What is consciousness? - Michael S. A. Graziano

[@ShauryaSingh-ts2oc]

It's amazing that we humans are conscious enough to question What is consciousness which means that we are consciously questioning consciousness and it's reason for existence in this non-conscious world.

[@DatBoyIsAvirgin]

🤯🤯🤯🤯

[@alamrasyidi4097]

_how do you know it's not conscious??!_

[@BenTheSkipper]

my brain hurts ...LOL

[@BenTheSkipper]

i guess i'm that damn

[@Noah-nt4tb]

How are you sure?

[@user-zm5wr2zw2t]

Everybody asks what is consciousness, but no one asks how is consciousness :(

[@user-Void-Star]

No body ask why is consciousness?

[@lovediyana47]

consciousness is sad

[@frenzysporetv3431]

@Doomer The neet gloomer r/woosh

[@blackflash9935]

Doomer The neet gloomer Well it is an attempt at humor and, although a poor one, you responding to the comment, showing no awareness that it is such, means that you technically got wooshed.

[@frenzysporetv3431]

@Doomer The neet gloomer ^

[@henk-3098]

I love psychology, neuroscience and philosophy. The immensily complicated ways we perceive the world, think, feel and behave, based on millions of years of evolution, biochemistry, neural pathways and our life experiences is fascinating.

[@johnyoutube6746]

Consciousness is flow of energy

[@jeffforsythe9514]

well, the brain has never had a thought, it is merely the cockpit of the human body and the soul is the pilot.........................falundafa

[@crswoodferns]

​@@johnyoutube6746not helpful. technically electric current is also flow of energy. But we know that just current flowing through a wire isn't consciousness.

[@johnyoutube6746]

@@crswoodferns Everything is one flow of energy Everything start at one point of energy Everything in universe is flow of energy Uni=one Verse=song

[@johnyoutube6746]

@@crswoodferns Body and brain will not work without energy Brain has billions of neurons cells that generates electricity

[@tymgamerz]

My school uses your videos to teach science and life

[@maheen8282]

@parsely chicken wish 2x

[@happynessblaster2365]

Nice.

[@crazyprayingmantis5596]

Who needs school then, school is in my pocket

[@Madhattersinjeans]

@Josh W happy

[@mr.cubarinogaming8953]

Kids please stay away from that school...😂😂😂😂

[@shivambahukhandi9157]

Ted ed just keeps answering the world's most common yet unanswered questions . Thank you for all the knowledge !!

[@hydrocarbon2195]

Still doesn't answer how the physical gives rise to the mental.

[@MetallicReg]

@@hydrocarbon2195 By being literary the same. "Mental" is just a network of networks with added adaptive filters. Neuroscience, neuropsychology and neurocognition would be the answer to your question.

[@hydrocarbon2195]

@@MetallicReg the metal is qualitatively different from the physical though. Once you can describe the experience of seeing red or green through physical processes, then I'd agree. Some animals can see colours that we can't. If we know everything about their brains, do we automatically know everything about the experience of seeing the colour that is inaccessible for us.

[@MetallicReg]

@@hydrocarbon2195 _the metal is qualitatively different from the physical though._ That is called dogma. _________________ _Once you can describe the experience of seeing red or green through physical processes, then I'd agree._ The coded abbreviated signal of 700nm and 550nm wavelength. ______________ _Some animals can see colours that we can't._ Calibrated receptors for another wavelength with a similar abbreviation. ________________ _If we know everything about their brains, do we automatically know everything about the experience of seeing the colour that is inaccessible for us._ Yes. After decoding our own visual perception, it is theoretically possible to reconstruct the visual filters for e.g. UV frequencies. Since this is not technically achieved - this is not a testable theory beyond a hypothesis. We can already see how the UV vision in insects show up as contrasts of brain patterns.

[@Johnny20022002]

MetallicReg Wait so you’re saying we’ve solved the hard problem of consciousness...because we definitely haven’t. As far as we can tell the firing of neurons does produce consciousness but we have absolutely no idea why the firing of neurons leads to subjective experience.

[@kelly2fly]

The brain is manipulative. It often gives misdirections and produces false memories. You can't trust yourself sometimes. Best to write things down instead of trying to remember everything.

[@kelly2fly]

LagiNaLangAko23 I watched a video where scientists were trying to determine if we have free will or not. Based on their studies scientists theorized that we don't have free will at all. Our brains are the one that's giving us commands and telling us what to do. We are being controlled by our own brains.

[@stabloona468]

determinism wins !

[@caad5258]

nah, it's impossible for us to experience objective truth (as this video points out), so why not embrace the lie? Thats what the harry potter qoutes about

[@VerumOccultum]

If you believe that, then that is what you will create in your experience. If you do not consciously trust the very nature of your being, then the wholeness of your mental composition becomes asymmetrical.

[@Madhattersinjeans]

@@kelly2fly Unfortanately for them they're going into the realm of philosophy where you can argue up is down and down is up if you know what you're doing. There's a lot of different aspects to freewill vs determinism that can be brushed aside if you want to depending on how you define those two big terms and what you believe the ideal is likely to be. Try a bit of David Hume on the subject. We can't know anything is real but we still have to work with what we're given to our best potential so it is effectively real for us based on our own experiences. And so we can't know if we truly have freewill (however you define it) but we still have to behave as if we do. Or something like that. Been a while since I was in college.

[@sebastianelytron8450]

But how much does consciousness weigh?

[@abdullahimran6012]

Sebastian Elytron enough

[@noone7146]

But steel is heavier than feathers

[@adeshpoz1167]

*Vsauce music plays*

[@hajorm.a3474]

Less than your mama

[@arallskiant9923]

It is like asking how much digestion weight. Digestion or consciousness is expressing a process that is done by some parts of your body.

[@yeahyeahyeah4187]

As a teacher, I am thrilled by the clarity and simplicity of this explanation. Really well done!

[@jeffforsythe9514]

News flash. Consciousness has nothing to do with the brain, the brain is merely the cockpit of the human body and the soul, the self is the pilot, the brain does not think, Falun Dafa.

[@jeffforsythe9514]

The brain has never had a thought, it is merely the cockpit of the human body and the soul is the pilot.........................falundafa

[@jeff_forsythe]

We all have a divine primordial soul and when we are awake, our soul is conscious and when we are asleep we are not conscious, what is so difficult? The brain does not think, it is just like the cockpit of an airplane and the pilot is the soul...................Falun Dafa

[@sukhrajsohal1397]

"I regard consciousness as fundamental. I regard matter as derivative from consciousness. We cannot get behind consciousness. Everything that we talk about, everything that we regard as existing, postulates consciousness." -Max Planck (Father of quantum theory and Nobel Laureate) "As a man who has devoted his whole life to the most clearheaded science, to the study of matter, I can tell you as a result of my research about the atoms this much: There is no matter as such! All matter originates and exists only by virtue of a force which brings the particles of an atom to vibration and holds this most minute solar system of the atom together. . . . We must assume behind this force the existence of a conscious and intelligent Mind. This Mind is the matrix of all matter." -Max Planck

[@martam4142]

Thank you!

