5 Brilliant Minds Who Shaped Modern Science | Compilation

[@derekcouzens9483]

"She sells sea shells by the sea shore". Yes that was about Mary Anning.

[@walrus4046]

Beat me to it Derek!

[@gibranhenriquedesouza2843]

This look like my english classes at the language school: listen and repeat "she shouldn't say swear words"

[@evodolka]

my god, now i have a reason to like that little tongue twister

[@303elliott]

It's a very fun idea! Unfortunately it has been debunked, but is pretty common misinformation nevertheless

[@walrus4046]

@@303elliott Must admit I was wondering how fossilised bones transformed into seashells. Apart from not alliterating of course lol Some witty paleontologist needs to step in and help us out here lol

[@MusiciansReflib]

Hank, I just discovered your works of music composition! I didn't know you were a musician. Actually we saw your wikipedia page and our minds are blown at how much work you've taken part in.

[@FalbertForester]

"Unparalleled awesomeness" - a fitting description of Dr. Alice Hamilton

[@Aaron_Jensen]

The great mind that I will continue to celebrate in 2020 is Grant Imahara.

[@semaj_5022]

I'm still heartbroken about his passing. Such a shock and such a massive loss.

[@kloassie]

Continue to celebrate in 2020? So starting from friday you won't celebrate it anymore?

[@kayakat1869]

A real king.

[@bakedpotatogaming777]

Omg I didn’t even know he passed...

[@SoManyRandomRamblings]

One of Grant's last projects was working on creating the animatronic Baby Yoda.

[@semaj_5022]

Yes please continue the Great Minds series please!!! And "I Don't Think That Means What You Think It Means," while we're at it. I loved those so much.

[@nicstroud]

Mary Anning is also said to be subject of the tongue twister, 'She sells, sea shells, on the seashore.'

[@catcatcatcatcatcatcatcatcatca]

Turner: Insects are not simple machines responding to stimuli, they are rational desision makers that hold the same unique trait humans and bigger animals do! Behaviouralists some decades later: Yeah, about that cognition thingy, we are pretty sure it's just a slightly more complex machine responding to stimuli. Thanks Turner! All jokes aside, humans have learned so much by simply questioning our own bloated ego and the way we often underappreciate all other life on this planet. Saying other life is smart and saying we aren't as special as we think is just two sides of the same coin. Traditions throughout world have seen animals as wise teachers, aspirational heroes and force bigger and smarter than human throughout history. We should probably do that more often, and on the flip side, see ourselves more as animals than something divinely rased above simple rules of nature and life.

[@303elliott]

I agree with this philosophy. Good things to keep in mind

[@icarusbinns3156]

I’m still gonna smash that spider… or set the cats on it

[@Th3F0nz]

23:05 If the cat can wear a mask, so can you.

[@rohannalawade3227]

Who else loves Rose's earings?

[@Ontheroad13]

I absolutely love Margret Hamilton. One of the best things is reading the code she has written. It is fascinating. Look it up on GitHub.

[@ccgarciab]

I didn't know it was uploaded! ty

[@Ontheroad13]

No problem! It’s awesome.

[@IanGrams]

If you've not already seen it, some people from Google made a neat tribute to her using mirrors from a solar power plant to depict her portrait in moonlight. blog.google/products/maps/margaret-hamilton-apollo-11-tribute/ Here's the behind the scenes video which iirc shows Margaret's reaction to seeing it: kzbin.info/www/bejne/baDTo6ijiraXms0

[@lilladydeuce]

Mary Jackson who also worked for NASA would be a very interesting subject. But I love your series on great minds. Keep to the great work. It is like being back in college many years ago.

[@dhampson545]

Whenever I think of Doctors and masks- I think of Florence Nightengale. She would be an awesome topic for a show.

[@bartwilson2513]

Did my family’s genealogy and found I am related to Florence Nightingale. That was a trip. Lol.

[@thedigitalodometer945]

@@bartwilson2513 Congrats! 🥳

[@outdoorsy01]

I live in weymouth. The Jurassic coast as it's called. Right next to lyme regis. Fantastic place to visit

[@gerardacronin334]

I visited Lyme Regis in 2019. It’s fascinating. The museum has many large specimens of fossils unearthed by Mary Anning.

[@Antenox]

+1

[@kylebarry8208]

Thank you for doing this series again! I missed them so much!!!

