The Wobbly Future of the Hard Disk Drive Industry

Links:
- The Asianometry Newsletter: www.asianometr...
- Patreon: / asianometry
- Threads: www.threads.ne...
- Twitter: / asianometry

[@smokecrackhailsatan]

2 months ago: "Why hard drives are dead" Today: "THE FUTURE OF THE HARD DRIVE INDUSTRY!"

[@nathansmith7153]

Well in 1973 when we did the first one at IBM we were told the industry would last 3 years

[@scaryjam8]

@@nathansmith7153Technically wasn't wrong

[@gkanai1400]

As a consumer, most people who use devices wont purchase an HDD unless they buy a tower PC or build their own PC and add an HDD for mass storage. Of course we all use HDDs daily via cloud/streaming services. I appreciate that we have the choice of SSDs for speed and HDDs for capacity.

[@T-Ball-o]

and HDDs for long term storage, too. An unpowered SSD can start losing bits in as little as six months

[@christopherd.winnan8701]

1TB satisfies most ordinary consumers. I have more but I struggle to imagine how I am ever going to watch all the video that I have in just a couple of TB. 20TB seems like overkill for home users.

[@savedemperor8024]

I only use a ssd for installing windows on it and the rest is still hdd and i even want to get one or two of those new Seagate 30tb server hdd for storage lol

[@savedemperor8024]

@@christopherd.winnan8701 Well i want to get two 30tb hdd drives so there are exceptions 😂

[@johndoh5182]

@@T-Ball-o Both forms of storage can flip bits over a few years. You can do a disk operation for HDD that will refresh the data. Yes, I know it's magnetic and the data should be retained, and yet there is a program to do this very thing. The bigger advantage is LONG term storage because a magnetic disk has a much longer life expectancy if you aren't constantly spinning it, as in over 2 decades, once again running a refresh every few years. An HDD will retain its magnetic field strength for over two decades. An SSD won't last that long, and 10 years is about as good as it gets regardless of it being powered or not. So, you not only get more capacity but also more life expectancy with HDD, once again if you're not spinning it all the time.

[@vi6ddarkking]

If they ever solve the laser problem. The new multilayer optical disks would be a worthy successor. To the good old hard drive.

[@T-Ball-o]

Optical has always been miserably slow

[@MBunn-uf1we]

@@T-Ball-o for archival storage it would be great.

[@Blink_____]

@@MBunn-uf1we still ridiculously slow

[@thomasruwart1722]

Tape is the thing that will outlive HDD and SSD. I know this because Mr Spock often refers to computer "tapes" and that is a few hundred years in the future! So, there you have it!

[@paulmichaelfreedman8334]

@@Blink_____ Complaining about properties that are not important to the application, isn't very constructive.

[@thomasruwart1722]

Here's an interesting tidbit: the tracks on a current-generation HDD are so narrow that you can fit ~1,500 tracks on the EDGE of a piece of paper.

[@Mr.SharkTooth-zc8rm]

HDD ain't dead yet.

[@MegaChickenPunch]

too bad

[@jtelliso]

Not yet, but hopefully one day we get m.2 or other SSD that out size the platters. So far tho 20tb platter is way wayyyyy less cost than 20tb of ssd storage.

[@volvo09]

Hard drives have a market. Can't get a 20GB SSD that can be stored for years without power

[@MattExzy]

I left a flash drive unplugged for what I think was two years. Totally corrupted, nothing was recoverable from it. So as far as even short-term archiving, flash memory is very untrustworthy. I hope optical media makes some sort of comeback, or we're potentially going to have an entire era of missing personal data.

[@jtelliso]

@@volvo09 Yeah, SSD is good at storage but they do need to be powered up much more frequently than a platter drive needs to be power to keep everything happy in the long term for data integrity.

[@TammuzKay]

Amazing how far we've come from simple cavemen smashing pieces of magnetite together to store low resolution bitmaps of their hunting achievements.

[@xmj6830]

Ah you're one of them believing such stupid theory...

[@manitoba-op4jx]

the joke your head

[@raylopez99]

Or a caveman throwing an animal femur into the sky and it turning into Space Lab (2001 ref).

