Can other animals understand death? - Barbara J. King

[@macngeeseyt6029]

When one of cats passed away, my other 4 cats were looking for her for over a year afterword.

[@TEDEd]

Who's cutting onions in here 🥺

[@bellala6]

When one of my cats unexpectedly passed, my other cat was running around the room meowing and he’s usually a calm cat. When he finally calmed down, his body was trembling. The next few days he would look around the house for his friend, and then eventually stopped.

[@yecyecii6820]

When Dixie went missing. I go out and call her name - Whisky is also going out with me to look for her. And whisky is sad. He never sunbathe anymore since Dixie is gone.

[@sketchyskies8531]

Ouch

[@144_The_Sheep]

​@@TEDEdraise my hands : sorry, that was me.

[@robertwatts7894]

I think it's really arrogant of us humans to think we're the only ones who feel. It doesn't take much observing to realize some animals definitely feel some form of grief and other emotions. It may not be remotely the same but there's definitely some kind of feeling there.

[@aguyontheinternet8436]

not arrogance as much as wariness. Humans are very very good at spotting patterns, even ones that don't exist. We need to be very careful if what we are seeing is what they are actually feeling, or if we are projecting our own feelings onto them.

[@kiboma4209]

Mammals im pretty sure can feel grief since my cat was sad when my dig, basically his friend for 11 years died. Insects and Reptiles, idk maybe

[@dork7546]

Some animals can feel grief, others don't. To assume all animals share the same emotions as us is just our tendency to project human characteristics onto animals. A lot of animals may share some our emotions but not all of our emotions. For example, dogs can feel grief but they can't feel guilt.

[@Sol-Amar]

​@@dork7546There's plenty of videos of dog behavior that I (and many others) think parallels what humans consider to be guilt. We won't fully know the truth unless we can fully empathize with dogs and/or invent or discover some way to fully understand their emotions and intent. But we are all animals and can notice universal patterns in body language, eye contact, tone of voice etc. It's instinctual and humans still have it even if we've been taught otherwise. Not ignoring the differences among the species either, but I don't think it's fair to assume we truly know anything. Nothing can truly be proven with science anyway, it's based on what evidence is the most concrete and consistent....until new evidence comes along that supports something else all together!

[@katarinajanoskova]

I agree. Came here to say the same. How presumptuous of us to claim we are the only ones having feelings and labelling the other animals as automata. If an alien looked at grieving humans, wouldn't they see exactly the same behaviour as across the other species? Vocalising, being unable to let go of the body, grooming the body after death...

[@Mariofan2479]

I can see why humans may not think animals grieve. Animals don’t express emotions as humans do, but they have their own way of communicating. They have their own way of grieving. Just as humans while similar, grieve differently.

[@meyr1992]

and how do you know that? are you an animal expert? are you a scientist?

[@exotic1405]

​@@meyr1992have you ever seen a crow before?

[@meyr1992]

@@exotic1405 you haven’t answered my question

[@sujanimator]

yeah but lion king 2019 does it all wrong tying to remake the emotion but with no proof of emotions if they wanna show it they can at least do some expressions like in thejyunhle book 2016

[@agniswar3]

@@meyr1992 I had personally noticed that when a crow dies a number of crows gather around its body. They caw for sometime and fell into silence for a while. Some moments later they flew away.

[@PyritePlays8431]

I had a dog who passed away, and her sister didn't do much besides look for her and lay around and look like she might cry. So yes, I believe that animals experience grief

[@alethehero5571]

I saw the same when one of my dogs died; his sister had tearful eyes for weeks, wouldn't go to the door and bark, didn't want to play and after a couple weeks, and looked way older than she was; I can see her sad even now and it's barely been a year

[@adriancarlito8830]

​@@alethehero5571Well my uncles dog basically killed himself because of grief. He didn't eat for days and eventually strangled himself to death using his collar.

[@Danny-us6ut]

When my grandma golden retriever died her dachshund didn’t give a sh*t

[@ar.kaninikadeysarkar5104]

Omg same happened with my dogs! The brother passed away a week back and the sister is so sad😢 I dont know how to get her back. She is severally depressed

[@Danny-us6ut]

@@ar.kaninikadeysarkar5104 yeah, the difference between your dog and my grandparents dog is my grandparents dog wasn’t sad

[@gman4906]

Anyone who's had a pet knows animals have feelings. You can sense it

[@shortyrags]

This could very well be a classic example of our own bias for anthropocentrism. Humans are great at projection.

[@senny-]

@@shortyrags Or narcissism. Are we humans really that special? It makes much more sense for a lot of animals feeling emotions like grief instead of just one. Plus, I've been to vet school. Animals feel more than they let on. In the wild, if you show a sign of weakness, you die. So a lot of animals don't outwardly show things like pain. A real pain if you're a vet and animal's sick but you don't really know what kind of sickness it has. It's not like you can just ask them, and they probably won't tell you if they're wild or something, even if they can talk.