[@Antenox]

+1

[@chavezharding7820]

Wow. Back then we didn't know how cells made or used nucleotides? It's incredible the strides made since that time. We now know the origins of every single carbon in purines and pyrimidines.

[@slaterrox23]

Leaving a positive comment to dilute out the lemon heads -- Awesome video! Was so much more interesting than "5 Great Minds You Already Know About", haha. Also how good would it be to collect fossils in your backyard?? The past was wild.

[@kayakat1869]

People still do that in the Dakotas and Montana. That would be incredibly cool.

[@MxDiagnosis]

Toast to all these people and to a better 2021! 🍻🥂

[@elizabethCorkins83]

🎉🎊🎉🎊🎉🎊🎉

[@Antenox]

+1

[@ryaneylee]

Ah, back when Michael had precovid hairstyle

[@demonetizationbutton2388]

Great video! 10/10 would 100% watch another one of these again!

[@gregorywhittaker1502]

Those earrings look AMAZING!!! Please tell me that they are authentic pieces from Host Rose's heritage AND that we can anticipate an episode about them and their makers.

[@necessaryevil455]

Roughing up a moth, oh man that's so wrong. lol

[@KnighteMinistriez]

Science is awesome and I love watching videos on this channel. Keep up the good work.

[@jerrysumner4923]

Thank you for these two programs. Just what I needed after a hard day😀😀😀

[@reasonsvoice8554]

23:12 the cats got a mask on too 😂

[@nicoleonfeels]

Here’s to greater minds in 2021! 🥂

[@Antenox]

+1

[@jar-jar3806]

Sometimes the content on this channel makes me emotional in a beautiful way

[@dilpher]

I love this channel. The content is awesome. Great job people 👏🏾👍🏽

[@Boots_293]

Awesome compilation guys! I love the added backstory of these wonderful scientists. Thank you for shedding light on some lesser know women in STEM. I personally loved the video, and if your subscribers have a problem with that then they aren’t exactly here for the science then

[@orchdork775]

RIP TRAY 😢😭

[@lexfrancis5916]

12:03 ayy that's what I take. Thanks Elion

[@joost00555]

I always wish we could tell some of these outstanding scientists that have since passed how their work has impacted future science. I can only imagine how exciting that would be for them.

[@ryancx9524]

Nice episode

[@Antenox]

+1

[@kristianminkov9631]

Hi guys, thanks for all the great videos. I watch all of them and not only on this channel. I hope you make videos about Jacque Fresco and Buckminster Fuller some day. Two great minds worth mentioning.

[@evanrigel954]

i was hoping to hear about Ada Lovelace or Dr James Barry (my personal heroes) but learning about these other awesome people in science was heckin cool too

[@svenmorgenstern9506]

How about Temple Grandin? Nah - not PC enough

[@CritterKeeper01]

Give them time, they've done other Great Mind compilations, they will likely get to your favorites, especially if you advocate for them here!

[@CritterKeeper01]

@@svenmorgenstern9506 Huh? How would including an icon of neurodiversity be *not* "PC"?

[@ardenalexa94]

Some, I haven’t even heard of hardly at all before watching this video. But I’ve become addicted to this channel. 😂

[@outdoorsy01]

The worst years, shines a light on the greatest minds.

[@Antenox]

+1

[@HECKproductions]

some opressed girl 100 years ago: finds out that masks prevent the spread of disease karens today: tHiS mAkS iS oPrEsSiNg Me

[@pamelamays4186]

Nonchalant Moths. My new band name.🦋🦋🦋🦋

[@robhenry7896]

R.I.P. Tray

[@EpicGamerScout]

Man these commenters are wild. Are you saying you would have really preferred the video simply list off 5 insanely smart but already extremely popularly known scientists, adding nothing new to most viewer's understandings? "And here's a video about Einstein, did you know he figured out how space works?!? And here's one about Steven Hawking, did you know that black holes are weird?" Scishow is in the business of showing people interesting things that they didn't already know, and scientist for scientist, the most unrecognized work is gonna tend to be from the women. It's not a grand conspiracy to exclude white men, it's just the logical conclusion of educational content aimed at giving you fresh knowledge.

[@Antenox]

+1 It's because the commenters complaining about the choices are the kind who hated science in school. That's why they think the only ones who deserve attention are the "popular" ones that a grade schooler could name.