[@AG-yx4ip]

So true, we can never go beyond consciousness therefore we can never know if there’s anything outside of it. I do think awareness is the fundamental reality.full stop.

[@firstaidsack]

@@AG-yx4ip How do you get from "we can never know if there's anything outside of consciousness" to "there is nothing outside of consciousness"?

[@REDPUMPERNICKEL]

Nonsense! Max Planck may have been a genius of physics but the nature of the conscious is not a physics problem in the same way and for the same reason that linguistics isn't. But it is dangerous to say things fascists disagree with in approximate proportion to the power that they wield. One says what one must to keep ones research funded.

[@Aromatic-ring]

I respect and have used plank’s work countless times, but I fully disagree with him here. Consciousness if a byproduct of the brain

[@mehdichikh7378]

I suffered the borderline disorder for over 23 years. With so much anxiety Not until I came across psilocybin mushrooms treatmentPsilocybin treatment actually saved my life honestly. 6 years totally clean. Never thought I would be saying this about mushrooms

[@ChildCONTENT0]

Microdosing helped me get out of the pit of my worst depressive episode, a three year long episodeenough to start working on my mental health

[@Why444x.]

Can you help with the reliable source I would really appreciate it Many people talk about mushrooms and psychedelics but nobody talks about where to get them. Very hard to get a reliable source here in Germany. Really need

[@kayumbaemmanuel9187]

He's Reid_myco

[@Dineshkumar-kz1xn]

The shroom experience stands as my most remarkable journey, an awe-inspiring encounter that left an indelible mark of amazement.

[@sazzadhossain7013]

He’s on insta?

[@annymus4502]

Wow... I still cannot understand why people of my age don’t find this type of things addictive. It is deep and mysterious, and looking at it closer, so interesting...

[@mrpickle9117]

Anonymous Girl only religious people don’t think this stuff is fascinating.

[@annymus4502]

Mr Pickle I am religious Well, now you’re crying on the floor ‘Cause you just got dunked on

[@mrpickle9117]

Anonymous Girl so why your watching this, do you believe your imaginary god is the reason why your alive 😂

[@annymus4502]

Mr Pickle There was no need for that face. Why should I not believe in medicine, physics, chemistry, maths... WHILE BELIEVING IN GOD!

[@matthewchansavage3699]

why do you assume that god is imaginary?

[@ClownDollThatHasContemptForYou]

I love that Dumbledore quote

[@Isa-fq9kk]

Dont we all?

[@ziaandreax2925]

Yo deku

[@yt-sh]

@@Isa-fq9kk not me

[@Isa-fq9kk]

@@yt-sh GIRL ITS BEEN 2 YEARS 💀💀

[@yt-sh]

@@Isa-fq9kk those are rookie numbers

[@parantapbhardwaj7057]

i have been waiting for this videos from last 20 years i am 20 years old, thanx ted

[@jeff_forsythe]

We all have a divine primordial soul and when we are awake, our soul is conscious and when we are asleep we are not conscious, what is so difficult? The brain does not think, it is just like the cockpit of an airplane and the pilot is the soul...................Falun Dafa

[@JohnSmith-lg2ie]

After spending a lifetime studying animal behavior and interacting with animals, I believe that conciousness may be a universal truth. I know that seems foreign and far fetched, but the science is heading in that direction now and I believe that is where it is going to end up.

[@nik8099]

Really it's only far fetched to hardline religious people and materialists

[@brp5497]

@@JohnSmith-lg2ie in Buddhism the idea that we all share the same consciousness just different forms. I introduce ajahn sumedho KZbin.

[@brp5497]

@@nik8099 Religious is practice of a religion. Christianity is not the only religion. What does practice of Buddhism look like? I'm sure you would not know.

[@jsptraveler3001]

Night: i want to sleep Brain: No. let s stay awake and remember all your mistakes

[@jackwells8635]

Meditate in the day and it will help alleviate this my friend

[@divamontgomery2338]

Consciousness. Forgive yourself.

[@juicestains52]

Depression, heartbreak and good dose of an existential crisis is the ideal way to start a 2020 morning😌

[@leeshaahseel9428]

😆😆😭😭

[@action16x2]

2022 morning also

[@tus632]

Not to mention Covid

[@piuscalvinus]

how are you doing in 2024?

[@a-google-user]

Humans consciousness is not enough to explain what is consciousness!

[@ID89926]

👌🏻 it’s like we were made and “they” purposely left that out so our heads would be fried thinking about it

[@james6401]

Rupert Sheldrake has interesting thoughts on it. Susan Greenfield has an excellent presentation on it too - but at one point she gets stuck on one of her ideas of visual vs auditory processing where she concedes she needed an expert relativity physicist who could model spacetime manifolds to help her coax out the ideas.

[@ZeroGravity60]

I agree. Our human consciousness can't explain what consciousness is but consciousness can be explained by itself. Not only can it explain itself, but you can test it right now and experience its truth for yourself. :) HOW TO MANUFACTURE CONSCIOUSNESS: We, humans, have four parts, mind, body, spirit, and soul. You are right at this moment living mind & body, or you're living spirit & soul. You can't live mind & body and spirit & soul at the same time, it's one or the other. When it comes to consciousness, live mind & body and you'll only be able to pick up on the lower 35% of earth's top to bottom vibration scale. Living in a soul/spirit state will put you ahead of most while opening you up to the mid-range of vibration on the earth's scale. The higher up the vibration scale, the more conscious your life and thoughts become. The higher up the scale the more in-tune you'll become with your chosen reality. When we increase our consciousness to the point of awakening our higher self, that's when we throw away our jeans and buy a robe. Supernatural gifts accompany high consciousness vibrations. With science breakthroughs we can now "manufacture" consciousness as far, wide, and dense, as we choose. The denser our consciousness the more spectacular our thoughts, actions, and physical results. It used to be necessary to meditate for hour upon hour, days, weeks, even years before we could even get a true glimpse of supreme consciousness. No longer. With the cosmic shift of 2012 and bringing with it the collapse of time, we now have the knowledge to at will, manufacture as much raw consciousness as we want in just an hour or two. [That's it! One session, two hours, done!] Once your consciousness is built, it can't be destroyed. WARNING! Increased consciousness is both a gift and a curse. You'll know more. You'll see more. You'll feel more. If operating on automatic pilot you may find a dramatic shift in consciousness hard to get used to. For those ready to boost their consciousness and move up the evolutionary scale, I suggest the following. [No meditation experience required.] #1] Our human body is very complex. Even more complex is our spiritual selves. To make this simple I want you to imagine your heart is in the very center of your chest, just above and in between your chest nipples if you're a man. #2] [Eventually close your eyes] Take your pointer finger and point it out in front of you. Moving your finger counter-clockwise in a circular motion, imagine you are only one inch tall and backing up into your heart. Keep doing this until you feel you are now inside your heart. [It takes some imagination. NOTE: It might take you 90 minutes to master the process but you'll build all the consciousness you want in the final 30 minutes.] #3] Now that you're inside your heart in the center of your chest, keep backing up! Use your finger tool to back up another foot. Yeah, out your back & another foot. [By backing up you're energetically going deeper into your soul.] #4] Get comfortable with the inner feeling you'll have while consciously being in this location. Take note of how you feel. Register the feeling/vibration consciously. It's from this location, this feeling, that additional consciousness can be easily manufactured. #5] While in position and feeling the vibration of being in position, imagine gushing waves of energy springing up from within your chest. Like a fountain from nowhere, gushing blue & white energy springs forth from you going out in every direction. Let it flow freely but intensify its speed of eruption as you get comfortable with the practice and start to grow larger. #6] Now this is the most important part. Let the energy grow out around you in a perfect circle. A ball of energy that surrounds you. While inside the center of the energy circle, keep expanding your circle to include the whole room, your whole house, your whole neighborhood, your whole province or state, your whole country, and yes keep building your gushing ball of energy until it surrounds the whole earth. [It's important that your streaming visuals are not interrupted. If you build to your whole house and you have a break in your concentration, it's important you go back to the beginning and start again. YOU CAN"T HAVE A BREAK IN CONCENTRATION! It must eventually become one seamless visualization. You must have constant contact with your outer circle. Keep trying and you'll eventually get it. Building your circle of energy to include the whole earth is just the beginning. Keep growing it to include the moon and eventually to the other side of Mars. Sounds insane but what your doing is stretching your mind. [One seamless stretch from being to end.] A stretched mind may retract somewhat but most of what you build and repeatedly indent will be permanent. With this exercise, you will stretch your mind and increase your potential for consciousness. The mind will use up any and all available space it is given. [You just stretched your mind all the way to Mars.] It's simple, fast, and it works. Going forward you'll notice massive growth in your overall consciousness. Effective self-awareness can only be achieved with a sufficient depth of consciousness. [Becoming a Monk or engaging in life-long meditation no longer required. :) ] Well, that's my book for today. The Geriatric Hippie P*E*A*C*E

