine soon to help people like him/her ;)

[@reedrichards1820]

our governments certainly don't want to, unless a tony blaire figure pops out, demanding lawsuits for those who have gotten hurt or worst.

[@xjmg007]

It is almost impossible to boycott them. They produce chemicals used by almost every industry.

[@Noqtis]

@@kylegrace4718 They made one. It's not helping him but its helping us getting rid of him. Not many left like him so its working quite fine.

[@johnj1602]

They have gotten rich. No longer afraid to admit anything.

[@emilymcfadden4360]

Excellent expose on Pzier Doctor. Bravo's from Oregon USA

[@geevesnc3008]

Why would ANYONE trust the Pharmaceutical Industry. Seriously- wake up.

[@lorrainewarmington5121]

​@@TORY-BLUEbye bye bot!!!

[@iainbaker2742]

​@TORY-BLUE prove it, or it never happened........

[@pastandcurrent]

@@TORY-BLUE you are so 2020 lol

[@lisac1619]

​@@TORY-BLUEGo get more boosters. You can have my share.

[@EyesWideOpen...3.16]

@@TORY-BLUE What number you on? 8? 9? Yeah they work so well, it’s not a vaccination either, yr a liar 🤥

[@kevinjhonson5925]

I’m deeply sorry I listened to the So called experts and got the jab so I could keep my job. I’m deeply sorry that I had to tell my daughter that I have stage 4 lymphoma. I’m deeply sorry for the hell my family went through because of my cancer when i spent 43 days in hospital 12 of them in ICU on a ventalator. But all is ok because Pfizer is sorry

[@robertadowns217]

So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!

[@robertadowns217]

So sorry Kevin! I tried to warn all on this podcast, until Dr Campbell did the research...

[@robertadowns217]

So sorry Kevin! My reply keeps getting deleted??

[@nasserlondon12]

I am so sorry to hear your story. So many people are in your situation and it's so unfair.

[@heidiwestgate7045]

I will pray for you and your family.

[@Saadiqa1]

👏👏👏👏👏 Thank for sharing and exposing those cirminals

[@sweetiepie7396]

Thank you Dr Campbell for all you do

[@christopherjames1453]

Millions dead, millions more possibly injured, no single person yet held accountable.

[@woofwoof9647]

17 million an climbing 😢

[@1cyanideghost]

My dad and some elements of our family died to this. Dad took Pfizer, then started manifesting symptoms, got a heart attack then clotting and multiple organ failure. He was a very healthy man!

[@gwenechotaylor96]

not yet anyway. I will weep with joy on that day of accountability or public apology.

[@almafrith778]

@@1cyanideghost Sorry to hear about your Dad. 🙏🏼 Most of us won’t forgive or forget the crime against humanity.

[@fuddyduddyhorsemanship]

@@1cyanideghostsorry to hear it. My husband was diagnosed with cancer after the Pfizer booster. He is still around though.

[@itsrudiano]

"An apology without a change in behaviour is just manipulation "

[@rebeccadunehew8768]

Well said.

[@jacoblewis2961]

🎯🎯🎯

[@sgreen9088]

Financial change behavior to those who took it

[@rawgarlic9234]

How sorry is Campbell?

[@lorrainepec7577]

....While they prepare for disease X. Yup, Yup Yup!

[@Republic4ever714]

Doesn’t bring my friends and families back being sorry doesn’t cut it!! 😢

[@prunabluepepper]

Being deeply sorry is an admission of guilt.

[@jasmin5753]

If they are deeply sorry.. then they are admitting that their vaccines were unsafe. There should now be a class action lawsuit launched against them.

[@sarahwalkerbeach6985]

Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.

[@thedevilsadvocate5210]

no they are only sorry they promoted the jab before it was allowed to be promoted

[@Madonnalitta1]

It was about misleading on social media, that's probably as good as we're going to get.

[@flourfree2K]

Janine Small admitted it publicly in front of the EU Parliament.

[@sarahwalkerbeach6985]

😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.

[@botfantasies6229]

1. Live a healthy life 2. Stop buying their junk 3. Put them out of business

[@user-uo3ek2dk7s]

join class action for opiate crisis

[@miguel-jesus]

Whenever possible, I will ask for generic or alternative.