[@CTSFanSam]

For what I understand, unpowered, HDD's will store data far longer than SDD's.

[@paulblair898]

Most consumer SSDs will let the data on them decay even when powered 24/7.

[@Indrid__Cold]

​@@paulblair898Sounds like a software fix is in order.

[@markleuck]

True although I just read a story how hard drives from the 90's in the music industry are failing, eventually the magnetic platter starts to decay

[@vilian9185]

@@Indrid__Cold you can circumvent it using advance filesystems with data checksum(like btrfs) not sure if you fix the decay with software patches

[@HowManySmall]

Yes this is why I got 14tb of hard drives in my desktop lol

[@rockpadstudios]

I live next door with a guy that spent his entire career at Seagate. He told me all about HAMR tech and was working on a new HAMR drive before a layoff. He says the fines for selling drives to china cost Seagate millions with the decline of HDD because of SSD. Tape drives still are the best long term storage.

[@crash.override]

*for selling drives to Huawei specifically

[@paulmichaelfreedman8334]

It may have cost millions, but if they were doing it, it means they were still making a profit off of it. Simple math, and all about $$$$

[@MegaChickenPunch]

@@rockpadstudios good! this horseshit company must not exist

[@undivided_unified]

if you dont innovate, you become history

[@gitduck]

if you don't scale, you look pale.

[@gitduck]

if you do scale, you look shiny ofc.

[@mintoo2cool]

not true

[@CarsMeetsBikes]

Seagate/WD both have SSD arms. It’s hard to say they weren’t innovating when they were pushing the limits of physics for a specific method of data storage

[@BrophyMichael]

I was wondering why hard drive prices hadn't come down in the last 4 years! I wanted to back up my capture footage and building a NAS is too expensive so I just bought a massive 14TB HDD in 2020 and backed up everything and it cost me $210. Fast forward 4 years and now 14TB costs 250. It's gone up! This makes so much sense now, thanks for the great video!

[@spyderlogan4992]

This technology and industry has come a very, very long way from the first fixed head disk drive I ever worked on. A Data General Corporation 'Novadisk' with 512KB capacity, with a belt driven spindle motor. Then a 2MB Diablo Cartridge Disk Subsystem. The Read/Write head was the size of a dime...Then the 'Zebra'...

[@privacyvalued4134]

HDD isn't dead until the cost per TB gets to be about the same for SSD. The gap between SSD and HDD is definitely closing though. Right now the sweet spot for bulk storage, especially for backups and very large files, at affordable prices is HDD at around 13TB. Tape storage isn't nearly as cost effective per TB. Sure you can get 20TB tapes but they are two times as expensive as HDD storage and the tape drives themselves aren't cheap. SSD/NVMe drives are about 6 to 8 times as expensive as HDDs. Used to be closer to 10 times just a few years ago. So there's still a very significant gap in cost per TB between the two technologies.

[@mintoo2cool]

there will always be a market for HDD .. specially in archival and cold storage usecases

[@catcatcatcatcatcatcatcatcatca]

Tapes have a huge advantage in cold storage because of the form-factor. AFAIK the tape in itself is entirely ”passive” component, meaning there isn’t as much that can break during storage. HDDs don’t allow storing only the disc and making the read/write mechanism independent. So you still need to pay for the rack-space and server to ensure broken disks are detected and swapped before data is lost.

[@v12alpine]

For cold storage HDD's are still king for disk sizes over 1TB... just my opinion.

[@Crisdapari]

Magnetic tape still is a good option for backups, even today... I think. Just remember: Do not put magnets near those tapes. 😢

[@thomasruwart1722]

Tape is the thing that will outlive HDD and SSD. I know this because Mr Spock often refers to computer "tapes" and that is a few hundred years in the future! So, there you have it!

[@Lilybun]

would a solar storm similar to the carington event wipe those tapes?

[@SpiceFox]

for me, there are two advantages: cost per byte is the main, but also an hdd will hold data much longer unpowered. For main computing though, ssd is the only way to go

[@innonation]

Thank god when this channel mentions NFT, it's referencing a technology other than that hype train and some ape.

[@flyingdutchman28]

HAMR TIME!!! Sorry. I had to do it.