[@icygood101]

"Our certainty that we have a metaphysical, subjective experience may come from one of our brain's models; a cut-corner description of what it means to process information in a focused and deep manner". This sentence (among others) just brushes aside the hard problem (and the mind-body problem) as if there weren't a problem to address at all. Although actually, such a certainty is the only one we can ever justifiably have. Our experience is everything to which we have any direct access - you can be certain that it's there, as such. Not only that, but you can only really, really be certain that it, alone, is there. No, friends, our certainty of a metaphysical, subjective experience has not (yet) been explained by neurons alone... and it is very deceptive when people - even, at times, PhD's in cognitive science and related areas - put it in these terms. They're talking here about neural correlates but, for a video titled "What is consciousness?", I frankly expected more "attention" to the very question they posed (but don't take this the wrong way, props anyway for getting people thinking about this!). Anyway, from their own description, they are equating consciousness to - or defining it as - "processing information in a focused and deep manner". Hand-wavy language aside, what does this answer? Where is the subjective-experience part of this information; how does it happen; why do we experience it? This literally answers none of those questions and might as well be "information pan-psychism", which may be okay if it actually explains why we should expect information, which we currently define in a very specific, but different manner, to also map to consciousness in some fundamental way. IIT hasn't explained this. No one has explained this. Besides that, there's the recurrent frustration when academics seem to confuse self-awareness, self-knowledge, self-reference, or even "social attribution" with experience itself. Yes, Graziano, looking right at you, now. In fact, I have just watched another video (Closer to Truth channel) wherein Graziano literally answers "Yeah, if there is an internal experience - I would say there isn't in us, either". The question is "what is consciousness" (supposedly) and he literally believes it is NOTHING; that it simply is not. Not just that it is inexplicably "emergent", or some unexplained by-product of physics, but just not there at all! Now I don't know about your experience, reader, but over on this end, there is definitely something (conscious experience) that is not "produced" by physics as we currently model it. If you want to say that a system with self-reference or self-knowledge or social attribution has conscious experience, you can't just define these to be consciousness itself - you need to show where in these systems - indeed, where in the universe - lie the experiential properties which we observe, in addition to showing why they take the form that they do (which is all neuroscience has generally tried to do). Otherwise, you go the idealist route and show where in consciousness or in experiential properties (however you might define these) lies the universe and the physics we have been modeling. It is so odd to me that some people will not admit that there are certain things about the universe that we simply do not yet understand.

[@rnafratnthfrenorentgoth5186]

IOIOIOIOIOIOIOIOIOIOIO KEY TO OPEN UP MULTI-UNIVERSE AS WELL AS MORE. GREETINGS YEE OF WHO STILL THINKETH YEE ARE YOUR PHYSICAL BODY UNDERSTAND AND KNOW THAT YEE ARE MUCH MORE AS YEE ARE A CREATION FORCE WITHIN YEE AS ALL HAVE THE SAME BEGINNING FROM FORM TO FORMLESS LIMITLESS WE ARE ALL ONE

[@jeffforsythe9514]

The practice of Falun Dafa explains all those things. The brain is simply like the cockpit of an aircraft while the pilot is the soul.

[@Paradoxonification]

All this just assumes that the processes of consciousness alone could not generate consciousness, if all the information is there then why wouldn't this network of stored data be able to produce our experience of reality?

[@jeffforsythe9514]

Falun Dafa explains who we are, our origin, the reason why we are on earth and that consciousness is our soul awake.

[@jeffforsythe9514]

@@Paradoxonification Consciousness is our soul while we are awake, the you that is reading this comment...............Falun Gong

[@DavidG2P]

Best and most correct explanation of consciousness available. Consciousness is an emergent property of every autopoietic (i.e., living, self-sustaining) system and arises from the reduction of complexity (i.e., perception, representation) of the infinitely complex environment to the relatively few perceptions, i.e. model-building, necessary for autopoietic self-preservation. These perceptions or models also include system-internal (i.e., within the body) processes, thus forming a self-representation within the representation of the environment. This is the definition of consciousness.

[@RLekhy]

You sound a Buddhist! I was wondering who was the first to coin the term Consciousness (or equivalent term) and conceptualized it as a philosophical or metaphysical terminology. So far, I have studied both Greek and Indian traditions, I found it was the first Buddha in the 7th Century BC. He conceptualized it and explained it in very detail. I think we must study Buddhism, and test it in the light of modern sciences. Buddhism certainly can help us to solve the puzzles!

[@jeff_forsythe]

Humbug. We all have a divine primordial soul and when we are awake, our soul is conscious and when we are asleep we are not conscious, what is so difficult? The brain does not think, it is just like the cockpit of an airplane and the pilot is the soul...................Falun Dafa

[@DavidG2P]

@@jeff_forsythe para-religious dualistic romantic fairytale bs

[@mintayza7784]

Brain: _Quick, think of a snarky comment while you're still early_

[@roselineponmalar9213]

Exactlyy

[@mehulvemareddy33]

Your brain found the answer

[@artso1990]

Snarky comment

[@FaizanMunirKhanRajput]

Generic Snarky Comment

[@mintayza7784]

@@FaizanMunirKhanRajput Damn I shood have gone with that one

[@prabhupt]

BRAIN is the most important part of the body . . . . . Who's telling me this? THE BRAIN...😰

[@caad5258]

I mean, they seem trustworthy. Of course from a DNA perspective, genitals are the most important parts of the body.