[@shortyrags]

@@senny- I don’t disagree with you that animals most certainly feel pain and definitely feel some sort of affect which I would generally describe along a spectrum of pleasant feeling to unpleasant feeling, as well as a spectrum of stimulated and unstimulated. So you as a vet have certainly seen animals within certain states of affect within these spectrums. Calling those states emotion is something I’m agnostic about, because we humans name, construct, and categorize our states of affect into ways that animals do not seem able to. I believe it’s that categorization we call emotion. I’m a fan of Lisa Feldman Barrett’s work here, and I think it’s telling that we have yet to this point been able to find emotional fingerprints in the brain. An animal such as a giraffe is certainly feeling something when an animal close to them passes away. Whether that’s what we call “grief”, I’m less certain about.

[@elfpiesomeanotherword]

​@@shortyrags I assume you are confusing categorization with experience. I am a fellow linguistic student and just recently went through the categorization field. To experience something is whether to know about, whether you retain an information about it or not, it is up to you. But experience is always an experience: it is present in any living being system. I'd say even not-living ones (like virus) like if they interact with something they aren't 'designed' to interact, they may not interact or evade it. It is an experience for a non-living being. It is not an emotion, it is a response. The human specie is able to develop any sort of pattern control, hierarchs, and even build systems capable of self-organizing (like self-learning AI or equations that turns our lives easier) and that doesn't translate that any kind of emotion is better or less. Only shows we have been developed at organization/categorization skills, at a species point of view. Now, from the point of experience, we may indeed have been granted extremely nice skills about how we communicate and how we can use them, self developing our skills based on experiences is a good example, it can be related to emotion but it is not an emotion. But from the point of emotions, it is almost like a 'recipe' in DNA we all (should be all, but lets presume) have. The sequences that are likely responsible to that, be it synapses, hormons (chemicals releases) or even both of them, are experiences but they don't translate as something exclusive. It is almost a trait for a being to be a being. There were several examples in the video and we could, through them, say they grieve and feel emotion. They may have not the same standards or pattern skills to deal with their experiences and solve problems like we do but they definitely have feelings. I find this topic very important and debatable because we often overlook animals and their feelings because of the "nature savagery paradox", I'd say it is very unpleasant to accept that our skills to name, construct, categorize and summarize things are equivalent to being superior in emotional levels. "Some dictator not a long ago was capable of uniting a country and laying terror, he had some extreme respectable skills on strategy and communication, yet his emotions is worldwide known as bad" Skills doesn't translate as "better feelings". I'd say it is empathy towards someone possibly harmful or non-harmful that brings the idea of emotion, but that is another profound and long topic that walks within psychology area, which I doesn't not study profoundly.

[@chatgpt4135]

@@senny- truly

[@scriptorpaulina]

I saw a horse die of grief once-he stopped eating, drinking, resting, grooming… it was very sad, because you could tell he was uncomfortable and unhappy even when we tried to comfort him.

[@meyr1992]

or that he died from a disease…

[@scriptorpaulina]

@@meyr1992 it took six months and we called the vet multiple times. We even did a necropsy. He was disease free and while not young, not old enough to die of nothing in particular

[@helenhighwater5313]

@@scriptorpaulina So did the horse lose a friend? Were there other horses to keep him company?

[@scriptorpaulina]

@@helenhighwater5313 yeah… his best friend, of god only knows how many years… 10? 20? They’d met when they were maybe 4, or even earlier, and even though his bestie was an AH, Hershey stuck to him like glue. But when he died, it was like Hershey just… gave up. Nothing we could do could bring back his sweet, friendly personality. Not time in the pasture with the other 20-30 horses, not extra grooming and food (which he didn’t eat), not free rein of the entire paddock so he could drink as much water as he wanted, (previously his favorite activity). He just… stopped wanting to live. And it was sad and terrifying all at once, because I felt like all I could do was try to ease his passing

[@francix7978]

@@scriptorpaulina That's so sad, the loss of a close one can be very depressing even for animals. But please what is an "AH"?

[@charlie-qh2ll]

I have seen what I would classify as grief in the many dogs I've had throughout my life. I am wary of anthropomorphizing non-human animals but there are some human emotions that my mind recognizes in non-human animals.

[@vasectomyfail442]

Do you ever feel grief for humans that have been attacked by dogs? Dogs are responsible for 30-50 deaths every year in the u.s. There is a person bitten by a dog almost every ten seconds.

[@charlie-qh2ll]

@@vasectomyfail442 WTF does that have to do with non-human animals experiencing grief?!

