This robot took DNA Sequencing work from humans and this is a good thing!

I tried to understand the meaning of life. …and by that I mean how to sequence DNA
Matt Gray | mattg.co.uk | @MattGrayYes
This video is sponsored by my patreon members, join here: / mattgrayyes
(Payment not required but greatly appreciated)
📄 Credits 📄
Series Producer/Director: Cambria Bailey-Jones
Camera Operator / Editor: Jamie MacLeod | www.jamiemacleod.co.uk
Sound Design: Dan Pugsley | www.cassinisound.com
Captions: Jacob Salas | caption.plus
Executive Producer: Guy Larsen
A Matt Gray & Penny4 Production www.penny4.co.uk
Special thanks to the team at The Francis Crick Institute: Clare Green, Maria Rodriguez and Ashley Fowler. You can find out more about the Hello Brain exhibition here: www.crick.ac.uk/whats-on/exhi...
Attribution:
03:57 - © www.myupchar.com / Wikimedia Commons
04:00 - © Mstyslav Chernov/mstyslav.com / Wikimedia Commons
04:03 - © Claude Truong-Ngoc / Wikimedia Commons
📱 Follow Matt elsewhere on the internet 📱
All my social links are at mattg.co.uk
chaos.social/@MattGrayYes (Mastodon)
/ mattgrayyes
/ mattgrayyes
/ mattgrayyes
/ mattgrayyes
💷 Advert 💷
This video has no adverts or sponsors.
Want to contribute towards my videos? Sign up to my Patreon: / mattgrayyes
Want to sponsor a video? More detail here: mattg.co.uk/contact/
💸 Full Disclosure 💸
💷 All Amazon links are affiliate links which give me a small percentage of what you pay them as a tip for sending you their way. It doesn't cost you more.
📹🎙️ Kit I Use Regularly 🎙️📹
Sony ZV-E1 Camera: amzn.to/3Tac43V
Sigma 24-70mm F2.8 DG DN Art Lens: amzn.to/49Zp9Db
Peak Design Cuff Wrist Strap: amzn.to/2PdKTXh
Røde Smartlav+ Mic: amzn.to/2H1CEVJ
Røde Wireless Go II: amzn.to/445Hk6h
Røde Charge Case for Wireless Go II: amzn.to/47W0JIN
GoPro Hero 11: amzn.to/3t8izcR
GoPro Hero 9: amzn.to/3NDWkmP
Sony a6400 Camera: amzn.to/3rxLpwl
Sigma 16mm f1.4 lens: amzn.to/3tYYBvZ
Sony 16-50mm F3.5-5.6 Lens: amzn.to/465T5M5
Sony RX100M2: amzn.to/2JcxQxt
iPhone 15 Pro: amzn.to/3RchQ2C
Snapchat Spectacles (Circular video): amzn.to/2GQ6AXc
Tascam DR-10x Audio Recorder: amzn.to/2pXQZun
Røde NTG2 Mic: amzn.to/2GHS3gi
Røde Videomic Go: amzn.to/3m1jQKP

[@MattGrayYES]

What would you say is the meaning of life?

[@boozytortoise]

42

[@friney23]

42

[@nbmrbluesky3688]

42

[@ConnerADavis]

It's actually 43. Deep Thought had an uncaught off-by-one error.

[@shellturner6857]

42

[@MicroBlogganism]

For anyone wondering, yes, giving your expensive lab equipment silly pop-culture names is very common

[@sundhaug92]

One of the treadmills aboard the ISS is called the Combined Operational Load-Bearing External Resistance Treadmill, or COLBERT for short

[@LevsOnTheBevs]

I've seen microbiology cabinets named after big bang theory characters...

[@hammerth1421]

And if things suck, they're sometimes given derogatory names as well.

[@KX36]

I used to work in a lab with 3 old overworked analysers that were always breaking down. They were called Ted, Jack and Dougal.