[@botfantasies6229]

@@miguel-jesus what junk of theirs do you need?

[@miguel-jesus]

@@botfantasies6229 For my prescribed meds, I am know choosing another store.

[@Shredder858]

Cue the turbo cancer medication

[@Unapologetically40]

So so glad that I did not waver and trusted my discernment.

[@fredfloyd34]

Dr.C....Your sense of humour is fab...wished you would of been my physician growing up.Carry on....

[@heathtich3]

“Deeply Sorry” for me having to quit my nursing job because of horrific adverse side effects from 2 jabs that were mandated. I had to have a major surgery from the damage. “Sorry” doesn’t cut it for all of us that were damaged and all the families dealing with losses and illness from something that was supposed to protect us!!!! I have zero faith in pharmaceutical companies! Absolute crimes against humanity!!! This plandemic and all the criminals need to be exposed!

[@trishalee3198]

So sorry for all you suffered due to this mandate, and I wish you well from this point forward. May we all be healed from this madness.

[@kawataufik5098]

Nurse and doctors guilty plus anyone had power boss in factory leader in hospital bla bla

[@pigmeal2224]

I left my nursing profession of 20 years rather than take something my clinical judgement could not possibly endorse or allow. Thank god I had a plan B. I view my complying colleagues as a collective of cowards though. Their clinical judgement would have been no different from mine, and had we as a collective stood our ground the madness would have been stopped in its tracks. That day. So yes I feel for you ... but there must be some acceptance of complicity ... like it or not ... 🌹🌹

[@leesaunders1930]

What kind of surgery did you have, if you don't mind me asking?

[@jcutler1018]

I hope that you can recover.

[@adavies1752]

All involved should be sent to prison for 6 billion years

[@karlg2950]

That means they will get out , Sorry no Amnesty this time!

[@hotarobin1]

@@karlg2950 they will...just not in this realm of their existence..

[@Emily-pm5gr]

Probably somewhere around 1/3 of humanity

[@sunway1374]

The senior executives are probably people with business degrees. With little understanding or no backgrounds in epidemiology, vaccines, human biology, statistics, clinical and non-clinical trials, etc. You let people like that run a high-tech, scientific or engineering company, you would get bad outcomes. Just ask Boeing.

[@terryfoster1706]

Including the government and scientists who were on tv every evening.

[@flyingfox7252]

Dr. John I doubt they care - it’s all about profit and deceit

[@raywaller5905]

Thank you for all work Dr John Campbell RW

[@ThomasKing19933]

As much as I'm relieved that I never had the 'Jab', I still worry about the people who fell for the lie. (especially family members)

[@bustjanzupan1074]

Eeeeeeexxxxxxxaaaaaaaccccccctttttttlllllllyyyyyyy !!! ! !!!

[@Oiledballs-wu1cm]

I don't I have no sympathy whatsoever

[@DonaldMerrit]

Yes everybody who took the Pokie is somebody's family member

[@tinasturgeon7087]

Me too, family and friends

[@alanlafromboise3156]

Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!

[@chewy66]

I am deeply sorry I took the Jab. Pfizer should not only be sorry, but they should be in jail.

[@susanmurray7654]

I feel bad for you too. You might escape the consequences though. There are those who do, for sure.

[@britgal3836]

Me too!

[@LizzLunney]

SAME

[@DesertlizzyThe]

Yes. Like who's the boss? The CEO CFO Chief in Charge all shd be more than hand slapped. But we know money talks & they will walk.

[@ruth.greening]

I am trying to tell you that there is a internet page with protocols. Done by frontF lineL covidC criticalC careC doctors. Keeps getting scrubbed off. Wonder why Dr John Campbell is not talking about it?

[@pauljosephsoh1732]

Can someone take them to court? Sue them for a million pounds?

[@annikabjornson998]

Hundreds of millions.

[@graverobber135]

I like how he made his own document with the script of what he’ll point at and underline with a pen to make the document in front of him appear to be more legitimate than it is, which is simply a document he create in order to essentially chew the food for his fans. There’s a reason why investigations and studies are made public when they are, and there’s a reason they get misinterpreted/manipulated by people (news outlets mostly) so often. It’s because the basic ability to read doesn’t gift you the ability to understand what you read the way it’s meant to be and instead unprofessionals spin their own interpretation to validate an already established belief system. As another person pointed out already, interesting that this “document” has grammar issues.