[@cesarheuvelmans]

​@@vasectomyfail442seems like they didn't watch Cesar Millan 👀

[@HurricaneHunter]

Knowing of the deceased makes one grief.

[@clusterstage]

@@charlie-qh2ll his vasectomy probably failed because of a dog attack. username checks out.

[@kirbymarchbarcena]

If animals can express anger, happiness, and fear, then they can express other emotions such as grief.

[@nicolenikita9325]

I agree

[@Kindness8811]

But that would be a logical fallacy there. Just because something can do something like us, it doesn't automatically mean it is capable of another thing we can do as well. But even if other animals wouldn't be able to grief we should always treat them in a good way 😃. We're all animals. Since humans have the power to treat other animals in a good way, I think, we're able to decide for the option which causes the least harm.

[@OmniNeon900]

⁠@@Kindness8811Fallacy? Bro humans are just as animalistic and can act just as crazy as a feral monkey. Humans aren’t the smartest forms of life. We get mad if the food we order isn’t right, we kill our own cause we’re mad, we bully each other for the sake of ego. Animals can be just as intelligent as people as people can be just as primitive as animals. Humans are literally animals. Our brains just evolved differently than the animals you see out in the wilderness.

[@YouWinILose]

​@@OmniNeon900It is still a fallacy to assume, but we *should* err on the assumption that they have the subjective experience of grief. It is important to understand fallacious/faulty reasoning. Think about plants as a simultaneously more and less ambiguous example: they undergo chemical reactions that mirror our own for stuff like pain. Do they have the ***experience*** of pain? Is it painful? How can we investigate that? Also think of Theory of Mind. You never know what anyone else's experience is like because you will only ever have your own experience. Far harder when you have different neurology entirely.

[@foam3132]

@@YouWinILose He was mainly talking about animals, not plants, but I see your point. Imo it is best to make the assumption that animals do indeed feel seeing how they act at times, when it is obvious. How they do it is a whole other arena. We and all others animals are not so different. Using that argument to say that "they don't feel emotions" adds a layer of arrogant disconnect between Humans and animals, despite the fact we are the most vile of all animals. Half the things we do and for those reasons would have most animals wondering if we ourselves feel emotion. Using that argument to say that "they do feel emotion" adds a connection between animals and humans, but there needs to be a way to also state we are different

[@adamkey1934]

Animals (mammals at least) definitely have emotions. I know this is anecdotal but the last cat I had was a rescue cat that was a few years old. We brought him home and he was obviously confused and frightened. Ran about all over the place. I said his name and he instantly stopped, did a double take and stared wide eyed. As if wondering 'how does this person know my name?' Exactly the same facial expression a person makes when shocked/surprised. They feel emotions, they just can't vocalise them like a person would.

[@helenhighwater5313]

I wonder if your cat had belonged to someone who died.

[@kittyocean]

I once saw a duck (female) hit by a car. The body was moved away from the street and onto the sidewalk, waiting for the city to clean it up. A mallard landed next to the dead duck and sat down. He didn't move, until after the city took the body. That was the moment I realized animals are not 'just animals'.

[@VVilde36]

@@iridium8341 nah you should be the animal, for you to turn on the one showing humility and empathy lowers your status iridium8341 - why is it funny that they are ashamed that we always assume we are the center of the universe, what has it gotten us? assuming certain diseases don't get to us, assuming some diseases belong to some humans, we all have our personal pride in relation to science info, but to assume we are "better" is where we go wrong. We made atomic bombs. and atomic winter would b out tru destruction but in truth we did that to ourselves, we deserve no column of power or credit right now really

[@meyr1992]

@@NOOBCRASTINATOR69alright sell your house and all your belongings and go live in the forest with all the animals you so love and wish to live with

[@NOOBCRASTINATOR69]

I'm sorry for cussing

[@lolk7726]

this happened to me with rabbits

[@pillsburydoughboy1627]

​@@meyr1992what did that person say? 💀

[@isabelleblake8732]

I am an animal scientist and biologist and have studied grief in dogs. Although anthropomorphizing other species is dangerous, I can say with certainty that some animals DO grieve by most accepted definitions. We will never know the thoughts or emotions of another species truly, but it is important to act with caution and consideration when making husbandry decisions and grant our animals every comfort we can, especially when they have lost a companion or family member.

[@andreasjonsson5071]

Cows kind shows the same behaviour in the milk industry when their calf is taking away from them after birth, its a bit concerning thinking about it. I think it makes the thought difficult of drinking the milk myself

[@kamikazeblackjack]

​​@@caramela1309t's really ez for people to forgot about factory farming and such because its so common and we are so disconnected with our food and where they came from i bet most people never seen a cow getting decapitated irl which is horrifying to see

[@samuuu9350]

Can you explain why anthropomorphizing animals is dangerous?