[@MdotAmaan]

go back to facebook

[@kelvingivens1629]

@@MdotAmaan damn dude you dont mess around do you

[@ultimateme3049]

@@caad5258 does this meen that all this time i've been thinking with my d**k i've been doing a good work?

[@sahikahaapne678]

Brain is big mamori

[@SwastikSwarupDas]

I come her for the intro outro music and Addison Anderson

[@SwastikSwarupDas]

@Madara Uchiwa the narrator's name is Addison Anderson

[@Representing4II0I7]

Come here*

[@trevorrichard4710]

He’s good

[@Asegh]

I love that they talk of PS in such a manner. Because it has complete synchronicity with phantom limb syndrome, but what if you could have, theoretically, a phantom limb syndrome, outside of the boundaries of the dimensions of your normal person on an energetic, quantum level, like the ionic emanation that we take pictures of

[@jeffforsythe9514]

When a limb is removed it is just the cells, molecules and atoms but the smaller particles, thousands of times more microscopic and impossible to perceive with modern science, still remain, and that is why people still feel the presence of that limb. The soul is from where all thoughts spring...............................falundafa

[@SciencewithKatie]

Already won me over on this video with the Harry Potter quote! 🌟🧙🏻‍♂️

[@mehmetayaz93]

What’s that quote exactly?

[@GS42SCHOPAWE]

Mehmet Ayaz written at beginning of video

[@FilterChain]

No , that's where they lose me, quoting harry potter is like quoting football slogans at the start of a philosophy lecture

[@Madhattersinjeans]

@@FilterChain Makes sense for the boo hooray theory though.

[@lgbaloni]

Science with Katie same!!!! #potterhead

[@namanbansal3546]

Real happiness is a TED-Ed video starting with my favorite quote! 😀

[@saishriya8244]

I felt so great seeing it

[@mistygirl4961]

So do we have more senses that we are unaware of having? Is this how the subconscious works? We perceive things, we react accordingly but are unaware of knowing them and unaware of why we reacted the way we did? Maybe premonitions (I swear I have had them) are actually our senses? We are just unaware of being able to perceive things that way? Maybe if we had a “higher consciousness”, we could become aware of such things?

[@imdcoolest1685]

This comment deserves more likes

[@imdcoolest1685]

I feel we do have a sense of higher consciousness. There are phenomena that is unexplainable.

[@silentbeast6127]

May be that's what the religious said...?

[@4umang]

1:30 Group of brain trying to learn how brain works

[@caad5258]

Science is the process of the universe trying to comprehend itself.

[@10mimu]

Science is the conscious universe then.

[@Ngamotu83]

Whether it's this P.S., Phineas Gage, or Henry Molaison, it just goes to show how important neurological disorders and diseases are in studying and making sense of the brain and the mind. If no one ever suffered from a neurological disorder we would probably know almost nothing about the brain.

[@jeffforsythe9514]

Our consciousness has nothing to do with the brain, the brain is merely the cockpit of the human body and the soul, the self is the pilot, the brain does not think, Falun Dafa.

[@iwky1930]

@@jeffforsythe9514 i mean theres more proof that suggests otherwise but can be true ig.

[@jeffforsythe9514]

@@iwky1930 So many have abandoned the soul and the Divine, very sad................falundafa

[@ogbestarchive]

and we won’t need to 🤧

[@palmtreebranches]

FANTASTIC lesson. Thank you, Dr. Graziano. Wish I had the resources to take a whole semester of lessons at Princeton for this type of learning, so thank Ted Ed for making it so ridiculously accesible.

[@jeffforsythe9514]

The brain has never had a thought, it is merely the cockpit of the human body and the soul is the pilot.........................falundafa

[@BobMcCoy]

*Consciousness is lit*

[@ivangalik7848]

I like the theory where conciusness is underlying field like gravity and we connect to it like we connect to cloud. Brain is only the hardware but conciousness is the code we can not see. We can see electricity currents in the pc even transistors but we can never backengineer source code of operation system.

[@Dion_Mustard]

excellent point! and perhaps that "underlying field" is not destroyed when the brain is destroyed...

[@nutellateen9593]

That is the best analogy I've ever read

[@Bruh-fy5xc]

I love this animation and another great video Edit: thanks Ted Ed I love your videos

[@mydogsbutler]

Speaking as a software developer, we seem to have a pretty good idea of how neurons process certain kinds of information. We can build software-based neural nets that can learn using algorithms modeled after brain neurons. IMO the big answer that alludes us is how do those individual neurons add up to consciousness? In other words, why do we experience ourselves as a distinct consciousness rather than a cacophony of countless individual signals?

[@Duchesnerecords]

Maybe god I think maybe All of ours are connected

[@REDPUMPERNICKEL]

The kind of information that neurons support is analogical. These analogies are instantiated by neural discharge frequencies. The self is but one of these analogies. Being conscious is the process wherein the self analogy is modulate by the others. The self analogy might be more accurately characterized as an analogy complex. (Note 'frequency' is an abstract concept). I hope you aren't too upset to discover that your essence is abstract. Cheers!

[@mydogsbutler]

@@REDPUMPERNICKEL Experimental general purpose AIs of large IT companies are getting pretty good. I don't buy they have consciousness though. Without an understanding of how consciousness works in the human mind, there is no way to confirm software. I've heard a lot of theories over the years of how consciousness arises. Have a few of my own. Unless one can write it down mathematically and test it though, just speculation.

[@REDPUMPERNICKEL]

@@mydogsbutler Mathematics is, I was going to say simply but it's not, a very terse language. Every word in every language is analogical in essence. Thoughts are analogical in essence. One needn't be a math wiz to excel in computer science (though I can see how it is extraordinarily helpful in many circumstances). I'm interested in what is most likely. I find a web of interacting analogies to be most likely with the advantage (or deadly consequence, à la Westworld) that computers have the ability to operate an isomorphic web.

[@mydogsbutler]

@@REDPUMPERNICKEL One can string together words in all sorts of ways that might appear to reflect reality. Mathematics on the other had keeps us accountable.

[@afcademy1463]

Consciousness is the unlimited active relations of < I > in ( n ) directions.

[@016329]

Does anyone else here wish they were like a lot of other people seem to be and were untroubled by these questions? Most people seem to be able to lead their lives blissfully unaware of questions about what we really are/death and what it means, etc and seem happier for it!

[@KingKing-yw4xe]

I love to see the story of Dr. Wudi. He observed timelapse of all Universes. He holds a very different view. He has an unusual Theory of Everything. He has been observing in silence since 2017. If you make a video about him, I think it would be a truly fascinating story.

[@kunalpatil5995]

Great video! This is one of the most controversial and debated question in modern science.

[@jeffforsythe9514]

The practice of Falun Dafa explains all those things. The brain is simply like the cockpit of an aircraft while the pilot is the soul.