[@djchewmacca]

So glad I stood my ground even though I was accused of being selfish.

[@JohnMartinez-is9ov]

I was fired became homeless. Newsom never helped me. They said they couldn't get me a bed for 9 months. Just survive in the elements however you can until then.

[@DebraCollins-fq4jo]

Or the smirky comment from complacent family members, "OH, you're one of those people". Smhhh

[@essie9500]

Exactly, and that they made us feel like we were carrying the germs

[@djchewmacca]

Fortunately all my immediate family didn't fall for the hype either.​@@DebraCollins-fq4jo

[@nickieglazer7065]

​@@JohnMartinez-is9ovRespect to you ✊

[@cory9189]

GET IT OFF THE CHILD VAX SCHEDULE!

[@debbie189]

I agree but what scares me is other vaccines are being done with the mrna there not safe either

[@nancywatkins5836]

Get off the child vax schedule entirely. They’re about to make all vaccines mrna

[@marjengle1150]

Most definitely!!!

[@adelepratter1156]

Exactly its so dangerous

[@aylaw5459]

Why in the world would they do that when it guarantees a future sick population that will bring them in money. Absolutely appalling… no child or adult needs this poison

[@user-fw3hc7cr2b]

For ovarian cancer, the number of deaths was about 7.6% higher than expected in 2021 and increased to 9.7% higher in 2022. Leukemia, prostate cancer, lip/oral/pharyngeal cancer, and pancreatic cancer also saw increases, with leukemia deaths 8% higher than expected in 2022 and similar rises in the other types.

[@dreadpirates_]

They went full BP Oil after the gulf disaster. No one was jailed for that either. And probably not for boeing either. Wish I made enough money to be above the law too

[@haileysmom2358]

Deeply sorry means nothing to those that have had their lives destroyed and the families that lost loved ones. Pfizer should be paying reparations to all those affected.

Deeply sorry means nothing to the pharmaceutical group either.

[@davidslater9297]

Davo here from sunny beautiful Australia. I want more people to become aware of the three words I learnt during the covid fiasco. PERFIDIOUS. ASSININE. Non SEQUITUR. Check the definitions,and lock them in ready for the next bit of BS you hear from government,the media,big pharma or your "doctor" 😊.

[@royferguson2297]

Pfizer can't be sued the Governments of the World gave them immunity. People en mass who got jabbed should be suing the Government.

[@ralphp3057]

@@royferguson2297 You are correct! But , sue the government? Good luck with that .😬

[@LadyBug1967]

Words r cheap especially words of liars n thieves

[@LG-jg8vy]

Pfrizer lied, And yet we still have the Covid-19 vaccine information from the NHS tag on this video!

[@truthandrighteousness]

Sorry won't take back the harm, it's useless!!

[@nid4za]

They're deeply sorry... that they got caught

[@saxmusicmail]

Don't forget all the politicians and bureaucrats who participated in this. They are equally guilty.

[@LoveZelda3]

And the media!

[@cherrybouris845]

They were all in it for benefits in one way or another. Shocking where is for the goodness of our fellow man.

[@cosmokramer3107]

And why now, after they all entered in a Faustian bargain, they will do everything to cover all their arses. Not one of them has a shred of moral responsibility left.

[@Redfeather80]

Nobody will be held accountable. Nobody in the Epstein/maxwell case. She’s probably in a mansion off a lavish coast. Diddy won’t be held accountable. Pfizer will not be held accountable and neither will Fauci. We’re merely tax paying slaves. Voting isn’t real.

[@classicrocklover5615]

They all probably had stock in big pharma

[@yvonneiversen8749]

Deeply sorry? For what has happened as a result of their abuse of drugs, they should be banned from ever distributing drugs again!

[@sharonjensen3016]

They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!

[@lindathompson4770]

Can we assume the same applies to the US and the rest of the world???

[@terrywereb7639]

Not just distributing, but developing!

[@iSheree]

The problem is, some medication can only be gotten from this company. If we ban them, lots of people will suffer or even die.

[@James-gf9jl]

Should be deeply in jail.