[@tomodomo7675]

​@@samuuu9350if everyone actually felt sorry for animals then we can't exploit them for experiments and make those really tasty meat boohoo 😢

[@rosescott9299]

I once saw a pack of wild dogs (street dogs) surround their dead friend in a circle with their heads bowed for an entire day. The dog that died an old dog, and he was my friend (I stopped by regularly to give him treats and say hello… he was a good boy). When he wasn’t there where he usually was (on the corner in a cemetery) I went looking for him. In the distance I saw the circle of dogs. They let me approach just enough to see who their fallen friend was. When I drove by that evening, they were still there as they had been in the morning, still in a circle with their heads bowed. At that moment I knew that we had more in common with animals than is assumed by most. This was probably 25 years ago and I’ve told the story many times, but I don’t think most believed me. I can only say that it truly affected me, and has shaped how I live my life though, with love and compassion for all living things.

[@natileroxs5226]

The fact that some people think animals don't grieve is so weird to me. My cat would whine and yowl for days after my other cat passed away. We made sure he had seen her body before we buried her, just so he wouldn't be confused and so he could mourn with us. Animals have such deep emotions that we really just don't have the capacity to understand yet.

[@andreasjonsson5071]

Cows kind shows the same behaviour in the milk industry when their cald is taking away from them after birth, its a bit concerning thinking about it. I think it makes the thought difficult of drinking the milk myself

[@NyeCOOL225]

cuz most of these ppl are scientists there like executives in a building company or smth they dont have a inside understanding of animals theres nothing rong ith these ppl but still

[@MrChickennugget360]

many animals don't grieve. grieving is something that happens with social creatures.

[@hugomventura]

@@MrChickennugget360 grieving occurs with the value of an object. If an animal values an object to the point of possession or protection it's capable of grief. The real question is how impactful is that grief. Most animals don't grieve in the sense of it changing their whole being like us but do grieve similarly to how we might grieve the loss of a phone or diary.

[@ocean6462]

​@@andreasjonsson5071not sure if someone has said this but yeah definitely stop consuming dairy and please eat less animal products :) It's very feasible to do and vegetarian food does taste good. Animal cruelty is ubiquitous in the animal agriculture industry and many people seem to ignore it because they consume animal products. I get that, it's hard not to especially if you're used to eating one way, and some animal product consumption is beneficial for a balanced diet, but a very small amount. Do you still consume dairy, if so what do you think about stopping and consuming less animal products in general?

[@sf3454]

"But what is grief, if not love persevering" OMGGGG 😭😭😭😭😭 THE FLASHBACK UGHH IT'S SO GOOD

[@oliviadavis3638]

One of my hens went broody and hatched four chicks. She was a great and protective mother. Her nest was attacked by a raccoon not long after. While she guarded the babies bravely, one was killed by the raccoon. (She had sustained some superficial cuts and claw marks from using her own body to shield the chicks, and lost some feathers, but the other three chicks were not harmed in any way.) she could definitely tell, and I could definitely tell too. While her other chicks were happy and energetic as ever, clearly oblivious to the absence of their sibling, the mother hen was depressed. She did not eat for three days, barely seemed to have enough energy to stand with her chicks as they ate. She stood in one spot for long periods of time while her chicks played, not interacting with them, her head tucked close to her body. When you looked her in the eye, you could see clear as day an overwhelming sadness. It took her about a week to get mostly back to normal, and the healing process was definitely sped up when i gave her two foster chicks to raise days later. It was like she was reminded that despite her grief, she still had five other babies depending on her. Some may argue that she was behaving like that because of the minor wounds she received protecting her babies during the attack, but chickens are able to hide pain extremely well and the cuts were not enough to cause such intense behavior changes. Chickens hide their pain on purpose as a survival method (if they look weak, they’ll be targeted by predators). And later, the wounds became infected (we treated them and they went away) but they were much more painful like that. Except she’d recovered emotionally by then, and we had no idea for weeks. I believe she was definitely grieving and understood that her baby died.

[@DB-me7ol]

It is interesting how human act as if they are the only ones who feel grief and can think but then act in the coldest, thoughtless ways

[@Iloveme715]

Right

[@JojoJere]

you are one soo... 🤷‍♀

[@anthonyyoung6659]

I had two parrots, both siblings. One was called Curro, the other was called Pollo. They are brothers and sisters. Both Pollo and Curro used to live in the same cage and never fought. They were taught to talk or learned through imitation. They could speak each other's names and a plethora of other words. However, four years ago, Curro passed away and Pollo, I think, fell into a depression. He stopped speaking a lot and barely likes to come out of his cage anymore. Additionally, Pollo can imitate a crying noise as he copied it from my baby brother. But sometimes he would randomly say Curro and then proceed to cry, even up to today. Of course, this could just be a coincidence, but I know for a fact that his actions and demeanor forever changed when Curro passed away. Therefore, I believe that animals, at least from my experience, such as birds, can feel grief and empathy.