[@1Diulio]

“ A conscience is what hurts when all the other parts feel so good”

[@jedjohnson2925]

Consciousness is just us, inside of us, it is the part that makes us not a robot or a body, but a being that has control of what our body and feelings and emotions. I believe it is our soul and the thing that makes us, us.

[@croozerdog]

Anyone else on an existential youtube journey?

[@naitikmehta7968]

Not only on KZbin. Looking around every where.

[@alterego634]

Sadly, no luck…

[@croozerdog]

@@alterego634 the worm at the core is the first book that grabbed me in years

[@kendellyoung533]

I was a few mnths ago ... its fun and scary

[@jawadbenbrahim5933]

I am! It's quite unsettling…

[@michaz.3075]

Consciousness is the faculty of awareness - the faculty of perceiving that which exists. Awareness is not a passive state, but an active process. On the lower levels of awareness, a complex neurological process is required to enable man to experience a sensation and to integrate sensations into percepts; that process is automatic and non-volitional: man is aware of its results, but not of the process itself. On the higher, conceptual level, the process is psychological, conscious and volitional. In either case, awareness is achieved and maintained by continuous action. Directly or indirectly, every phenomenon of consciousness is derived from one’s awareness of the external world. Some object, i.e., some content, is involved in every state of awareness. Extrospection is a process of cognition directed outward - a process of apprehending some existent(s) of the external world. Introspection is a process of cognition directed inward - a process of apprehending one’s own psychological actions in regard to some existent(s) of the external world, such actions as thinking, feeling, reminiscing, etc. It is only in relation to the external world that the various actions of a consciousness can be experienced, grasped, defined or communicated. Awareness is awareness of something. A content-less state of consciousness is a contradiction in terms. ~ Ayn Rand, Introduction to Objectivist Epistemology, 37

[@forsaken841]

Michał Z. There’s a lot of big words in that speech, must make everything said true.

[@FINALB]

Well, that is an answer from a branch of philosophy, but, scientifically speaking, there is no clear answer of consciousness. That is why neuro scientists are still studying to find out what is consciousness , the video points out that at 1:28

[@Madhattersinjeans]

oh god Ayn Rand. Delete this nephew.

[@NothingMaster]

We still don’t even know if what we refer to as ‘consciousness’ was an evolutionary unavoidability, a freak accident of nature, or a manifestation of some hereditary human brain disease. The very question of what consciousness is, beyond the simple self awareness aspects (a trait that could be identified in a number of animal species, as well) may not be a scientific one at all, since it is not ultimately subject to the falsifiability test. As the apparent absurdity stands today, we couldn’t even devise an experiment to prove, or disprove, that we live in a simulated reality; perhaps one setup and manipulated by some other/alien type of consciousness. Our continued persistence in a brain-processed reality doesn’t even extend us the privilege of knowing what the ultimate nature of the object of our consciousness may be. In other words, what exactly is it that we think we are conscious of? So we go on living our mortal lives in search of answers that might never be. All the while pragmatically content in our lingering state of ignorance, and overjoyed by our technological marvels and the myriad of creative strategies to feed our need for the denial of death.

[@JordanBeagle]

0:05 Great quote, the Deathly Hallows is fantastic

[@GUPTAYOGENDRA]

1. Consciousness is holding the same place in the universe what it holds in my dream. 2. My dream (Including me and others, who were living in my dream) was imagined, seen and known by consciousness, which was independent of my dream. 3. The universe(Including me and others who are living in the universe) is imagined, seen and known by consciousness, which is independent of the universe.

[@Danny-no7jp]

I just finished playing Detroit: Become Human. A game about AI becoming concious. This was a really fitting video to have been uploaded at such a time. Thank you TED-ed!

[@Taikamuna]

Is there anything TED-ed has no answer to?

[@amberheard2869]

everthing

[@FilterChain]

you think this is an answer?

[@Maryam-qx9kp]

They probably making a video answering how they have an answer to that.

[@Ultracrepidarian]

"Why did she leave me?"

[@Dekku]

kzbin.info/www/bejne/bYS6p3d-q7yLpc0

[@JohnSmith-lg2ie]

What if conciousness has nothing to do with the brain, except that the brain can acknowledge it? What if there are things we do not acknowledge as brains that function like brains?

[@Dion_Mustard]

i like it :)

[@blahhh...8369]

I literally just had this thought last night!

[@TheKingdomFeminist]

Exactly. The brain can only acknowledge it. A consciousness birth the world we see and the developments derivative consciousness’s like ours will make in the world as we go along. Consciousness is the CREATIVE FORCE that gave us all existing things. Yet, it is not just creative. It is also administrative, emotional, relational, ordered and free at the same time. Consciousness is a being, and also not just a being. It has the power to make anything, and everything it’s created is a part of itself. And in all created things, it shares/plants a dimension of its own consciousness. It’s nature & likeness. So we can, as we are already doing, become creators like it. But it’s highest aspiration for all its creation is a relationship driven. Yes, create but the creation of humans it most respects - is UNITY. A concept that allows for all derivative consciousness to unite into one, and then we can all truly say that we are in the likeness and image of the BIG CONSCIOUSNESS that created us. Consciousness is GOD.

[@ranjeetagupta9024]

We all are like P.S , we choose the right decision sometimes though we don't see the real picture , but our brain consciousness sees through the whole situation even without us noticing and in the end we say I glad I did that or maybe did not do that.

[@jeethuvarghese8579]

I almost cried out seeing that Harry Potter quote . I love it so much. Thank you. It wouldn't have been complete without that quote. ;)

[@saishriya8244]

Yeah- Never

[@vijayarya542]

Can you make a video about why the skin hardens and makes a hard tissue? And what are the ways to get rid out of it? Also, mention the medical ways and natural ways (if there any). Will you please do it?

[@EthiopianSoulJah]

Consciousness, and how/why it exists, are questions that led me to become religious, from being an aethiest, about a month ago.

[@drummy3611]

Same here

[@wheresmycookiegoddamnit8077]

Good

[@wheresmycookiegoddamnit8077]

ToXic Havikzzz I’m very happy for you people.

[@raymundmata5982]

So what have u found out?!?

[@homerds200]

That’s the reason why i am still religious

[@delphine1001]

it would be great to have foreign languages subtitles because i am so focused on understanding the words i miss lots of abstract concepts. I often have to stop the video to assimilate the ideas and at the end everything mix up. So french (and spanish, chinese...) subtitles would be great because these videos are very interesting!

[@jayceedelr]

Intriguing video! Awesome animation!