[@stevebabiak6997]

Can’t touch this …

[@raylopez99]

@@stevebabiak6997 If the head touches it will crash and bring down da house.

[@johnmijo]

SO, my idea of bringing back PUNCH CARDS just didn't cut it :p

[@christopherd.winnan8701]

Struggling to find a Jacquard laptop in my part of the world! ;-)

[@mintoo2cool]

ibm shill detected 😝

[@Atom224]

CDs are basically the closest thing to punch cards if you think about it.

[@O.M.G.Puppies]

The only problem with SSD is if you turn off the power for a year, they will degrade. The little capacitors leak.

[@juhotuho10]

this isn't necessarily true, there is a video on youtube about testing this and after a year being unpowered, the guy didn't found any data degredation so far

[@Coyote27981]

I wonder why they aren't building 5.25" disks again. Quantum Bigfoot were huge size back then. Sure, seek times are horrendous ... but sequentials are good, and you could have twice the disk space per platter. For storage of big files, it should be good.

[@markleuck]

I remember those drives although never had one, Quantum is now owned by Western Digital

[@dercooney]

i can use 2 5.25" bays and have 5x the space with 3.5" drives. add a parity drive, so it's 4x 3.5 against 2 5.25. comparable capacity, but i have a design that is proven and high volume

[@oggilein1]

people who have acess to that much space will just run multip 3.5" drives in raid array, either giving them better speed, redundancy or a mix of both

Babe wake up, new Asianometry video has dropped.

[@LydellAaron]

We'll see a spike in HDD if our cloud infrastructure collapses for some reason. I'd like to see a return to local data downloads and ownership. Between all my various services, Google drive, Dropbox, dashcam content, photos, etc I probably have about 12-24TB so an HDD is still key if you need to backup your cloud data with +10TB.

[@johnrickard8512]

I have been getting into this too as my flagship workstation has dual 10tb hard drives - perfect for data dumps. Linux makes these things easier still as well since static data can be packed away with SquashFS and yet remain fully transparent to the filesystem.

[@DavidHalko]

The cloud is buying HDD

[@LydellAaron]

@@johnrickard8512 didn't know about squash FS. Thanks for sharing, and the tip.

[@johnrickard8512]

@@LydellAaron it's a trick I picked up from tinkering with OpenWRT. Works great for huge dumps of websites and ISOs

[@catcatcatcatcatcatcatcatcatca]

I don’t think the average consumer is too keen on this idea, at least before someone packages into a nice product/service. Many, probably majority of people actually buy new PC/phone when they run out of storage. Users don’t know where the information they rely on is actually located in the filesystem they use, only what it actually does. To maintain local backups and private cloud/NAS, one needs to not only monitor the systems health, but also handle dedublication, basic labeling and basic storage policy. As well as connecting all their devices without centralised end-point/authentication. If google cloud sold a home NAS that used googles authentication and worked similar to google cloud, I think average consumers might want it for their family. At least parents might want to protect the images and other personal data of their children. On the plus side, this would probably raise up some great IT admins, who spend their childhood ensuring their minecraft servers are properly stored, as well as sneaking in whatever pirated movies and games their friends need storage for.

[@anapananapa]

They should just reintroduce the 5.25in HDD. That would give you more capacity. Just like they should make LaserDisc sized Blu-Ray discs. (Because it would be fun. That’s why.)

[@Slavicplayer251]

Yep I reckon a 10” blu ray might even be able to hold 3.5TB+

[@dercooney]

2 5.25 bays = 5x 3.5 or 8x 2.5. given that and the lack of overall interest, i'd be surprised if it took off

[@anapananapa]

@@dercooney Yeah, so that would be at least 5x capacity. 20TB *5 = 100TB. That’s a lot for one device. Besides, it would just be fun, regardless. Feels like almost the entire tech industry is plateauing and has become rather boring (disregarding the amazing advancements on the technical side), and what we have right now pretty much fills the needs of most. So, I think we should start doing fun things, because they’re fun. If I could plonk a single 100TB 5.25in full height HDD in my PC, that would hilarious and fun, if a bit ridiculous. They could totally do fancy things too like split heads, so you could have more versatile data streams, or have some kind of internal data redundancy something or other. Heck, there’s probably enough room to stick in a whole SSD as well. Have a hybrid drive. An all-in-one data storage device. I don’t know. It would be fun. That’s all I’m getting at.