[@user-es8nl1nr1b]

Great to see you in my part of the world. Greetings from Perth Western Australia 🇦🇺

[@oldbiker9739]

they say there sorry while the WHO WEF and the UN is pushing for a global health treaty

[@anneabsolutely]

Most relevant comment here..... their plan to do it again.

[@elizabethfermor344]

And make it all compulsory.

[@josephvanwie6706]

According to Dr Campbell, the west has signed over it's sovereignty to the WHO since March 2024.

[@holmesgormerley308]

@@elizabethfermor344getting injected while being restrained

[@lw1zfog]

PHE > UKHSA

[@ThomasKing19933]

They are not sorry at all. They should be behind bars for what they've done. Thank you, Dr. John.

[@janiekrig5232]

Yes, you are correct. The ugly truth is that it's all about money for them. They will do anything, murder, cheat, lie etc for money!

[@happytwolaffs6454]

It's Nurse John

[@jodiknight2820]

I bet they are sorry that they've been caught.

[@happytwolaffs6454]

@@jodiknight2820 What do you think this apology is for?

[@Freedomfortruth90]

​@@happytwolaffs6454 is a doctor though... Has a docrate..

[@BREEZE-ROADS]

Really gotta bring the 'heads on stakes' trend back

[@LizzGee1111]

I’m still waiting for my “deeply sorry” by my former employer for firing me for not getting the jab and labelling as misconduct 😡 I hope everyone involved is deeply punished and held accountable. Very deeply.

[@howard1beale]

Sue your employer

[@christine4939]

Agree. One day you sue. Only then will they be deeply sorry.

[@tarico4436]

@@howard1beale Network, right? The movie?

[@Beanerds]

Me too , but I do keep an ear on them through good people who remained and they are suffering today , shipbuilders don't fall from trees . Loosing 35 Tradesmen from a workforce of 60 tradesmen on 2nd Feb 2021 hurt deeply and today they are unable to fill those roll's ,, Ha blardy Ha ,, Karma is a birtch aye ? . The remaining workforce are conastanly sick , day's/week's off at a time , yes they are struggling and deserve it all !

[@manuelferreira4345]

I waiting for deeply sorry everything was not gonna be OK. My work closed on st paddy 2020 and I haven't worked since...

[@GrumpyMeow-Meow]

Say you’re sorry to all the folks who lost their jobs for not taking your product.

[@Jetmab04]

Yep and, sorry for the millions of people now killed by their criminal psychopathy!

[@christenedoering7720]

​@@Jana-om4bbnow I'm convinced your a troll

[@donnazukadley7300]

Or the nurses that were mandated, got vacc1ne injured and lost their job ANYWAY BECAUSE THEY TOOK TOO LONG WHILE OUT IN FMLA FROM the 💉 💉 💉

[@jeffmoodie6144]

Jobs… don’t forget lives and health and peace of mind for all those who now understand it was a mistake to comply and they don’t know when they will be affected.

[@MsJoyce31202]

That's the governments fault. Let jabbers get jabs and leave other people alone. There should have been no threats toward people's livelihoods.

[@adrianshjadesheehan9991]

Bill Gates life in prison

[@user-bz4sy3gj4o]

why to keep it and feed it....

[@keithwatson7779]

Riders forever! 🏍 Keep up the good work Dr John and thanks for your hard work

[@user-se2zg5he4q]

Deeply guilty.

[@sharonbeck3087]

Paid well by the corrupt federal governments.

[@SeaJay_Oceans]

Highly Profitable $ MANDATED SALES & Government funded... Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?

[@paulhewitt5198]

"Safe and Effective" !!!!! What a load of bollocks!!! Criminal is what it is. Start the prosecutions NOW!!

[@eisbeinGermany]

who is going to run the courts and be the judges

[@jenmason472]

​@@eisbeinGermanyexactly! Can't trust the judicial system....in any country 😡

[@mikeswallow1694]

Definitely effective but not safe

[@carenfeldman8854]

The WHO still parrots that claim. Still on their website.

[@percybyssheshelley8573]

YEAH-- A TOTAL LOAD of stinkin' Bee Ess!!!