[@nikolajovanovski7481]

based

[@DrIstoris]

Antenox not true. I think the video was named originally greatest minds. Also, the comments are shitstorm because well.. it is not diverse enough :)))

[@girlgamer4444]

The majority want their ego stroked but half have been told that it's wrong.

[@unknown..66..99]

@@Antenox yeah

[@marjoriebahm9239]

Michael, you look great! Love the haircut! Finally!

[@demonflowerchild]

It was an old clip

[@DominikJaniec]

nice compilation!

[@elizabethCorkins83]

Happy New year's everyone

[@gerRule]

Same to you

[@Antenox]

+1

[@Jagzeplin]

id love to know how Turner "roughed up" those moths

[@robomonkey1018]

I sort of think you wouldn't lol

[@BlazeOGlory]

He put little boxing gloves on a wasp

[@renzox1136]

Like a mafia godfather

[@303elliott]

He trained a bunch of caterpillars to wait by his car. They were taught to associate wacking a moth with lil bats to a sound track to receiving delicious leaves.

[@jerrysumner4923]

This program is wonderful! Top drawer👍👍👍

[@brandonzzz9924]

1000 dollars a year as a high school teacher seemed like nothing until google let me know that the price of a house was A DOLLAR A SQUARE FOOT IN 1908

[@eliscanfield3913]

If there isn't an Anning-saurus and a Turner-bug of some sort by now, there most definitely should be.

[@Kamel419]

i love that you highlighted only minorities in this list, but wish you had made it clear somewhere that's what you were doing. mostly because i think this would make it easier to find for those looking for such lists. i think it's amazing to see all of the wonderful accomplishments!

[@CritterKeeper01]

I'm guessing the idea is that it shouldn't be any more unusual or remarkable to see such a list with no white men in it, than it is to see one with no black women in it. Which, I notice, is a group that *noone* seems to have noticed was not represented, while quite a number of people have commented on the list not including any white men.

[@Kamel419]

​@@CritterKeeper01 as admirable as your sentiments are, the statistical distribution does in fact make it an anomaly. wishing it to be otherwise doesn't make it so :(

[@CritterKeeper01]

@@Kamel419 You mean the statistical distribution of people who have *already* gotten widespread recognition for their achievements, or the statistical distribution of the actual real life people who made great discoveries, whether they got recognition at the time or not? Those are two very different things!

[@pheart2381]

You can find tiny fossils among the sand and stones on lyme regis beach,but watch the cliffs! and the tides!!

[@charleshicks604]

14:51 I would not mind if hank did them all, it would be cool seeing him years older or younger than the previous video. And I really like Hank as a host.

[@hollyjhager]

Love this!

[@philvarney3860]

Never mind the smart people. Who managed to get the cat to wear a mask?

[@seachers6124]

Hey if you're interested I've got a few things you guys and gal's should see. #1. I figured out how to cool off a broken nuclear reactor and end the nuclear waste while protecting the rest of the planet from a growing radiation threat. #2. An "engine" i,e, thrust source that works with magnets . My engineer friend says 1,000,000lbs of vectorable thrust. Allowing a vehicle to lift any amount of weight or pick up speed ( in outer space ) exponentially. Second by second . Reach out to me and we can discuss these designs.

[@alexiswelsh5821]

Hamilton: The Astronauts could press the wrong button and ruin everything! NASA: There’s NO WAY our highly trained astronauts would do something like that! Highly trained Astronaut: I pressed the wrong button and now we can’t get home! Hamilton: Told you so NASA: Shut up and fix the problem we wouldn’t let you prevent!

[@Antenox]

+1

[@debkayaker]

Love your show. Please ... No more cockroaches

[@medan880]

I want this year to bring a cure for ME!!!

[@mischarowe]

The more you study historical discoveries the more you find that when a woman discovered something, the *men* took credit. This was a great compilation. Here's to 2021 being even better.

[@mangoface4323]

Breastfeeding shirt shoutout! 💗

[@TheJaboogie]

RIP Doggo

[@teagan_p_999]

Great video, love the diversity and scientists I didn't know much about yet.

[@JadedDragon_]

I absolutely love that this video is not about white men. Four white women and one black man. All fascinating. I’m so glad that these people are finally being recognized. It saddens me that they weren’t recognized in their time though.

[@jerrysumner4923]

The best of great and good people. Bravo!!!