[@hariom24]

Get him a new friend bro

[@rlsvid]

If birds can grieve, which I'm pretty sure they do, they should also feel miserable inside cages, not being able to fly freely. I know it's not the subject but I can't fathom how is it normal to keep birds in cages and calling them pets, nobody ever talks about this

[@Laurelin70]

@@rlsvid While the loss of a loved companion is something very real and tangible even for animals, "freedom" is a very complex concept. Most probably they don't want to be "free", they just want to go out of the cage, at least every now and then, or they want more space where they can move and explore, or they want a more stimulating environment, or they want companionship. Being 'free" usually means being subject to predation and diseases and starving, and that's something no animal (not even humans) wants. A good owner must provide what they need, and not what (S)HE would need if (s)he was in its place.

[@okayokey]

@@rlsvidI used to have a bird named Neo. We never clipped his wings, and we used to go outside with him. One day a flew away, but came back like 5 minutes later. He also could be very serious at times. If he didn’t feel like playing on a certain day, or if he got bored, he would close himself in his cage to not be disturbed. He’s unfortunately dead now, but if he thought me anything is that they have preferences and their own way to communicate. He had a certain type of chirp to signify that he wanted to be left alone in his cage, or if he wanted me to open his cage. I don’t think a bird would feel miserable to kept in a cage, if said cage wasn’t a forced constant, but rather a chosen one.

[@mime514]

It’s possible he may be experiencing loneliness, so get him a companion. Parrots are social animals

[@eunoia2849]

I had a family of stray cats living in my garden for quite a while. One of the kitten's body was found dismantled with her tail and limbs detached, probably from the attack of another cat. The mother soon left with her kittens, though used to come back and wail occasionally, like every third day. She still visits the place, and cries for a considerable time. Her wails were so agonising, it's like she was violently lamenting over her child's death. Her wails still ache me.

[@superamario6464]

:( Thanks. I said I wouldn't be sad today

[@skapaloka222]

this one broke me finally, i’m tearing up

[@late8641]

Thank you for the correct title "other animals". Some humans really have the hubris to think we are separate from the animal kingdom.

[@catpoke9557]

It's that same kind of hubris that even makes people question if other animals feel grief. Really no reason to think we're the only animals to feel it.

[@neila6340]

We aren’t animals

[@late8641]

@@neila6340 Yes, we are. We belong to the kingom _Animalia,_ and we are great apes.

[@catpoke9557]

@@neila6340 What are we?

[@neila6340]

@@catpoke9557 people bruh

[@daniyalshah4338]

The thumbnail of the elephant grieving sums it all they are the most emotive and family oriented species on earth

[@PhonyLyzard]

This video is basically just 5 animals deaths that will make you cry, great video, I unironically really like it, stellar as usual.

[@HONOUR-34]

The part about elephants in this video was the most impressive, and I felt grief and finally I was motivated by thinking about the sadness of animals. Thank you for providing this video.

[@potatomatop9326]

As an animal, i can confirm that i grieve.

[@KickCaesar]

exactly what I was thinking

[@kushagraverma4943]

But you are plant(potato)

[@ChiemelaDN]

You absolute plant

[@crusternwave]

i think you are from taters class?

[@artemis7496]

Humans are also animal

[@some_guy_with_a_hat]

I had 2 ducks growning up on a farm. One died in a Coyote attack. It was a long time before the other duck would eat anything. I believe more animals grieve then we realize.

[@shadowwriter329]

I remember seeing a video of a troop of monkeys grieving. They had a fake baby monkey that was a spy camera to get a closer look at the troop’s interactions. One day one monkey was carrying the spy and accidentally dropped it from a high height. The reacted at once and tries to help it but when it seemed like the unmoving baby had died…they all gathered around. The large group circled the “dead” baby, some bowing their heads and some holding family members. I have no doubt animals that display high level and complex emotions and understanding can grieve.

[@rl9217]

“It’s enough to make a grown animal cry, and that’s okay. You go right ahead tear!” -Emotions and grief in nature

[@cheese5207]

This was beautiful and bittersweet to watch and think about.

[@JackieOwl94]

My dog, when his elderly best friend passed away, he knew she was gone, as we showed her to him, but he always became sad and lowered his ears and tail whenever we mentioned her name before looking out into the road from the window. He wanted her back, but he didn’t seem to understand why he felt so bad, because his behavior would change as if he wanted to try to cheer himself up but needed to grieve. It was a very interesting thing to see in the years before he died. I don’t know if he understood why he felt that way, but he did.