[@AdamMansbridge]

You've got to have a naming scheme

[@pileofstuff]

Matt out standing in a field while thanking the people who are outstanding in their field...🤣

[@whyamiwastingmytimeonthis]

I’d be VERY disappointed if the car he drives is not matte gray

[@titanlim8303]

@@whyamiwastingmytimeonthis The MattMobile (as seen in Breaking The News on Tom Scott's channel) was blue unfortunately

[@whyamiwastingmytimeonthis]

@@titanlim8303 NOOOOO

[@JoshWright396]

The "pause and explain" mechanic is so simple, but so effective

[@TheHuesSciTech]

That Novaseq 6000 machine (the big one) is even more impressive when put in historical context. The Human Genome Project was a landmark scientific achievement to sequence a complete human genome. It took over a decade, running from 1990 to 2003, and cost about 3 billion dollars. That's just for one human genome. The Novaseq 6000 can over a dozen Human Genome Projects in a single weekend session.

[@winkletter]

If only they had sequenced Matt's DNA we could have found the source of giggliness.

[@singerofsongs468]

I love the guitars-as-meters graphic at 4:41. All of these little touches of user-friendliness and personality make this series so special!

[@jacquelineliu2641]

r/AnythingButMetric

[@althejazzman]

I checked this against my actual guitars and it's surprisingly consistent. I never knew!

[@CoolAsFreya]

Another interesting thing about gene sequencing not mentioned in this video, the machines sequence chunks of DNA of arbitrary lengths, but the way they assemble the chunks together by looking for overlapping parts is challenging and fascinating!

[@gljames24]

I took a CS course and that problem is quite literally NP Hard in complexity. One of the strategies is called the smallest common superstring which is like trying to solve a puzzle with redundant, but overlapping pieces.

[@idk01123]

How the hell has the algorithm not picked up your videos yet? This is incredible.

[@sundhaug92]

Re the flu, part of the reason they need DNA-sequencing is that you need to know which strain of flu is coming, and predict it what's gonna be needed in x months when vaccines etc can be ready, and it can show the family-history of the sample

[@LevsOnTheBevs]

Phylogenetics and molecular epidemiology is so vital to outbreaks- I'm more bacterial now but either way looking at SNP changes over time!

[@FlamingMonocle]

Matt, I genuinely hope your 'Matt is Trying' series blows up in popularity as it well deserves. I am not particularly financially well-endowed, but you can bet I'm telling everyone I know about it. I particularly enjoyed your road painting ep recently. Long may your trying times continue!

[@SamuelGeist]

Likewise! I've shared this with my friends and family as Matt's style and enthusiasm is sure to be a hit there as well. :)

[@Spiteflavoredsprite]

I want to also thank you for going through the extra effort of hiring someone to caption the video, as someone with an audio processing disorder it made for a much easier and smoother watch and helped me understand this fascinating subject in an easier way

[@itskdog]

After Tom's rant, he'd kinda be in an awkward place if he didn't, but I'm sure he also does it legitimately as well - he seems too genuine in his reactions to do it just because of the expectation.

[@sundhaug92]

If RNA sounds familiar after COVID, a lot of the major vaccines against COVID basically came with RNA that said "hey, make this spike protein", and the spike-protein is something your body can later recognize (as long as it's the right type of SARS-nCoV-2 for the vaccine)

[@madaian369]

Can you imagine how scifi this all would've been just a few decades ago? Like there's a DNA sequencer that fits in your pocket!

[@KX36]

Just 2 decades ago the human genome project was a worldwide effort that took researchers all over the world 16 years to collaboratively sequence the human genome using quite manual techniques, Sanger sequencers, a lot of gel elecrophoresis and toxic chemicals. Now it takes 2 days and costs about £1000 to sequence a human genome.

[@diribigal]

Mandatory GATTACA reference

[@tumbledryshoes]

Buffy the Genome Sequencer 🤣 Such a cool video! It's amazing when the real thing outdoes the sci-fi renditions.

[@juliajean6731]

I love the "Out standing in their field" joke X)

[@KX36]

field

[@juliajean6731]

@@KX36 thank you X). English isn't my forst language

[@smugly6793]

I’m always impressed by your ability to just….end up in really cool places I understand it takes lots of planning and communication, but I enjoy thinking of it as just stumbling into a lab and getting the press treatment

[@JohnRunyon]

😂 i took a class in college named "cellular and molecular biology", i wasn't expecting to learn how to sequence DNA, but i did and it was fun (We didn't have robots to do it for us though)

[@janmcclure6239]

Your team is so good at explaining technical topics

[@ben0329]

The graphics explaining everything are so well designed!