[@sheikhsquad9624]

FBC fund and their algorithm is the best, there is no point in arguing with this

[@chriscostello117]

Thanks for all the hard work and you and your team have done. I have by all means been left me with some next level gems Sound and Fury for example. Happy new year . Stay Safe and #savetheventurebros

[@sarahburke5839]

They went to the container with the food in it??... Fn Geniuses those bees must be! !😲🤨🤔

[@twocvbloke]

Although Hank makes a lot of videos, he's got nothing on Simon Whistler, I swear that guy has multiple clones for all the videos and channels he does... :P

[@sandeesandwich2180]

I liked this, though I did feel in solidarity I should "smash that dislike button".

[@thomas.02]

how many channels does the guy even host?!

[@twocvbloke]

@@thomas.02 All the channels, allegedly... :P

[@sandeesandwich2180]

@@twocvbloke Because he's a LEGEND. Allegedly.

[@StudyWaliClass]

awesome

[@elizabethCorkins83]

I hope 2021 is better 🌹

[@minnymouse4753]

First episode of Ozzy and Drix Scarlet fever gets in anew body from a mosquito can that really happen

[@IanGrams]

Scarlet Fever is caused by a bacteria that causes Strep Throat. As far as I could find, that doesn't seem to be a mosquito borne disease, so it seems the creators of the show took some artistic license with that story. www.health.state.mn.us/diseases/mosquitoborne/diseases.html en.wikipedia.org/wiki/Scarlet_fever

[@minnymouse4753]

@@IanGrams so the show was wrong they even had mob strep throat villain but hay its impossible for mainstream scientist to be 100% accurate with so many discoveries being made

[@IanGrams]

@@minnymouse4753 yeah it seems either they just wanted that storyline or they mixed up Scarlet Fever and Yellow Fever which is transmitted by mosquitoes. But agreed it's hard for anyone, scientist or not, to ever be 100% accurate.

[@minnymouse4753]

@@IanGrams yeah I've noticed in the series and movie many organs and diseases called some things are much more like other things. Thrax his size alone and releasing a burning substance ant taking an important chemical he's much closer to a bacterium. Then a virus

[@IanGrams]

@@minnymouse4753 agreed, they definitely focused more on a good story than an accurate one. The fact Thrax never infected any cells to make more of himself wasn't very virus-like and stealing a single nucleotide to cause issues doesn't make much sense because our cells can repair DNA damage. But at least I learned from the movie the hypothalamus regulates body temperature so there was a little truth to it 😅

[@stephenconnolly3018]

There is a world outside America being the first America is not the same as first in the world.

[@davidpavel5017]

Hank calling dibs on great scientists

[@Cedrus_]

its okay, hank is my favorite, but i love all of you

[@itzmeB2]

I'm proud that over 50% of the minds are women

[@Isha-ot6tc]

Why don't you continue with the series 😤

[@TheSmkngun]

Never go full Scishow!

[@icarusbinns3156]

23:14 1918 pandemic family picture…. How did they get the mask to stay on the cat??

[@JudyMenzel7]

After listening to several of your shows about bygone scientists,, mathematicians, physicists, geologists, etc, it seems to me a vast number of them died from some sort of cancer. Is there an explanation for this?

[@joelmiller3218]

1 in 4 people will get cancer at some point in their life, and the older you get the odds become 1 in 2. And in the old days we didn't really have anything to treat cancer with so by getting cancer, death was almost guaranteed. Unlike today.

[@topaz0a]

Thanks i knew about Michael Hill! He was my professor in Oxford and told us FBC fund!

[@lewisgordon1490]

It was a mistake IMO to not include any of the human computers from the Hidden Figures book & movie. Esp Mary Jackson IMO who was trusted by John Glen over the mechanical computers. But possibly and/or Mary Jackson, & Dorothy Vaughan.

[@Xirpzy]

Could have mentioned Wu Lien-teh as well.

[@Rei-invented]

Ive seriously considered being a entomologist and im worried about the jobs avaliable, i'm super interseted in making some living terrariums when i can afford it!

[@macaylacayton2915]

Me when I hear "Margaret Hamilton:Who was she again? Me when I see a picture:Oh yeah! *laughs* her! I have her as a lego model! my dad got it for me from the museum for flight and space in DC. I even have a book that mentions her I'm pretty sure, it is called "Galaxy Girls". also why would HAMILTON BRING HER 4 YEAR OLD TO WORK?! what did she think she was gonna do? help her program? A 4 YEAR OLD CAN'T UNDERSTAND THE TERMS!