[@joshcarter-com]

Problem is that transfer rates to/from the drives has not tracked with capacity. A 5.25in drive would magnify an already significant problem. Ditto access times.

[@AC-jk8wq]

I just watched a video of a lecture by Dr. Grace Hopper about the storage of data in 1982…. A year before I bought my first 10meg Winchester Hard Drive… The topic was the time value of the data being stored… recent entries vs. ancient history… 😃

[@thisisausername1265]

I enjoy how you say MAMR and HAMR.

[@AC-jk8wq]

You must love his DRAM as well. 😃 Jon is an efficient speaker… he has saved a few syllables over the years…

[@caluna76]

HAMR reminds me of magneto-optical tech used in PD, MiniDisc, and DVD-RAM but with data read back magnetically instead of optically.

[@n00b247]

Imho, bluray will be back soon. Burning holes in hair-thin metal is the only way to store data for centuries. Yes, 25-50GB is floppy size by today's standards, but with just 10 disks you can sure save a lot of memes for future generations. HDDs will also stick around for "long term" 5-10 years NAS storage.

[@johnrickard8512]

Tbf Blu-Ray is good for 120gb, and I seriously doubt that optical storage is out of tricks.

[@DavidHalko]

@@johnrickard8512- I hope so

[@fus132]

My collection would take only half a bluray disk, nice

[@Slavicplayer251]

Until the plastic degrades

[@T-Ball-o]

Are you for real? Optical is not only a pain in the butt and rots, it's SLOOOOOOOW

[@TSAlpha2933]

my PCs haven't had mechanical disks in about 10 years (I've been lucky enough to have most of my computers purchased for me by my Jobs) I have however had many many hard drives in my house at all times, because I keep an external disc array for my PC, and a NAS for my work and family. I don't see either of those facts changing for several years.

[@markleuck]

My only criticism of the video is that SSD's are not more reliable than hard drives, I just replaced my 2015 computer that had no issues with the hard drive running 24/7 since the day of purchase AND the secondary drive was from my previous computer bought somewhere in the early 2000's that while slow still worked fine. find me an SSD that will do that

[@jimdawdy6254]

I've had 2 SSDs crap out on me. I've never had a HDD go bad.

[@manitoba-op4jx]

@@jimdawdy6254 yeah. i dropped an HDD down a flight of stairs once, that drive served reliably and survived the computer it was in literally catching fire and it's still good

[@IntegerOfDoom]

I have a few old Caviar drives under 2GB that still work fine. (for now)

[@tulsatrash]

Love seeing data storage tech advance.

[@raylopez99]

Unless you're a WD or STX shareholder...

[@kahvac]

I'm thinking the need for higher HDD densities is so great that perhaps longer seek times and or bigger disks are worth the tradeoff in some applications. 100 -200 TB drives ?

[@siberx4]

Tape media endured a big slowdown in the 2015-2019 time period due to some ugly patent battles around the LTO-8 format that effectively stagnated capacity increases and kept prices for existing media higher than they should be. I think this is resolved now, but it definitely put tape on the back foot compared to hard drives in terms of capacity increases over time. The history of tape storage might make an interesting video topic. You briefly mentioned shingled magnetic recording in this video but didn't elaborate. The technology is somewhat niche/controversial, because while it does improve areal density, it vastly complicates the writing of new data to the platters (especially when there's existing data nearby). It's a cool trick, but you need to ensure your whole software stack is aware of the quirks and that your workload is suitable for the restricted write patterns that shingled drives can handle efficiently. In some ways, it's similar to the caveats around rewriting flash storage, except that flash is so much faster than hard drives that they have a lot more tricks available to hide the overhead. Some of the hard drive manufacturers (Western Digital in particular) have gotten in big trouble for selling shingled drives without clearly disclosing them as such, and consumers were understandably very annoyed when their general-purpose workloads performed like junk. One interesting change I've noticed in that last 5-10 years is that while hard drives _have_ gotten larger (although the rate of improvement has slowed) the cost per GB has plateaued quite significantly. Prices per GB used to drop every year (and there was a distinct curve of prices across the size range). These days though, you basically pick any capacity between about 2TB and 20TB and the price per GB will be nearly identical; you just buy the drive size you need for your application and that's that.