[@NXE212]

I am surprised crows isn't mentioned here, they are known to hold funerals and very social between each. Even if maybe they do that just to understand how one died and how to avoid it, altho it is not the exact same as we separate between inspection and funeral, it is still fair enough to say that they understand death, maybe not in a griefing way but it's still a way to understand death that we humans also do though out the time.

[@sketchyskies8531]

I never thought a Ted-Ed video would make me tear up but here we are

[@Hammadisteachingchemistry]

Can we really appreciate the topics they choose to talk about

[@enderrabit8128]

I hate the idea that humans are better then other animals. I hope that we can view other animals as also possessing feelings soon.

[@rickseiden1]

If you've ever had two dogs of about the same age who grow up together and are best friends, you know that when one of them makes their last trip to vet, the other one is not the same. Your surviving dog misses its friend. This happened to us about a year or two ago. The first dog passed away on the way to the emergency vet. He was old and it was his time. Our other dog changed. She became less there. Less responsive. Less "happy" almost. Her health started to take a turn for the worse, then her eyesight started to go, and it was her time. They both lived good long lives, were loved, and loved us. My daughter says, "Between hello and goodbye is a whole lot of love."

[@sergei2882]

I'm sure that they had a whale of a time with such a considerate owner!❤

[@rickseiden1]

@@sergei2882 Thanks!

[@Kay-iq8ht]

that last phrase your daughter says made me cry because it's so true😔

[@sairamsk3206]

The pain of a loved one's death is mainly seen in mammals and birds, including humans. But fish, insects and many types of marine species are the survivors of the fittest. So, they don't have many problems with emotional pain which disturbs their survival.

[@boringbilal]

Yet, we can't confidently make that claim. Who knows if insects and marine species express emotions in different ways? As the video says, more research is needed.

[@dork7546]

Birds may actuallt not feel grief, though. This assumption is mostly based on how ravens tend to surround the body of their recently deceased but the current theory is that they don't actually do this because they're grieving but because they're trying to learn how they died.

[@dork7546]

@@boringbilal Yeah, but it also says that we may as well project human characteristics onto non human animals. Yes, more research is needed but we do already know that a lot of animals don't experience emotions such as guilt, romantic love or shame, so why does it sound so crazy that some animals out there may not be able to experience grief while others are?

[@catcatcatcatcatcatcatcatcatca]

You could identify similar behaviour in early modern humans under bad circumstances. To me it doesn’t seem reasonable to look for emotional behaviour in such cut-throat environments. For all we know cannibalism is rare among modern humans because we largely don’t need it to survive. If we did live under such conditions, would we as a species not have emotions?

[@catcatcatcatcatcatcatcatcatca]

@@dork7546That’s a great evolutionary pressure to develop the feeling of grief. We as a society investigate tragic accidents closely precisely because we see them as tragic. Emotions should in themselves offer evolutionary benefits to be plausible in the first place. Evolutionary beneficial behaviour is a prerequisite for developing of emotions, not a mutually exclusive alternative.

[@RealDemimondaine]

My father died recently, and I’ve always wondered how other creatures of the world grieve when their relatives die. Thank you for this timely video.

[@terramater]

That's absolutely true! Our crew got on camera a giraffe in Tanzania that investigated the scene of a death. Her offspring has fallen prey to lions. Now, all that remains is its bones. This rare and intimate footage shows how giraffes may also mourn their dead. It's very emotional to watch it, but it also shows exactly what you guys approached.

[@The_Grecian_Empire]

wowza

[@Apwbdtosct]

This is one of the highest quality animations I've ever seen. Kudos to the creators!❤

[@paluxyl.8682]

But what about represtation ??? .... not a single time was a male human or animal mentioned.

[@DrizzyB]

​@@paluxyl.8682 tf does that have to do with the animation quality??

[@Polarcete]

The animation on this video was astounding, and the music was perfect for the tone of the matter. Thank you for putting so much effort into your content

[@LushSSB]

I had a dog growing up. He was really happy but after his brother passed away he got extremely depressed, I never heard him bark again after that.

[@theressmthinthestatic]

Since one of our cats passed away last year, the other has not been the same. He's quieter, less playful, pickier with affection, sleeps more, and has had some health issues crop up. He used to prowl around all the corners of the house meowing for days trying to find his friend. If I were talking about person no one would give me a second thought if I said he was depressed. We ended up getting another cat so he wouldn't be as lonely, and he does love that cat very much, but I absolutely think he is grieving his old friend.

[@martynap2930]

I had two cats growing up, when the younger one died in an accident his friend looked for him for weeks after and meowed like he was calling for him to come back home. It was heartbreaking to hear 😭

[@Ermude10]

People are quick to dismiss animal feelings for anthropomorphism, but there's so many studies (many quite cruel honestly) showing that in every way that matters, so many animals can feel and empathise just as humans can. And even without studies, anyone who's been close to an animal (even fish) can recognise their personalities and traits, that there's a feeling being inside of that body. The sad part is, there's a huge disconnect between what's on the plate or the clothes being worn, and that recognition of feelings in animals in the general public.