[@roshan7961]

The channel which you always look forward to

[@mitrabuddhi]

NAVOMITTO: A New Approach to the Hard Problem The "hard problem" of consciousness refers to the mystery of subjective experience: how something physical like the brain can give rise to interior, conscious qualities like the redness of red or the painfulness of pain. Philosophers have struggled for centuries to solve this puzzle. The NAVOMITTO framework offers a novel approach to solving the hard problem. At its core, NAVOMITTO sees reality as composed of illusory dimensions and perspectives that differentiate across clarions. It's this process of differentiation across clarions that gives rise to consciousness and qualia. Clarions are the key to the solution. Lower clarions contain relatively undifferentiated perspectives that likely correspond to primitive forms of awareness. As perspectives differentiate into more parallel perspectives across higher clarions, richer conscious experiences emerge. Consciousness "scales up" as clarions increase. Subclarions within each clarion also play an important role. Subclarionic dynamics contain the finely differentiated information processing that grounds our qualia. Though embedded within a given clarion of consciousness, subclarions may bridge the gap to neural processes. The vocabulary of NAVOMITTO - illusion, dimensions, perspectives, clarions, subclarions - provides new conceptual tools for understanding how consciousness arises. Traditionally, philosophers framed the problem in terms of physical substances - like neurons - that seemed fundamentally separate from subjective experience. But clarions reframe the debate in a more fertile way. While NAVOMITTO presents only a high-level solution at this point, it points to a promising new direction for tackling the hard problem. Consciousness may emerge as an inevitable byproduct of the differentiation and integration of perspectives across clarions and subclarions - a product of the illusory structure of reality itself. In this way, NAVOMITTO offers a potential answer to the hard problem: consciousness arises through the process of differentiation across clarions, grounded and textured by subclarionic dynamics, and made possible by the illusory nature of reality. With further development and refinement, NAVOMITTO's novel conceptual tools may finally help philosophers crack the mystery of consciousness. NAVOMITTO: A Multi-Dimensional Framework for Understanding Reality Nothingness and existence are two sides of the same coin Illusion 1-there is Illusion. Reality is made of Illusion. Illusion is the whole coin of nothingness-existence. Illusion is all aspects of reality from zero (nothingness) to infinity (existence at its most actualized form). Illusion is the paradox itself. Illusion can be seen in different clarion through the process of differentiation. Dimension (Universal) 2-there is Dimension. each Dimension describe a concept or property or quality or quantity or relations or changes or process or anything else‌. each Dimension is unique in its own way but it can be seen as an interaction of infinite other Dimensions. in other way each Dimension is entangled with Illusion and All Dimensions are emergent from Illusion. Dimension exists in different Clarions and different Perspective. Illusion can be seen as infinite Dimentions. Perspective (Particular) 3-There is perspective. The set of perspectives in different clarions makes the dimension. Any conscious or unconscious entity can only pass through successive perspectives in different clarions. It is not possible for an entity to pass to parallel perspectives. Each perspective contains unique information that describes the dimension in that clarion. Each perspective manifests its own unique qualia. Clarion 4-there is Clarion. Clarion determines how many Perspective exist in that particular Clarion (in a specific Dimension). Clarion can be any number from Zero to Maxima. Differentiation (enamation) 5-There is Differentiation. Differentiation is the process of enamation that involves separation of superimposed information (at previous lower clarion) into more clear information (at next higher clarion) that leads to increase in clarity, But losing of information's. Differentiation creates Reciprocal Hierarchy Structure of Dimentions. (For example: At a lower Clarion , you may have a Perspective that contains information about red and green (Particular red-green). There is no green or red in this lower Clarion Perspective but there is only red-green. Through the process of differentiation, the information in this Perspective (Perspective red-green) can be separated into 2 simpler, more clear Perspectives at next clarion (Perspective red + Perspective green). red Perspective is the parallel Perspective of green and red-green is the parent Perspective at lower Clarion. So if you move from red-green Perspective to red Perspective you will gain clarity but at the same time you lose information of green Perspective) Nothingness 6-there is Clarion 0. Clarion Zero contains no Perspective. Clarion 0 is nothingness. Clarion 0 contains all of illusion as potential. Nothingness is the result of superimposition of all Dimentions. All Dimensions are common in Clarion Zero. Clarion 0 is the only simple. Existence 7-there is Clarion 1. At Clarion one, there is one Perspective in Dimention. The information in Clarion 1 includes the superimposition of all Perspectives in Clarion 2. Clarion One contains all information found in Dimention, but in an undifferentiated form and looks simple because it is viewed from the perspective of Clarion One. Clarion One means Dimention in the most uncertain state. Inflectia 8-Between Clarion Zero and Clarion Maxima, there is an intermediate Clarion that has the largest amount of Parallel Perspectives. From clarion zero to inflectia, the number of Parallel Perspectives for each clarion increases, and from inflectia to clarion maxima, the number of Parallel Perspectives for each clarion decreases. Perspectives at Inflectia has the most complexity while Perspectives at Clarion 1 and Platonica has the minimum Complexity. Platonica 9-there is Clarion (Maxima-1). In Clarion (Maxima-1), Dimention needs another Differentiation to reach Clarion Maxima. Platonica means Dimention in the most certain state. each perspective at Platonica contains the last bit of information in that Dimention. In Platonica, with One differentiation, existence is destroyed and nothingness remains. Platonica is formed from the superimposition of Nothingness in clarion Maxima. Maxima (Infinity) 10-there is Clarion Maxima. In Clarion Maxima, there is no superimposition, and all causes have already occurred, with no change left to be made. In Clarion Maxima, there can be no further differentiation, and there is nothing left to differentiate. Therefore, paradoxically, Clarion Maxima, represent Clarion 0. Maxima can be any number from zero to infinity. Formulas: 11-The number of Parallel Perspectives in Clarion C is calculated through the binomial coefficient with the following formula: N=P!/(C!(P-C)!) In this formula: N=number of Parallel Perspectives in Clarion C P=Platonica Clarion 12-Despite the existence of multiple perspectives in the upper clarions, for a perspective in the lower clarion it is only possible to enter P-C+1 number of perspectives from the upper clarions (for 0

[@marcobiagini1878]