[@CritterKeeper01]

Sometimes kids get brought to work because their usual daycare wasn't available. Sometimes it's a special chance to see Mommy or Daddy at work (like Take Your Daughter To Work Day) so that kids can see for themselves, and thus understand, that women really do have important jobs, something that wasn't represented in the popular media until recently.

[@jessicaevans7847]

Girl, I don't think you really have the right to joke about Hank's hosting frequency. I mean you've been around for what like two or three great minds?

[@JeevasJerico13]

Hmm, wonder why this video got so little traction

[@darkangelprincess101]

So how do we train roaches to avoid the dark so I can sleep at night

[@renzox1136]

So 2020...

[@TheSavageJCE]

What’s the Hostess name ?

[@zzz_zzz_ZZZ_zzz_ZZZ_ZZZ_Z_z-ZZ]

She makes cool videos too, check her out m.kzbin.info/www/bejne/mmHXeHV5eKpjosU

[@IanGrams]

That's Rose Bear Don't Walk and she's the newest member of the SciShow team. If you pause during the credits they always list the name of the host for a given episode. This video also listed her in the description but I'm not sure they always do that so the credits is the most reliable source.

[@lili_dee]

Interesting that nowadays we all know about Mary Anning, but very few can name any other paleontologists of that time.

[@tcf70tyrannosapiensbonsai]

If all scientists were courageous and idealists, as shown in this episode, we wouldn't stick in this socioeconomic catastrophy. Instead of learning how earth is renewing itself through cycles, we were tought the oneway from good to waste philosophy of entropy.

[@sth.777]

Would you please do an episode about the woman behind every medicine we use today - HeLa - Henrietta Lacks. Without her immortal cells, many medical advancements would never even have left the ground...

[@Antenox]

+1

[@IanGrams]

They did one 4 years ago: kzbin.info/www/bejne/qYm8Z2Ctgcqmj7s

[@valleyshrew]

She didnt even know about it and deserves no recognition for it. They are just cells that share her dna, she didnt really contribute anything.

[@patriciamcintyre1667]

@@valleyshrew So if someone steals something you own and profits in any way off it, you're telling me that you will sit and be quiet about it simply because you didn't willingly give them the item? So what you're saying is that youre okay with being robbed. Gotcha.

[@valleyshrew]

@@patriciamcintyre1667 Should I start charging people to smell my farts too, since these atoms were also once part of my body and are being stolen? If they take biological waste from me that I had no use for, and use it to save lots of peoples' lives and advance science I would be perfectly fine with it, why wouldn't everyone?

[@tatinightmare]

How do we know about Mary anning now if all of her work was published by other people and was virtually unknown 🤔🤔

[@wontnotawill1356]

Margaret Hamilton was so beautiful as a young woman

[@a_real_jive_turkey7772]

What if moths can't hear and instead they are feeling vibrations

[@savagepro9060]

hearing is feeling vibration through the mechanics of the ear

[@joshualawrencevlog301]

is there really still a person who does not know about the existence of FBC fund and their algorithm?

[@makingkwak329]

Guys! Just google: “FBC fund”! You will go nuts!

[@WiseGuy02]

Talk about a woke compilation. Well done.

[@unknown..66..99]

What

[@Vladimir-et2kq]

thought you guys ment 2021 greatest minds not the past

[@Beauregard1]

Awesome can we do one about the relationship between race and IQ?

[@kayakat1869]

Can we do one about stupidity and the misuse of hairdye, especially before press conferences?

[@Beauregard1]

@@kayakat1869 Dont you have coal to burn?

[@kayakat1869]

@@Beauregard1 I'm not that outdated.

[@RandomPlayIist]

160 people must feel inferior after watching this lol.

[@Noah-ge4kx]

nah it's mostly people that are, for whatever reason (truthfully, the reason is kind of obvious, but), butthurt because no white men were featured in this video.

[@thomas.02]

@@Noah-ge4kx saw the dislikes, knew what that most likely meant, oh well

[@ryosworkshop500]

How did we figure out the story about the fossil woman if all her discoveries were published by men

[@theaverageblitzer4351]

Hank is a snack ngl