[@c222]

I worked at a genetic sequencing company that used Illumina machines. Alongside scientists with impressive PhDs, I helped build the analytics software that took the GACATGCAGTC and turned it into more understandable information. Every ~40 hours the sequencers would produce Terabytes of data and the lab technicians that kept them running were invaluable.

[@SamuelH2020]

A Matt Gray a day keeps the existential thoughts at bay!

[@evan]

Matt Grey deserves 100k subs right this instant. This was so swish in quality

[@_Mute_]

I would like to congratulate you on the achievement of creating and publishing the best thumbnail of 2024. Hats off

[@Divig]

Matt, you are really good at explaining complicated things in a simple manner.

[@jurriendevries3673]

"What is really cool..." is everything there! Holy moly!

[@redmondgurney]

This is so well produced and well explained, I need you explaining all complicated concepts

[@PinkSupervisor]

Man, that production value.

[@lottievixen]

thank you for subtitles! and colour coding them, didn't know youtube even supported that. continue being great and having fun Matt

[@fat_vegan_slim]

I was literally just thinking about when your next video would come out, and bang! Notification!! Loving watching your "adult work experience" ❤

[@peter_smyth]

It's cool to see Matt enthusiastically geeking out about my day job.

[@idk01123]

You talk about people outstanding in their field while standing out in a field. Excellent.

[@MudakTheMultiplier]

You remade that stock photo for the thumbnail and i love it.

[@inquries]

Very fun video! Especially as I do DNA Sequencing for my job, was using a Miseq today 😁 Cool to see all the different equipment and technologies

[@LevsOnTheBevs]

We do this super routinely! I've just finished my masters using DNA sequencing to detect convergence between multi drug resistance and virulence in a specific bacteria (resistance to antibiotics and how scary/damaging the thing is, basically). We got samples from Sudan, and working on the DNA let me see that the both types of scary genes are present in one sample- not good but hopeful for the future! I've also in the past had to send off samples for sequencing just to check if things I've done have worked or not. The Crick is very cool and while my PhD isn't going to be there I'm sure I'll be working with some scientists from there at some point!

[@heyitsgwen]

thank you matt I now understand the meaning of life

[@devinholland2189]

How on earth did you jump from making ice cream to DNA sequencing. This is the most eclectic channel, bells on im here for it.

[@autumn_west]

Matt, your excitement at so many things is infectious! I love it

[@gljames24]

During a CS course I had to prove a problem was NP hard complexity and there was one actually relevant to gene mapping. It is called the smallest common superstring. Essentially it was for finding the smallest sequence given a bunch of fragments which is what you end up with when you break apart the genome and have multiple copies of the same section.

[@andrewwmitchell]

Thanks, Matt. As always your enthusiasim is infectious. This one was absolutely fascinating.

[@Spiteflavoredsprite]

Loving the editing in this, and the explanations are very clear and accessible! Great video and really interesting subject

[@SPUDog]

The animations are so well done, I love them

[@actuallyneon]

I like how Matt is wearing a "Swifts" t-shirt while the eras tour is ongoing

[@abigailcooling6604]

Woah, didn't expect that tiny pocket-sized sequencer to appear. It does the same job as the big ones but its so *small* 🤯🤯🤯!?

[@MsBlulucky]

Little mistake at 2:55 : RNA contains U (uracil) instead of T (tyrosine)

[@MrStupidPantsEv]

I enjoy you posting these Matt. Thanks for doing them

[@l.n.4929]

My brain likes the descriptions and systematic You are here-references. I like the rest od the video as well.

[@AlRoderick]

This is great stuff. I remember when I was in high school back in the 1990s I was in the robotics class, we took a tour of a local pharmaceutical research company that was using robotics for sample prep. It seemed to be very early days at that time, the robots were using tools like mechanical pipettes that were intended for human hands but were adapted to be actuated by a little solenoid or air cylinder. It seems that the dedicated design of robotic tools for laboratory work has come a long way. The thing you have to understand about robotics is that they fill a void that didn't exist previously between an automated machine that mechanically performs the same task almost perfectly and very fast for years with just some maintenance but can't be changed to do anything else and the universal things like the manual tools used in a lab which can be used to make basically any setup but requires hands-on use by a technician. The small robotic production line might need to do the same job thousands of times over the course of a few months or years but it doesn't have to be scrapped. When the needs of the project change, you can reprogram it and it can perform a similar task or an entirely different one.