[@abdellaidani4392]

We are deeply hurt

[@MikeyCanuck123]

John cracks me up! He's pure gold. 👍🏼👍🏼👍🏼

[@Peter-jx3ie]

Mikey. Yeah, just love his dry humour and sarcasm 😁

[@adamweisshaup]

At this point being labelled an 'Anti Vaxxer' should get ones insurance premiums lowered.

[@carolann4087]

Hell yeah! We're not the ones clogging up the hospitals,,,,,,,,never were.

[@juliegwilliam8503]

Ditto!🎉

[@tarapayne4945]

Word… and eventually- it better be a fact!

[@PossessiveK]

I hate that I agree with this. I used to be heavily pro-vaccination, but our 'lovely' excuses for government and medical leaders changed my mind. Now I have to worry about relatives who took the vaccines that are now showing more sickness than before they took them. People who kept in shape and kept up with their health.

[@reneschellevis7897]

​@@PossessiveKtakes guts to admit this, therefore kudos

[@georgemather9082]

Stuff your apology, I want justice.

[@laveraparato258]

Yes!

[@1cyanideghost]

Same. With deaths in the family and Pfizer directly to blame, it is deeply personal and sorry isn't good enough.

[@paulnewton3059]

I would just like my 2 best lifelong friends of which I now only have one left to admit they were wrong.

[@christineevans1787]

Thats right crimes against humanity

[@CCelia1953]

So deeply sorry and here in NZ it's still bn prompted on Social Medias 😮

[@davekeith576]

And they're pockets are jungling whilst they Lough all the way to the bank.

[@joannaplaza2847]

It is painful to see how slowly this scandal is being uncovered.

[@zerotoleranceforsataniceli4794]

Yes and look at how MHRA , our regulatory body, not only went along with this but actually promoted these vacc and is still doing so ! Where's the anger about that ?

[@itsbonkerjojo9028]

How tf it is painful then

[@KerrieRedgate]

Indeed!

[@LorettaJameeVincent]

i just got my first song put together check it out guys. thank you! it's anti-v country music

[@johndough23]

It's almost as if they are hiding the fact this is nothing out of the norm with all drugs. Releasing just enough on this pesky Covid formula to convince the naysayers this was not the norm and we fvcked up sorry.

[@timsmith1278]

Jail would be far too good for the likes of Gates and Bourla.

[@richards933]

bourla is a reptile

[@Bryt25]

And all those poor 'Gates sterilised' ladies in Africa. How disgusting.

[@kimcalder388]

Love you John, and dirt bike ... Impressive! 👍

[@jts3505]

Love your comedian-act in this one. The sarcasm is not lost. Thank you for continuing to put out videos.

[@gerardkelly1191]

ALL TRUST IN WEF POLITICIANS & BIG PHARMA IS FOREVER GONE..!!!

[@pup0229]

What were they thinking by giving us all that time to stay home and go down rabbit holes? 🤪

[@user-uo3ek2dk7s]

first its opiate crisis now this my daughter is a victim still alive thanks be to God!

[@judyjackson639]

As it should be

[@singleshot1331]

Well, I never really had trust n them at all

[@traceyhilton2768]

Plus NO trust in msm or medical people 🤢

[@Lesspaw41]

I think everyone should get something out of this.

[@ianplunkett8013]

God bless you Mr John Campbell for you speaking the truth and for your courage.

[@ShaquilleOatmeal730]

People were saying it while John was pushing the vax.😂

[@ianplunkett8013]

@@ShaquilleOatmeal730 I was talking about a different John Campbell though.

[@richardhumby8704]

We are deeply sorry for the mass murder and the 80 billion profit, now can we just draw a line under it and move on!

[@kathleenking47]

It didn't effect everyone the same....I'm still wondering what's different He's only 60+ Not too old

[@lvr5266]

THIS

[@davisutton1]

@@kathleenking47 Really, saying some intervention isn't universally lethal doesn't make it worth taking.

[@jpsholland]

actually 600 billion.

[@outfromtheshadows]

We have yet to see how it affects future generations.

[@lunasaige]

Deeply evil. They are literally only sorry they got caught/exposed.

[@user-qq8yq7xv8b]

👏

[@thepreacher5934]

Them outlaws are not sorry at all

[@connifilteau2678]

All fired and cancelled. There is unsurmountable amounts of trust to be regained, by all of them. Thanks for taking us on a safe ride, not a hellride ;]