[@vannoo67]

So the solution is Hard Drives with Lasers on their frickin' heads?

[@crash.override]

Dr. Evil bought Starbucks; he can buy Seagate too.

[@drakelangham4412]

At this point, for retail/consumer purposes, I'd think reviving full height, 5.25" drives would be cool.

[@nathanahubbard1975]

That would be something. And hard to resist if someone is offering a 100TB hard drive for a reasonable price.

[@Slavicplayer251]

And how cool would it be to see the inside a full 4.5” wide platter stack

[@8BitNaptime]

I'm in.

[@nate9000x]

Raid setups with 5.25 drives would be epic.

[@louwrentius]

Don’t underestimate the bandwidth of a wagon full of tapes hurling down the highway (just don’t mention latency)

[@raylopez99]

Now it's an SUV with a pallet full of NVMes?

[@johanslabbert2869]

If ever there was an award for the best combination of simplicity of design, reliability, precision of operation, portability, robustness and cost, it would probably go to the humble present day hard drive. To my mechanically inclined mind, it is an intrinsically trustworthy technology, far more so than any SSD. Much respect, may it continue to exist for many more generations.

[@catcatcatcatcatcatcatcatcatca]

The lasers in HAMR hammerheads! This must be why my aunt told me to invest in Near-Field Transducers two years ago!

[@cjay2]

I'll stay with my rotating hard drives thank you.

[@thegorn]

Pour one out for our dead friend - the HDD.

[@charlesvanderhoog7056]

In 1971, we got a 128K HDD the size of a golf cart wheel. It cost DFL 50.000, or €200.000 in 2024 money. It means you would be able to buy a couple of Rolls Royce cars for less than one cent.

[@aikafuwa7177]

I don't about you, but 20TB SSDs even if they exist are too expensive. My server (home made NAS) will still need HDDs because that is only affordable option. The last thing you want is your data to be out on the cloud. You should NEVER trust those MOFOs.

[@M33f3r]

Cloud is just someone else’s computer. Unless it’s on a blockchain but that gets expensive fast.

[@crash.override]

Go multi-cloud; don't put all your eggs in one basket. But the cloud providers do have entire teams dedicated to being Properly Paranoid about storing bits. E.g. X months of past(/soft-deleted) versions retained, 3 copies of the data, each in data centers on opposite sides of the continent, with periodic batch jobs looking for bitrot. Ya ain't getting disaster-resilience with one NAS.

[@spiralout112]

A lot of people seem to hate tape but I've had a few different tape library's in the home lab for quite a while now and it's been great. Cheap, reliable and offline which in this day and age is very important.

[@gamagama69]

thats how i use my harddrive too. rarely played games, local backup of my phone pictures and videos, ripped movies, whatever.

[@mattilindstrom]

Shingled magnetic recording serves best as a write once, read multiple times medium. The write delay plays merry hell with e.g. the ZFS file system. A couple of years ago there was a problem with HDD manufacturers selling shingled type disks to consumers and companies without explicitly stating what they were getting.

[@crash.override]

Anyone else remember the "Get Perpendicular" musical promo animation from Hitachi about PMR?

[@andreyv116]

HDDs are still useful for NASes given a beefy SSD array cache for data tiering but yeah that's not very general consumer

[@SHO1989]

yep. been researching building a new NAS with my "refurbished Hard Drives" cause the cost of used Data Center drives is so cheap doing raid level using 2 disks as redundancy is totally cost effective. If one drive fails, who cares, it's a fraction of the cost of new drives. Homes all over will be buying up these used Data center drives at a fraction of new.😂

[@RainbowLovingRainbow]

At this point, quantum physics is going to be an insurmountable problem. Chips are getting to the point quantum fluctuations are going to literally make them useless. We are nearly at the end of lithography, regardless of type.

[@IntegerOfDoom]

I feel that way with a lot of tech these days. We are nearing that brick wall.