[@AroMaths]

As a microbiologist, it always amazes me, to see all of those machines where we send samples to be sequenced. Even after using them myself, it is still unreal to think what science has achieved in the last 50 years. 😊 And even if you only compare what methods there are for sequencing, from Sanger sequencing to Illumina Solexa and rather new techniques like Oxford Nanopore. Lovely!

[@AroMaths]

I got to say, I love your videos but this hit my heart differently 🥰

[@cemace90]

The meaning of my life is my family and friends but I think, on an individual level, it is unique to each person.

[@Oivaras]

It's amazing how you get into all these fascinating labs, really futuristic stuff, awesome.

[@uzetaab]

I'm really enjoying this channel. I hope it continues to grow.

[@hammerth1421]

I literally study chemistry with a specialisation in biochemistry and still, Matt beat me to actually sequencing DNA myself! It's kinda fun to see the devices on video that do the things I've spent lecture after lecture learning about though. Flow cells, ddNPs with fluorescent markers, nanopore sequencing...

[@that_teegor]

Matt how is it that your awesomely well produced videos are not blowing up more??

[@jagg88]

Love the experts in their field while in a field

[@pistonsjem]

First time seeing different colored captions thats great

[@0xTJ]

I didn't have the slightest idea how DNA sequencing works, and wow, it's even cooler than I expected! I also can't help but wishing that I could use that robot arm to make my coffee and breakfast.

[@cemace90]

This is awesome!

[@vacronda]

Another Matt video!!

[@devttyUSB0]

Thanks! Very interesting video!!

[@_Piers_]

That was great Matt. Not the sort of place people normally get to go to, well done! :)

[@kleinesren7064]

brilliant! Thank you for such a good video

[@obansrinathan]

There appears to be an error in the figure at 11:54. She stated that all the colours are added at once, but each molecule of dna only has one attach each time, but the figure shows all greens added with them fitting all over the molecule. As a complementary strand of dna is made, the new nucleotides(the little bits that make up dna) have to attach to both their pair as well as a neighbor that already is attached. Thid way of sequencing DNA takes advantage of this, so a load of all four nucleotides modified to be coloured and not able to have another nucleotide attached after them are mixed in so the growing strand gets one nucleotide longer and is now the right colour. Then a photograph is taken, and the slide is treated to get rid of the colour and make it so that the nucleotide that was just added(and has now had the colour removed) can now have a new nucleotide attached after it. Then the process is repeated.

[@danjoseph9857]

"Out standing in their field" 😂

[@nex]

Oh dear, I accidentally scrolled past this yesterday because I mistook if for the Matt Gray Is Trying video from March from the same place. But earlier I saw your post on Mastodon and that set me straight ^_^

[@0utOfSkill]

Great video! I really hope you find a way to make this series financially viable :)

[@PeloresanterOctagenarima]

You've got a great style!

[@Thawney]

another delightful video :)))

[@DAveShillito]

10:05 Outstanding in their field 💜

[@snowyshade0901]

For the algorithm, to pick this video and share it with more people.

[@Onio_Saiyan]

42?

[@toamastar]

very fascinating!! :)

[@BrakeForLoop]

That's so cool!

[@funtaril]

What a time to be alive

[@opaqueentity]

Great video :) Is funny that I knew exactly where he was before he said

[@tbrooke3016]

My science teacher taught us to remember the base pairs (AT-CG) with the acronym All Terror***s Carry Guns

[@freespam9236]

no PacBio machine? what a lame lab j/k but on real note - really cool lab with it's robot arms to reduce the "move stuff" work

[@607]

4:11 THAT SCREENSAVER (it wouldn't work too well as an actual screensaver, though...)

[@MartinAhlman]

"I'll take the blue ones, and you'll take the blue ones, and Matt will bein prison befoooooooore me!"

[@Mergatroid]

Happy pride month from one enby to another!

[@eeveepro9171]

The answer is simple 42

[@andrerenault]

Amazing video as always! I’m curious what the % error or confidence on these tests are, anyone know?

[@LevsOnTheBevs]

Depending on the type- for this one (illumina) you have multiple short reads which increases accuracy so it can be around 99.9% (higher read depth means more accuracy), but it struggles with reading repetitive areas for example. Others like nanopore are better at repetitive and structural stuff but have lower accuracy- ideally you do both! Source- just got a first class masters in biomedical science and going to do a PhD in microbiology later this year!