I am a physicist and I will provide solid arguments that prove that consciousness cannot be generated by the brain (in my youtube channel you can find a video with more detailed explanations). Many argue that consciousness is an emergent property of the brain, but it is possible to show that such hypothesis is inconsistent with our scientific knowledges. In fact, it is possible to show that all the examples of emergent properties consists of concepts used to describe how an external object appear to our conscious mind, and not how it is in itself, which means how the object is independently from our observation. In other words, emergent properties are ideas conceived to describe or classify, according to arbitrary criteria and from an arbitrary point of view, certain processes or systems. In summary, emergent properties are intrinsically subjective, since they are based on the arbitrary choice to focus on certain aspects of a system and neglet other aspects, such as microscopic structures and processes; emergent properties consist of ideas through which we describe how the external reality appears to our conscious mind: without a conscious mind, these ideas (= emergent properties) would not exist at all. Here comes my first argument: arbitrariness, subjectivity, classifications and approximate descriptions, imply the existence of a conscious mind, which can arbitrarily choose a specific point of view and focus on certain aspects while neglecting others. It is obvious that consciousness cannot be considered an emergent property of the physical reality, because consciousenss is a preliminary necessary condition for the existence of any emergent property. We have then a logical contradiction. Nothing which presupposes the existence of consciousness can be used to try to explain the existence of consciousness. Here comes my second argument: our scientific knowledge shows that brain processes consist of sequences of ordinary elementary physical processes; since consciousness is not a property of ordinary elementary physical processes, then a succession of such processes cannot have cosciousness as a property. In fact we can break down the process and analyze it step by step, and in every step consciousness would be absent, so there would never be any consciousness during the entire sequence of elementary processes. It must be also understood that considering a group of elementary processes together as a whole is an arbitrary choice. In fact, according to the laws of physics, any number of elementary processes is totally equivalent. We could consider a group of one hundred elementary processes or ten thousand elementary processes, or any other number; this choice is arbitrary and not reducible to the laws of physics. However, consciousness is a necessary preliminary condition for the existence of arbitrary choices; therefore consciousness cannot be a property of a sequence of elementary processes as a whole, because such sequence as a whole is only an arbitrary and abstract concept that cannot exist independently of a conscious mind. Here comes my third argument: It should also be considered that brain processes consist of billions of sequences of elementary processes that take place in different points of the brain; if we attributed to these processes the property of consciousness, we would have to associate with the brain billions of different consciousnesses, that is billions of minds and personalities, each with its own self-awareness and will; this contradicts our direct experience, that is, our awareness of being a single person who is able to control the voluntary movements of his own body with his own will. If cerebral processes are analyzed taking into account the laws of physics, these processes do not identify any unity; this missing unit is the necessarily non-physical element (precisely because it is missing in the brain), the element that interprets the brain processes and generates a unitary conscious state, that is the human mind. Here comes my forth argument: Consciousness is characterized by the fact that self-awareness is an immediate intuition that cannot be broken down or fragmented into simpler elements. This characteristic of consciousness of presenting itself as a unitary and non-decomposable state, not fragmented into billions of personalities, does not correspond to the quantum description of brain processes, which instead consist of billions of sequences of elementary incoherent quantum processes. When someone claims that consciousness is a property of the brain, they are implicitly considering the brain as a whole, an entity with its own specific properties, other than the properties of the components. From the physical point of view, the brain is not a whole, because its quantum state is not a coherent state, as in the case of entangled systems; the very fact of speaking of "brain" rather than many cells that have different quantum states, is an arbitrary choice. This is an important aspect, because, as I have said, consciousness is a necessary preliminary condition for the existence of arbitrariness. So, if a system can be considered decomposable and considering it as a whole is an arbitrary choice, then it is inconsistent to assume that such a system can have or generate consciousness, since consciousness is a necessary precondition for the existence of any arbitrary choice. In other words, to regard consciousness as a property ofthe brain, we must first define what the brain is, and to do so we must rely only on the laws of physics, without introducing arbitrary notions extraneous to them; if this cannot be done, then it means that every property we attribute to the brain is not reducible to the laws of physics, and therefore such property would be nonphysical. Since the interactions between the quantum particles that make up the brain are ordinary interactions, it is not actually possible to define the brain based solely on the laws of physics. The only way to define the brain is to arbitrarily establish that a certain number of particles belong to it and others do not belong to it, but such arbitrariness is not admissible. In fact, the brain is not physically separated from the other organs of the body, with which it interacts, nor is it physically isolated from the external environment, just as it is not isolated from other brains, since we can communicate with other people, and to do so we use physical means, for example acoustic waves or electromagnetic waves (light). This necessary arbitrariness in defining what the brain is, is sufficient to demonstrate that consciousness is not reducible to the laws of physics. Besides, since the brain is an arbitrary concept, and consciousness is the necessary preliminary condition for the existence of arbitrariness, consciousness cannot be a property of the brain. Based on these considerations, we can exclude that consciousness is generated by brain processes or is an emergent property of the brain. Marco Biagini

[@shoemcflextheflex2199]

Explain in monkey

[@caioadao1863]

Oh my godness. Big point! Very good!

[@paulhamlin1432]

Blah blah blah blah blah!

[@sheiruto1058]

Regarding this video I also found a flaw in the video's argument like this supposed over simplication of sensory inputs . But these over simplication is being presented to what ? To whom to the Brain itself which already had these detailed information, why would it need to then oversimplify the details it just showed capable of interpreting besides even if it does present it to itself what it is it presenting it to still, the areas of brains ? Then how is it decided which area of brain will produce a response ? Do the areas fight with each other ? Or do the sensory inputs from different situations illicit fixed response (which due to free it's clearly not ) then how is it decided which area produces a response and why is it that my head has not split apart yet due to this supposed constant contradictions of areas of brains . Why is it that I can see these areas of brains in mind as presenting me with options which i something other than these areas then choose now I might genuinely be more inclined to choose certain choices more than others due to situations (which does have an effect ) but the ball is still in my court I can still choose the choice I am less inclined to or have no inclination towards purely on my intuition or logic. I don't know if what I said made sense at all added to this my punctuations are also horrible so I don't expect a response

[@ashgarcia2546]

DID YOU JUST USE A HARRY POTTER QUOTE??? I LOVE TED-ED!!!!!!

[@steveishere8808]

Jasmin Rios Yeah they really outdid themselves

[@alfaulv7594]

"Did you throw your name into the goblet of fire?" -Dumbledore asked calmly.

[@steveishere8808]

gavin cooley DId YoU tHRow YOuR naME iNTO tHE GObleT oF FiRe?!?!?!?!

[@stardust4001]

@@steveishere8808 🤨

[@steveishere8808]

Star dust I think Dumbledore shouted it out in the movies, I don’t know I just saw a clip comparing how they were said

[@computings8326]

*Yaaay. Ted Ed posted a video on my birthday!!* *Today is my birthday 🎂 guys..*

[@fpolunderscore]

Maligayang Kaarawan!

[@ssiddarth]

Happy bday 🎂🎆🎁

[@meercia]

happy bday!

[@traditionalsunni629]

great! one year of your life is gone and never gonna come back!

[@computings8326]

*Thanks all. BTW I never expected so many likes!* 😁😁

[@thomashaines3182]

I like the theory of the consciousness field. Our brains act as a receiver for a consciousness field that the earth has, like the magnetic field

[@sprightlyrandom1550]

This is a thought provoking video!

[@zerocool1ist]

I was once looking at a lobster in a tank floating starring at me and i asked it, i wonder what it is you might think about are different worlds? The lobster took a moment and looked at me kinda sideways and said "Human beings are the only creatures on Earth "that claim a God."And the only living thing that behaves like it hasn't got one."Does the world belong to no one but you?" And when he said it, I was taken back. Not because of who was doing the talking, because I finally understood the connection between children scavenging for food and shiny brass plates on the front doors of banks

[@Metrotouille2243]

0:50 she has ultra instinct

[@vamsibalam]

Nani?

[@caad5258]

the power!

[@IamINERT]

Power level over 9000

[@mariorazy]

Damn! Beat me to it

[@doctorrottington]

Right on time

[@anjusingh5510]

The best Ted ed. The best animation ever seen

[@GentleJungle]

Even though we can get along with the awareness and control we've had "just fine", I really wish we could all choose to ask why we do the things we do more often. I wish we would all choose self awareness for the greater good. To aim as objectively toward an ethical living standard for all reality and humanity. Mental health is so important. Humans are so volatile.

[@jeffforsythe9514]

It has to do with attachment and emotion. The practice of Falun Dafa explains all those things. The brain is simply like the cockpit of an aircraft while the pilot is the soul.