[@technicallyme]

Ssd's can also do orders of magnatude more iops per second Love the triforce chart 😅

[@davidholder3207]

My first experiance with computer storeage was 7 hole paper punchtape writing and reading from a TTY 33. If you ever dropped and unspooled a large reel of punchtape the best way to respool it was to use a deep stairwell and throw the tangled reel down it from the highest level. Many years later a 50 mbyte pc hdd got zapped in a lightning strike. The only meyhod I found to retrieve all the data was to place said drive in a freezer for around 10 mins which gave you up to 2 mins of read time before repeating the process.

[@Bboyman1150]

9:33 - 9:45 😭 the wording is funny for no reason

[@gemstone7818]

a video about the future of magnetic tape would be interesting

[@fredinit]

Plenty of room at the bottom. ESR - Electron Spin Recording. That should hold us for a little while until they get proton and neutron spin recording PSR / NSR. Unfortunately, there is a bottom.. QSR - Quark Spin Recording.

[@alanwolters9651]

- Almost 70 years since the first HDD in 1957

[@paulmichaelfreedman8334]

As long as the storage cost per bit is a lot lower than SSD, HDD will live on. All about the $$$$ It's just that "smaller" hard drives aren't attractive anymore as SSD outperforms them by at least an order of magnitude. When large SSDs become affordable, that's the day HDD dies.

[@SimpMcSimpy]

When SSD become reliable as HDDs that is the day HDD dies.

[@chengong388]

At this point I have had many very old 2.5" SSDs, and they've all been super reliable, even when used in somewhat heavy duty (for a consumer) roles, like running it in a NAS with torrent running 24/7.

[@tad2021]

RIP OCZ. Their SSDs had a 100% failure rate in my experience. Those early generation of consumer SSDs were not reliable.

[@An0nymousMessages]

My computer wants to get HAMR'd

[@stevebabiak6997]

Isn’t that what Hillary did to her hard drives?

[@uss_04]

I love HDD’s just not in my personal machine. Preferably connected to a NAS with dedicated caching.

[@manitoba-op4jx]

you can recover the platter from a hard drive after a fire. SSDs melt. learned that the hard way.

[@hamesparde9888]

I'm still waiting for that race track memory! 😭

[@ZaphodHarkonnen]

Random unexpected NZ chocolate at 10:30 🤣

[@Sku11Basher99]

Missed opportunity to call it the floppy future

[@AppliedCryogenics]

RAMAC (RAM-ACK): Random Access Method of Accounting and Control.

[@user-ot7wb8sy1v]

Hammer, Mammer and Nammer. What's Nammer? Heck if I know. It just roll off the toungue.

[@ccshello1]

Here we hear the endless appetite of storing bits in the smallest form factor, however the human real talent is to generate even more junk information to be stored -- until we simply cannot remember what we are actually storing there in that little packed universe.

[@christhirion9474]

Huray someone got my surname pronunciation right 😮

[@ronaldgarrison8478]

Data rot is something that must be considered, but I don't believe it will ever be a deciding criterion for much of anything. Whatever the time to rot is, you just need to refresh the data often enough to avoid it.

[@fredyellowsnow7492]

I still use tape (ex office LTO setup) to back up my video collection and photo gubbins. Slow, but it just does a job overnight, and it's not every night, just once in the blue moon. Handy thing about tape, is I can pick up ex small enterprise systems for next to nothing, and the tapes for nearly free - nobody else wants them. The tape setup is more of a fallback of last resort, but they're there and will remain readable - I hope. My main offline storage is larger and larger SAS and SATA discs, but even they will eventually be replaced by solid state, I suppose. For the meantime, they do the job and ex-enterprise ones are cheap with lots of life left in them. I'm waiting for the eventual price break where it will be cheaper to SSD them than replace with more spinning rust.

[@halfsourlizard9319]

Maybe I'm missing something, but I basically don't care about how much data can be stored on a drive or per unit area ... I care about durability, reliability, TCO, and ability to securely / permanently wipe the drive (e.g., degaussing). It's fine if I need to buy and RAID up a large quantity of drives.