[@FelineBlender]

Base calling errors are more likely further into the reads, at least with illumina technology. Certain strands within a cluster on the flowcell will slip one base ahead or behind where they should be and you're getting blue signal or no signal where you should be getting green. Since each cluster should be monoclonal and sending out the same signal for each SBS cycle this causes a muddying of the signal that we call 'cloud collapse'. The latest versions generally still have less than a 1% error rate at the end of a paired end run. That then gets boosted by coverage depth, or how many different times any given region will have been read after all the different clusters are analyzed. 30X depth is pretty typical, so you are extremely likely to get the true answer.

[@pandaman144.]

wait, y'mean its not 42? im shocked! shocked i say!

[@althejazzman]

10:12 Where can I buy the t shirt off the cats wearing space helmets?

[@arjovenzia]

It's funny, science n engineering folk can be extremely superstitious. It's a bit like every ship needs a name, and it's very poor form and bad luck not to be named. In my electronic engineering workshop, we had a selection of adhesive googly eyes that was an integral part of the commissioning process. Very serious conversations were had in the lunch room about what their name aught to be, almost like when the family gets a new puppy. My personal favourite was Steve, a wire cutting/stripping/crimping machine, whose eyes were mounted on the knife head. Once you got all the perameters dialed in you could really crank up the speed of it, he'd chew through thousands of meters of wire with all the enthusiasm of Cookie Monster after 5 shots of espresso, eyes goggling wildly, bits of plastic and copper pinging off wildly. My least favourite was Gary, our CNC glueing machine. His eyes were on the glue dispensing head, whose eyes spasamed every time he barfed out a gob of goo, like your mate who drank to much and is puking his guts out into a convenient bush on the walk home. Which is fine, but he was very fussy to get set up, constantly getting blocked n showing nonsense error messages, or barfing toxic goo in all the wrong places. There was a little measuring stick by the nozzle to help you set up the height correctly, which somebody added a tounge mad of red electrical tape. Really sold the image of being violently sick everywhere.

[@NorbiPeti]

Feb 21 heh niiice, really cool stuff

[@davetreadwell]

MATT! Where did you get your teeshirt that you were wearing when you were out-standing in your field?

[@derbazi257]

Buffy and Angel is just so bored-stem-people stuff ^^

[@Lizlodude]

The comment on text files reminds me of xkcd 2298 😅

[@b33thr33kay]

How small is the resolution of those cameras that can distinguish one nucleotide from the next in the sequence?? Or are they using some image processing tricks to "fake" this super resolution?

[@obansrinathan]

Matt slightly misunderstood how the sequencer worked, but essentially each DNA molecule only has one colourful nucleotide attached at a time, so it only needs to be able to resolve which DNA molecule is glowing rather than where on that molecule its glowing. Further the colour will be something that fluoresces quite brightly, making it easier. The resolution will have to be enough that different attachment sites will have distinct glowing bits. There will of course still be some image processing to extract the data and then loads of data analysis to actually get the sequences.

[@OutbackCatgirl]

MATT PLEASE WHERE DID YOU GET THE SPACE CAT SHIRT

[@evlli2342]

okay but how do you reassemble all the segments o.o i recollect it being a lot of statistical matrix multiplication to guess where it belongs but I only helped run the HPC Clusters and never looked at the algorithms back when I worked for a large university.

[@route2070]

Wait, when did they discover the cause of IBD? I got diagnosed with that in April. And I guess when did they find?

[@JosephWithaG]

Just watched the intro, and I'm surprised they need a big robot! Why, I could use scissors to ruin my own human jeans if I wanted to!

[@i.gaskoid]

Me, a bioinformatician: OH BOY

[@nocomply27]

How do people even think up how to do this, never mind design and build the machines to do it? I've never felt so stupid 😅

[@faenethlorhalien]

42

[@FamilySpeakUp]

Life has no meaning, you give life it's meaning, by the way you treat others. Give your life a good meaning, by treating others good.

[@craigwatt1303]

42 matt the meaning of life is 42.

[@SArthur221]

The Meaning of Life. Part VIII. ACACCACACATGACAGGCTAGCATCGATGACGATTGCTCGATCAGCTCAGCTCAGCACGTAACT