Virtual Riot - Earth & Sky (Fan Music Video)

[@sfhanims]

I guess this guy freed his body and his mind

[@xXalantalmaxX]

That's what I need

[@Sixelalebeau]

Brrr boam boam boam brrr yoop boam boam boam (Yes it was Virtual Riot '^^)

[@fawdable]

Now that I think about it... I actually really like this video. when this came out I thought it was strange and a bit random, but now I see that this was the purpose. The song starts of with a peaceful synth and melody with an zen-ish concept as to be relaxing and soothing. Then with the drop comes, you get this muddy and dirty growl that completely destroys the chill vibe of the song with nearly the opposite of that. With the video, they had beautiful scenery with a colorful van clearly sticking out from the green in the scene. The when you get the drop a guy in a horse mask jumping out of the van disrupts the calmness of the video and fits perfectly with what the song does. So, great video!

[@nonoachim]

Nice interpretation.

[@jensonbbenson]

+Meowth Thats Right or or or it's just a guy jammin in a horse mask

[@verticallychallenged1816]

Yeah

[@erroldkimcruza1662]

the first glitch hop I listen back in 2014

[@ShimiiyDev]

+1 Like for... >Virtual Riot >Nature >Glitchy film >Horsehead and more...

[@Wuguilia]

:)

[@TheT-800]

Shimiiy and a VW Bus

[@juannsebastian]

Cant believe this is 6 years old now and only has 130k views

[@guillermogonzalezcorona7780]

Esta canción y este video fue el primer contacto que tuve hacía Virtual Riot en el 2016, actualmente es mi ídolo el cual me inspira a ser mejor cada día, seguir mis sueños, darlo todo durante todos los días y nunca olvidar tus raíces

[@doylikeycomento5832]

Hombre de cultura, yo veo que eres, yo conocí a VR en el 2016 más o menos por Energy Drink, hasta hoy sigue siendo mi ídolo también.

[@verticallychallenged1816]

Well said

[@riokshutt2115]

​@@doylikeycomento5832 yo igual, re fan me habia vuelto de él

[@7REY1017]

This used to be my favorite song growing up holy shit it’s been too long! The second it kicked on it all rushed back. Man thank you so much for all the memories and music from my childhood. Brought a tear to my eye can’t even lie 🥲

[@seanmcoyle123]

Your amazing should be on the charts #1

[@razerfirebeatz168]

AMAZING I LOVE IT THAT'S CRAZY

[@asery8673]

My dear childhood, miss you so much

[@7REY1017]

I’m right there with you. It’s been too long since I heard this 🤍

[@asery8673]

@@7REY1017 ^^

[@pretzel6629]

@@7REY1017 me too : (

[@annisun69]

Man keep up the good work. i'm kinda sad because almost all the great dubstep producers are currently inactive. I want 2012 Dubstep to return :(

[@ravenclawrules2092]

3:28 To hell with your coffee! I AM THE WUB WUB HORSE!

[@samawol4161]

love the song and now that ive seen this (fan made) video clip, I love this song even more

[@coelacanth6398]

I remember having drawn this van under every angles from this video, this song brings back good memories

[@tebsel3541]

Still one of my favourite VR's.

[@Kackjes]

Gratulations for 100k subs

[@TheMogules]

love this melodic at 1:56 - 2:15, hope u can make some more music using that melodic featuring someone.. gonne love it

[@davidfoley1204]

I knew it! filmed in Ireland, it gives it away at 2:57 with the Irish number plate! the area looked Irish too...

[@myusername3162]

This is an insanely amazing music video

[@12shimonster]

WTF the car changed color!!!!!!! what kind of black magic is that? O_O

[@12shimonster]

***** dont ruin it XD

[@isnitjustkit]

Ts also different people (or creatures) driving it

[@Lukjasss]

hacks

[@12shimonster]

De Top Miners XD

[@tylerg.4303]

Game-hacks

[@fkathejuicebox]

THE SHOT WHERE HE'S LOOKING OFF INTO THE SUNSET IS SO GOOD

[@sk8rboy959]

Obviously, a dancing man on drugs with a horse head is the best idea for representing a song by virtual riot..😁😅

[@JutavisOfficial]

so ein schöner alter wagen... hat die ehre in diesem Video vor zu kommen :)

[@nonamenoname6594]

How to make drop???