[@ceruleous]

HDD's are needed more than ever for data centers because of the growing demand of storage for cloud

[@gecho194]

I looked at that LTO tape image and realized it only has one reel, so the drives that read it must have a take up reel inside them. I guess that's handy otherwise the tapes would be twice as big, half empty space. But you always have to fully rewind it before removing it from the reader (some drives hold multiple tapes with a single drive).

[@dercooney]

at the moment (sep 2024), a 20T HDD (WD gold) runs $450. a 8T SSD (also wd gold) is $1800. that's ~10x variance from one to the next, but it's shrinking. when it's 2x, i can't see buying spinning rust

[@tehpanda64]

With a combination of stalled technology progress and high inflation... I think we are seeing the beginnings of the first ever increase in price per gigabyte. Lets hope it was just a 9-12 month stagnation due to "ai" server demand, and that prices in this next quarter manage to decrease again or even hit new all time lows. admittedly I am mostly talking about ssd pricing, I do think hard drives may have been more consistent in price per gig in comparison.

[@CalgarGTX]

The lack of price gains per Go on the SSD side is sadly mostly due to price fixing cartels and collusion from flash manufacturers rather than tech limitations atm. We generally pay the same $ per Go we had reached around 2014-2015 despite droves of tech innovation meanwhile, QLC, 60+layer cells, massive economies of scale from datacenter use etc...

[@iamfinkyuk]

Fascinating stuff, thank you! But you seem to have barely mentioned SMR.

[@TransCanadaPhil]

i know I’m always looking for the biggest highest capacity hard drives for my plex media servers all the time. No point in using an SSD; the true rapid random access benefit you get from SSDs has a totally negligible benefit when streaming data from from largely linear media. Rather the cost per gigabyte is a far more important factor in those types of applications. Also HDs are far better for cold storage backup when I just want to backup a huge amount of data on a raw drive, throw it in an HD case and put it on a shelf for 10 years.

[@sehvekah7368]

Thanks for the MAMRies, even if they're not in RAID.

[@uss_04]

Given the price drops during Covid, I expected 4 tb NVMe 3.0 SSD’s at $140 by 2022 but it seemed the driving forces stalled it out

[@LeonAlkoholik67]

"more reliable" Yeah no, SSDs aren't more reliable than HDDs. I feel like many people either keep buy bad harddrives or don't know how to handle them carefully. I also can't write many Petabytes of data on an SSD, without having to worry about it's lifespan, while HDDs don't have a problem with that at all.

[@aryaman05]

😊What a timing, just done reading The Innovator's Dilemma !

[@buzzworddujour]

big fan of MAMR-E’s personally

[@marcfruchtman9473]

Thank you for that historical background. I guess my big concern would be longevity of the data with the heating of the media...

[@kenoliver8913]

It only heats when reading and writing. As a near-offline or offline archive medium it is not an issue.

[@marcfruchtman9473]

@@kenoliver8913 ok so, not for a server needing to use the drive for regular R/W ?

[@alexlefevre3555]

I have a 2TB and 1TB NVMe drive running my OS, software, and other things I just never copied to larger drives. I have a 6TB and 12TB SATA drive as in system storage. I have several 2TB external USB drives and a handful of 1TB NVMe drives pulled from broken/parts systems in USB adapters for additional external storage. This is on top of 24TB in a NAS. I store a ton of media and have a massive collection of game ROMs that I serve to several in home game consoles as well. I would hate to afford all that storage in SSDs. I'm looking forward to finding second hand enterprise 20TB+ drives!

[@koojaba5911]

I truly believed HDD hit it limit of 3.5" space, if they not bring back 5.25" format (like quantum bigfoot series) to the standard its will be end soon before 8TB SSD price hit $300-$350.

[@EhrenLoudermilk]

HDD is so cheap that its going to be around for a while.

[@v12alpine]

instead of increasing density how about decrease cost... just an idea? focus more on reads than writes....for cold storage.