[@StrikeWyvern]

I used to have a male and female green anole as pets, they're social animals and change from vibrant green to dark brown depending on factors such as heat, and social reasons as well. They'd been together for years, and the male eventually died. The female stayed brown for days and ended up dying less than a week after the male. I'm not sure if it was coincidence or if that other lizard really did die of a broken heart. Lizards aren't usually known for having higher emotion like that, but it was certainly a strange thing to witness from an animal that isn't supposed to be able to do that.

[@frozenBird925]

I'm glad this is being talked about. I believe assuming they don't feel these emotions causes much more harm than treating them like they do, especially since they act in a lot of ways we do when in similar situations.

[@Hanjo14]

this channel never failed to pique my interest

[@synsvids]

My mom's family has always had cats, but one story of two of them has always stuck with me. Two of their cats were best friends, but one day, only one of them came back from the forest. She'd always make a sad yowling sound whenever she was alone from then on, and my mom thinks she saw her friend get attacked by a coyote and saw them get eaten. I think the cat who didn't come back was named Pumpkin, and the one who did was Marmi.

[@Kayla-eh5fb]

My uncle had a dog and when she gave birth to her babies, he chose to sell them all and when she realized they were gone she didn’t eat for a month and would make weeping noises. I believe all animals can have the sense of grief,some more than others

[@camerongrow6426]

Always nice when TED makes me tear up on my lunch break

[@erasjt2585]

I can't help but to appreciate the animation. My god the animation is so awesome. Every walking animation could take hours and hrs of work. ❤ Love u Ted Ed

[@LeprosuGnome]

What a beautiful and touching video. Definitively one of my favorites. Animation, music, text and interpretation are 100% on point.

[@arturleperoke3205]

As a non-specialist in animal-behavior and psychology (like all the rest of my fellow youtuber-commenters) I can confirm that my pets are able to express complex emotions like us humans.

[@Myn0o]

When my dog lost her baby, she refused to eat for several days, she even cried at night like a wolf. Saddest part is we never found out what happened to her puppy. We just assume that somebody took that puppy

[@Myn0o]

@bryanvillafuerte765 I live in the Himalayas dude. There are no securities here. Not everyone lives in a convenient place like America

[@erikh8685]

Wow so beautiful. Very sad too, it seems like there is a capacity for grief in some animals.

[@funnysapiens]

Hats of to the person or team who composed the background music! it's beautiful.

[@haridandapani]

Given what we know about the rich and vibrant emotional lives of animals, it is truly a shame that we confine them in factory farms, torture them, and kill them just to satisfy our fleeting pleasures.

[@PhoebeFayRuthLouise]

Yes! Absolutely shameful!

[@JojoJere]

We dont, the industries do. Ethical hunters don't either

[@rajharsh2658]

YOU GUYS MAKE ME FEEL THAT I MUST WATCH ALL OF YOUR VIDEOS ❣️

[@KiuhKobold]

My aunt worked on a restaurant that had a couple of geese, and one day the female died in an accident with a car on a nearby road. The male, whose name escapes me now, wouldn't eat, vocalize or even move for days on end, isolating himself even from the owner of the restaurant and the other animals. I describe it as such not to say "He fell in a deep depression", but just goes to show that the behavior and symptoms felt by non-human animals isn't too far from ours. We know of members of our species who went through the same series of reactions that goose felt.

[@luuchoo93]

Anyone who has been close to animals knows, without doubt, that they experience emotions, happiness and sadness.

[@matildaderkowski4119]

Once when we were cutting down a tree in our backyard it hit a magpie and ended up killing it, for the following weeks other magpies took turns watching the body and wouldn't let anything come close. They appeared to be talking to the dead magpie as if trying to ask if it was ok

[@benaronson2410]

The art on this video is fantastic!

[@cocopen3415]

Thank you for this video. I truly appreciate it

[@senny-]

I've had some experiences of my own. It sure if I was just assigning human emotions to them, but you all be the judge: > Our female dog became a mom twice, bad both time, all her pups died. We were poor then living in a third world country, so we didn't get the luxury of going to the vet. One of her pups actually grew up for a couple of months, but eventually died for some unknown reason. After those incidents, her personality changed for a long time. She from what I would describe it "cried" every now and then, making those weird humming sounds, seemingly looking for something. It was heartbreaking. Rest in peace, Mel. Wendy, and all your other pups, surely have waited for you. > I kept two male mice and had them for over a year. Over a year is a pet mouse's usual lifespan. One of them got increasingly weak over time, and eventually succumbed. When I found him, his body's already cold, but his bud remained on his side, sleeping while being tucked to each other like they used to. It broke my heart separating the two. The mouse remaining wasn't in any weak at all prior to that, but after being left alone, he eventually changed and won't move like he used to. He died surprisingly to me just a week or two later. Their names were Ruby and Carbuncle and I'll never forget them.