[@bigusdicus9004]

Sooo good, best drops ever please never stop doing what youre doing.

[@glauk123]

this clip is sick wtfffffffff

[@dommizle]

Dang, that scenery looks beautiful :)

[@Chainsawerman]

I love this track!

[@WackAttack]

Pretty guud. ヽ༼ຈل͜ຈ༽ﾉ NOW WE RIOT ヽ༼ຈل͜ຈ༽ﾉ

[@SWFBrickbox]

YUS /╲/\╭( ͡° ͡° ͜ʖ ͡° ͡°)╮/\╱\

[@gregthomas8746]

Here's a riot for you ( ° ͜ʖ͡°)╭∩╮

[@Unwedged]

Its so cool to see people dance like no ones watching...but then this actually got posted to his channel and everyone's watching, great vid though lol. #StartARiot

[@fujiwarachika2187]

Amazing song and video! I enjoyed watching this so much :)

[@Banement]

01:36 I love the sound of that.. Effect/sound :) that's why I love this song.

[@CmanGrunt]

I miss Ireland so much now!!! I took a trip there last summer, it was so much fun. :)

[@kristinoconnor1282]

WOW.

[@redwoodenjoyer]

Haven't heard this in like 4 years but its when I learned to code so thats a nice memory.

[@VitazNetworkRecords]

That is an unique music video... Like it! :DD

[@MrCadaaa]

Beautiful scenery out there :D Fan-made is always fun!

[@xXAristoMoviesXx]

Oh wow, this vid just made my morning hehe.

[@MsDestroyer900]

this is the most beutiful thing ive seen so far

[@ervinzhou8251]

Where do I buy this teleporting bus

[@graykimchi]

At Tai Lopez's secret garage

[@musicchannel9256]

That cracked me up so bad.... god damnit

[@NicolasJudge]

This video is freakin' feelgood:) Luv it.

[@dethswurl117]

Your music never fails to impress my ear drums

[@josh.kent_]

So awesome virtual. You make it look so easy to make this stuff ;( I know it's not. Especially your music :3 But yeah your really really amazing ;)

[@Itaishii]

Jawoll Virtual Riot wird wieder Aktiv

[@issintf925]

Elfien lied!!!

[@Xeron25]

Nyu

[@leaaaaaaa]

Du schon wieder. It's fucking Zomboy. :D

[@Itaishii]

Daniel Aronson Überall Elfen Lied fans, ihr seid die besten ^-^

[@Itaishii]

master_pat Ich bin überall und nirgendwo ... :D

[@JSZylox]

Best. Music. Video. EVER.

[@cranttime3088]

Sehr gut gemacht:) Tolle Leistung!

[@Jocee888]

Awesome! :D

[@heinzmomper1476]

A very good music video. I like it :)

[@CasperGriefChannel]

*Суперский трек* *;)*

[@reviveddead_]

0_0 русский

[@Leock]

This looks like a loc in Scotland but it 100 % in the British Isles guys the road has white dotted lines and there quite obviously driving on the left hand side.

[@hadangthanhhung2007]

I love this music

[@BlogPlays]

nb Junge! Super. Deine Musik ist übrigens mega. Nur zum weiterempfehlen! ^^

[@UZGAMER99]

Really AWESOME.

[@mjscherer7]

I love it keep the music

[@defeatedbyego758]

You never disappoint. Fucking awesome.

[@DesignerVictorChavez]

is a beautiful♥ sick! i LOVE :') simplemente increíble y único♥

[@EdmTriforce]

Hahaha this is a very good Funy, Beautiful and Happy video if you know what I mean :)

[@Blue72l]

My love this song❤, first dubstep song when i hear

[@catorcek8464]

Pleno coronavirus y sigue sonanso este gran tema.

[@jonathon6266]

OHH Lads the new best dancer over here!!!!!

[@SENHEL]

2:09 Utopian life :)

[@analog_dreamer]

This melody is F0CKIN AMAZINNNNG

[@guillotine]

That was the most unexpected thing ever

[@artfxdnb]

Hahaa nice video, must feel great when a fan makes this! NOW WHERE IS MY FAN MADE VIDEO!! **RAGEQUITS**

[@SilverCubeTV]

You'll get one for Funky Space Cadet. In time :3

[@artfxdnb]

***** Ooohh I can wait. O=]

[@fawdable]

Hey, looky who it is. Great tutorials, man.