[@elierizkallah6547]

What you are talking about is thought & information, not consciousness... This explanation need update...

[@FernandoPerez-us1rp]

yeah, I don't agree with this video as well. Needs an update for sure

[@cavangriffin1514]

Great videos as usual, always love seeing the content you guys put out. Keep up the good work.

[@fwseyo]

She going ULTRA INSTINCT

[@jankie3601]

I really find it interesting how the more we try to make sense of everything, the harder it becomes to make sense of everything.

[@sagacity7786]

Yess, another TED-ED videooo. My parents and I love these kind of things ^^

[@phillipchavez1321]

1:38 what is consciousness?

[@flikkie72]

2:20 nooooo prisms don't break light that way, and you did so well with the cogs!

[@miladkareem6454]

Sometimes especially at night I feel something like a feeling making me Feel and wonder where I am now what I am seeing and feeling, but I freak out And like wake up out of it after like 2 to 3 seconds

[@Quantum_Current]

Love when Ted-ED comes through with an enlightening video !

[@youknowwho8925]

Speaking of conciousness, I think this is quite a good opportunity to ask a few questions about it. Do Animals have conciousness? If no, why do humans have? Is it because of intelligence? If yes, what level of animal stop having conciousness? Do mammals have conciousness? Going down from high level mammals to insects, which of them have conciousness? Do plants have conciousness? What determines the existence of conciousness in an organism anyway? What happens to an organism's conciousness when they die?

[@quantumeinstein3472]

Ted Ed is the best 😄👌👌👌👌

[@dennistucker1153]

I'm a computer programmer. This give me a unique insight into the nature of consciousness. To me, consciousness is a very simple thing to understand. In my opinion, consciousness is an elementary process in the brain that always tries to resolve 2 questions. 1) What is going on? This is analogous to input(s). 2) What should I do? This is analogous to output(s). There are sub-processes in each stage but the sequence of these questions(stages) repeat continuously all the time while we live. Consciousness also continues while we sleep. The biggest difference between awake and sleeping is that the brain is deprived of most of our senses and the loop time of these two stages is much longer. On the first question "What is going on?", our brains try to make sense of all the available senses(touch, taste, etc.). The brain also uses it's memories and it's reasoning in this stage. On the second question "What should I do?", our brains try to form a response to the first question. One of the main sub-questions to be resolved in this stage is "what is most important at this time". A decision is made like rest or run or talk about something.

[@mrcollector4311]

and then comes the question who is asking that question?, why do we have freewill or why do we make spontaneous causal actions which as observed in some tests doesn't correspond to the neural activity at all?

[@camiloiribarren1450]

Now we need to find out as well if consciousness can be tactile. Thanks for these incredible lessons

[@davidkatuin4527]

Memory is an amazing thing to have . What can be accomplished with it seems endless. Now let's add values to that and see what we have.

[@jeffforsythe9514]

Memory is simply that, memory. The practice of Falun Dafa explains all those things. The brain is simply like the cockpit of an aircraft while the pilot is the soul.

[@rcyadav9746]

Exercise working memory into long-term memory then to account of internet

[@noelkinz]

Consciousness is the interaction between space & time. You are the space that you occupied with your body but you are also the body that you occupied in space.

[@xorahmichelle9201]

"Our perception... Is wrong and over simplified but good enough for us to function." The problem with America today🙄

[@romaniangamer1]

@LagiNaLangAko23 That doesn't mean we shouldn't better this world!

[@nikhilutterker284]

0:48 ULTRA INSTINCT!!!

[@marcroswellgo1233]

how does we come up with the concept of conciousness in the first place?

[@noxaeterna8761]

Because rocks don't think

[@michelepellegrino6640]

it's the same question as the title's one, if you think about it

[@lillak8405]

Damn i love this channel, especially when it tackles topics that are related to philosophy too.

[@catcatcatcatcatcatcatcatcatca]

I really like this model, and will try to use it in future when reflecting my toughs. In one hand, what we are self-aware of is just an illusion build by the uncontious part of ourselves. However, model like this leaves no room for free will and self-improvement, and is useless for daily life. Please don't attempt such. But on the other hand, assuming that our picture of ourselves is accurate leads to unjust judgement about oneself, especially when dealing with trauma or harmful toughts. We can't fully control how we feel or even always whats we do. The idea that 'just trying harder' would bring success is also toxic, so this model is also bad for daily life. BUT if our toughts and feelings, as well as our idea of ourself is *part of a feedback-loop* , we kind of get the best of both models. We have an answer for how we can truly affect some things quite easily, and for why some things can't be changed by pure willpower. This model where our ideas are merely a visible part of a bigger system, that can affect the whole system, explains why sometimes being mercifull for oneself is important as well as slow methological working. Yet it explains why some things are easy: even completely new things. They don't have to be build into you, like in first model; they just had to be a particulary easy to implement via the feedbackloop to the unknown, full system

[@superprogamer3.0]

Great video

[@InvestingBookSummaries]

Another great video :)

[@GUPTAYOGENDRA]

Consciousness is associated with “Thinking” and is independent of “Thinking”. This thought is understood only by Consciousness.

[@visitacionomega1393]

Excellent explanation of Conscience. Thank you.

[@ashleybellofsydney]

Consciousness is just the meaning we give to our sense of awareness.

[@glynemartin]

The meaning resides WITHIN consciousness. What are you talking about?

[@namaanda5349]

4:14 Don't mind me, I'm just pinpointing an important part for myself.

[@abdinur4047]

We are Consciousness we're just wearing bodies

[@KnightSlasher]

Using your mind powers

[@teinarepia5944]

Rather than look at the brain in segments, we are better to view it as a whole and that when we apply our physical and spiritual aspects together we inturn find our complete self (our consciousness). We as humans actively break down and categorize everything instead of viewing some things as a complete working whole. I believe our consciousness is our active force the very essence of our presence regardless of how we see it whether it be your soul, Chakra, ki etc. One of the most important aspects of this question is the how you to your own answer in what is best for you as an individual. Well that's my theory lol.

[@Noukz37]

That's a big question if I ever saw one! Good job on trying as always guys!

[@user-Void-Star]

My consciousness level is over 999!

[@thegoodlistenerslistenwell2646]

The brain is the only organ ever to name itself.

[@hahanamegobrrr6667]

"Corporate wants you to tell the difference between this picture and this picture" P.S. : "they're the same picture"

[@Rexborinaga-wi3he]

Astrology and Environmental Consciousness!

[@blackbird4221]

I'm reading a book called Mind and Cosmos by Thomas Nagel about consciousness he argues that explaining it needs a shift in how we understand the world, biology and evolution

[@Aldarinn]

Could you please summarize the book for me? Why does he find physicalism false?

[@blackbird4221]

​@@Aldarinn Sorry but I don't think I can summarize, I haven't finished it, and I am having trouble understanding some arguments. He presented several arguments, I don't have the book with me now, but one of his arguments is that pure materialism is an assumption that has not (and probably cannot be proven), and perhaps changing this assumption and exploring other assumptions might allow us to progress in this field. He mentions the strict adherence to materialism is due to bias against religion and toward atheism, not based on an rational basis.