[@SpaceCakeism]

I still use HDDs... Unless there's some stupid good sale on mid-tier+, with high capacity, I'm far more interested in HDDs, as I just want a lot of storage space, and very little of that archive actually benefits from being on an SSD; I also tend to recommend HDDs for mass storage as well. However, it's not like I'm rich and buying a bunch of HDDs every day, so no way that'll show up in the chart at the beginning... P.S. Heard a while back, (might be from here? I follow a lot of tech channels...) that the HDDs have practically reached the limit of the technology, so the industry leaders are looking for alternatives, and one of the candidates is actually magnetic tape storage, not too dissimilar from VHS... Kinda weird, but also kinda cool... Although, tape storage comes with the demerit of... Well, being on a spool, so takes longer to access files.

[@yourcalicocat]

i had to scroll down forever just to find another HDD user

[@TWPO]

Holy shit this video is loaded with info with no fluff and I'm here for it. Excellent job.

[@JanekWerbinski]

HDD still wins as backup, mass storage and long term data storage. At 10$ per TB it's even cheaper than magnetic tape. SSD have two disadvantages: price and degradation of data in unpowered discs after only few months.

[@alexz1104]

Another great video from Asianometry! Would love to see a video on DNA storage. If you have a Bitcoin lightning address, please post it in the description so people can leave tips. Zeus is a great wallet. Not everybody can use Patreon or credit cards and I would love to leave tips on your videos. Thank you!

[@rollinwithunclepete824]

Good video, Jon. Always interesting the subjects you find to explore.

[@cfpai]

Just caught up with a friend who recently left WD. Seems like the HAMR thing isn't making much progress, and there's talk of a major structural shake-up at WD coming soon.

[@florin604]

Old faithful

[@LiveWireBT]

I see, so in the last decade, because SMR performance was so poor that customers mostly rejected it and HAMR/MAMR not being production ready, they basically stacked more platters into the enclosure, which looked unusual in 2.5 inch an was not feasible there. Let's see how long 3.5 inch drives can survive. Full Flash RAID sounds cool... or ridiculous, but with consumer M.2 drives and temperature throttling it's not always so easy.

[@ronaldgarrison8478]

5:23 I think the currently popular phrase is "fuck around and find out."

[@fanis4093]

magnetic tape seems to me extremely obvious. It just brute forces having a lot of area. And the cassette itself is extremely simple. You just buy more tape for more storage. The problem I see it had the previous decades was until you made a return on investment it was already obsolete. The other problem was that since it lost the mass market it was not doing well at competing with price. With reaching the physical limits, the obvious solution should have a comeback.

[@Punisher9419]

I think the problem is that SSD's aren't cheap yet for the hgher capacities. If you want 16TB+ of storage or even just 8TB it's just so much cheaper to buy a hard drive then an SSD.

[@henryisnotafraid]

Ha!! I had that exact same OCZ model SSD. It was the first one I ever bought, from Newegg, to go into an old HP entertainment laptop 😊

[@shephusted2714]

personally i think hdd are basically dead - ssd/nvme are starting to take over and already offer much higher storage capacities as well as much faster i/o - this trend should continue

[@halfsourlizard9319]

So, tape storage isn't really an alternative for most HDD applications -- for precisely the reason that AWS has both S3 and Glacier ... they're VERY different points in the cost vs usability design space.

[@mathew2214]

I still have my Hitachi hdd array. When it finally dies in another 20years, itll be time to say goodbyte to spinning platters once and for all.

[@anonamouse5917]

After my 4TB Samsung 850 EVO developed failed sectors I decided to give spinning rust another chance. WD 10TB Black and 8TB Blue are surprisingly fast and cheap. I've never had a WD go bad on me (other than the ones I dropped), and I've owned at least 20 of them over the years.

[@SimpMcSimpy]

You are not the only one. I had 2TB EVO which started showing bad sectors after just few months of casual use. Then I found out Samsung had several series of those drives where they did some production errors. But nothing betters situation with Corsair drive which after 1 year is already down 5% due to cell degradation. I switched to 7200 / 512MB Toshiba drives with 20TB of capacity and I am so freaking happy. They are fast enough and reliable. I just keep small capacity SSDs for OS (which I can replace after drive degradation is large enough). In my storage room recently found some of my old 3.1GB and 5GB drives, 25 years old. Plugged them in and still working like new with zero bad sectors.

[@TruthDoesNotExist]

We finally found a use for NFTs