[@DontoPivotDude]

Because you suck. jk

[@GendaArts]

Look who's there !

[@Sunkhrist]

Where is this place at, and why am I not there...?

[@adamscott49]

So this is Horsestep then?

[@AnstonMusic]

Oh hell yeah, the horse mask will never get old!

[@hueyr-c4790]

Amazing

[@anaschillin]

3:30 Makes me laugh everytime

[@issintf925]

Horse hat? Check. Volkswagens? Check. I guess it is now officially an amazing video.

[@issintf925]

Gotta love them 2012 vw buses from Brazil!

[@ghostmiyu]

I LOVE IT

[@m4r1o148]

I expected the video to be made by NBF when I read "Fan-made Music Video." Similar, but still awesome either way. :D

[@brendyn7282]

Anyone get the chills from this kind of music?

[@FormantVEVO]

Yes I do. o_O

[@RedGatack]

This is the only way I can listen to this song now, by watching this music video. XD

[@xxBOJOMANxx]

this should be the official music video.

[@chickencurrybros8829]

That's one hell of a inspiring horse!

[@derangedcrouton1864]

Oh I miss these days

[@Thenextphasemusic]

Interesting video :D

[@thatoneneko5985]

I did not see the horse coming. 300th view

[@skylarfox_bmb]

0:00 This is beautiful music... 1:14 This is beautiful music on steroids...

[@webheroes1484]

Kann ich deine Musik für meine Videos verwenden ?

[@nathanreddecliffe9968]

Best thing I've ever seen in my life: 2:46

[@linkinparkrocker11]

I LUV DIS

[@мадамксено]

Шикарно:3333

[@LukasRegelt]

Was ist mit Gangster? Es ist auf Soundcloud und iTunes aber nicht hier. Ich nehme mal an das man auf KZbin am meisten nachsieht ob VR ein neues Vid hat ;)

[@garagebandguy7722]

I live in wales where this was quite obviously filmed

[@garagebandguy7722]

+UhlFilmsStudio yes it was. ur probably american and dont even know what wales is...

[@garagebandguy7722]

***** where was it filmed then? I'm quite interested to know.

[@VirtualTurtleGames]

Is that filmed in Ireland? Or something like Norway or Sweden?

[@interalia_0]

Germany i think

[@marianpanayotov4448]

or Bulgaria

[@ines8546]

It was in Ireland :)

[@VirtualTurtleGames]

***** Haha amazing :D I was there for a holiday, the landscape is amazing :D

[@myrtnOfficial]

Steefen Turtle It clearly says "GB" on the license plate.

[@AtrixAtr]

I wish I had friends like this. My current ones hate electronic music and I cant find anyone irl who knows about Virtual Riot.

[@elruso2312]

can i use your songs in my videos??

[@EmeraldTech100]

Nice video BRB

[@Banement]

Christ..This is my favourite song in the universal and it's so nostelgic when I listen to it; reminds me of my old old Garry's Mod days(when I had only 300 hours, I have over 1000 now).

[@lepredo]

>nostelgic also wassup

[@jonathan952000]

This is why I love KZbin

[@catcatcatcatcatcatcatcatcatca]

why drop the beat when you can just drop the whole table? why scratch the plates when you can just smash them?

[@ThistleBeaksBirdCams]

Is this Scotland?

[@Kackjes]

Wann bist du mal wieder in Elevator in Münster :D

[@LatiOriginal]

Awesome ^^

[@ChatterBox711]

So Good ㅇㅅㅇ

[@zVaiRo]

dopeeee

[@CommanderBladez]

1:16 How I feel when it's Friday :3

[@4ndyIta]

so geil alles ich tieh die mir immer rein (deine songs) sind die gema frei? :) du Wuppertaler du :)

[@4ndyIta]

ich meinte bist du wupertaler ? das wäre so geil

[@dexterr988]

what is doping ?

[@maximilianlotz3581]

did anyone else notice that the van changed colors?

[@mosazhnone]

Maximilian Lotz yup

[@OpTic_navEshoT]

Yes

[@DARKXMuSiC]

Is other van

[@mosazhnone]

_ DARKX _ Ye

[@GHOSTPRO7089]

Yeah that confused me alot