[@equine2020]

YES. Being with animals since 5yrs old & living with all types of animals I've seen the grief, & pain they feel for another animal.

[@totalfreedom45]

These animals are known to grieve-elephants, great apes, monkeys, chimps, giraffes, dolphins, and dogs; perhaps birds, bison, and turtles do too. 💕☮🌎🌌

[@kirara2516]

You forgot cats

[@totalfreedom45]

@@kirara2516 Scientifically, you're right. 😽

[@crispyein8601]

The background music is excellent!

[@longwu9412]

This is simply beautiful, the content, the animation, love this channel

[@Thekingmaker]

It's impossible to remove ourselves from the human mindset, and so we are projecting the way we grieve onto other animals, it may be that whatever behavior they display is actually more of what grieving is than whatever we do.

[@spoupsmcdoups]

I can definitely say that dogs grieve. My family had a boxer that passed away a few years ago and when he died our Yorkie was constantly looking for him and seemed really sad for awhile until we got our other Boxer later on. He would even sorta take care of our Boxer months before he passed away

[@hemlockj4338]

We always look at things through the lense of "humanness" that we've forgotten to think that grief is a universal language that transcends a lifeforms' beingness.

[@sergei2882]

Such an eye-opening, poignant video! Ted-Ed talks, thank ya for your variety of information you always share with us in the videos. They are truly wonderful and unique!❤

[@theWZZA]

Human or animal, we all have the same basic needs, relationships and life cycles. Kindness and compassion is the best path.

[@jojospice3353]

I am sure that animals can feel everything. A human, in the end, is also only an animal

[@Geniusignotus]

Wrong. Humans are the most important animals- nay, the most important species to ever exist on this planet. No other species can survive on Earth without ourselves first existing.

[@BGI_guy]

​@@GeniusignotusThe dodo

[@Geniusignotus]

@@BGI_guy And remind me, what is the status of the dodo?

[@bigeman]

​@@GeniusignotusExtinct because of humans.

[@thefastcommenter7774]

Humans aren’t animals but believe what you wanna believe

[@MrsJudithWright]

Great topic. Love how they illustrate with Tahlequah, Eleanor ... Thanks TED Ed!

[@tyrant-den884]

Our last two of 7 chickens were extremely close. Our one silky was bullied by the other 6, until there were only 2; and they became inseparable. Only the silky is left now, Phyllis, is left; Lucy died 3 days ago. Phyllis gives the most soul wrenching calls each morning.

[@zoesakurablossom5327]

Beautiful illustrations and a fantastic insight on the topic. Thank you ❤

[@eryka2041]

Animals feel pain, show emotions, and have shown intelligence in ways we have yet to discover. As human beings, living amongst other animals, we are not the only apex predators on Earth.

[@ZoFuego_]

When my dog passed away, before we buried him, we were all standing in a circle with his body in a wheel barrel. My dad's horse walked up and tried to wake him up and then the horse started shedding tears. I am not joking and I was actually shook. Animals are so smart. I will never forget, miss my dawg!!

[@saatvik-agrawal]

The WandaVision Quote at the start 🎉

[@No_Direction-99]

I survived in the end but it was heartbreaking to see the videos of my dog when I was in the hospital. She stopped eating and kept pacing. She searched for me and staring acting defensively. She only settled when I came home and she saw I was okay. The person I left her with sent me the videos because I asked after he described the change in her behavior. It concerned me so I wanted to see it so. She was family and it was very important to me to know exactly what was going on with her so I could try to make her happy in any way I could. I miss her… 🕊️

[@AnimealPlanet]

They are stronger than us because they don't need religion to comfort themselves or others when people they hold dear dies (｡ŏ﹏ŏ)

[@user-lr8ow2jg4e]

Yes because they can't create one (yet)

[@JojoJere]

What does religion have to do with this? Religion doesn't make people weak? You can't even spell Animal right, what's an "animeal"?

[@mozart27th]

I've been living with my dog before for two years.. and when i started working away from home, my mom told me that my dog is very sad, she doesn't wanna eat, she doesn't wanna play. She's just waiting near at our door every single day(maybe waiting for me) . Then i suggested to my mom to send my dog to me.. and when i finally saw her after a month or two. She greeted me with joy and I can't help myself but to cry. A happy and chubby dog that i knew before became skinny like she's about to die..

[@TovenDo.O.Video-]

We are animals. If our species can feel complex emotions it's obvious that other species can too. Emotions were evolved just like everything else in our body. They are chemical reactions, not fairydust.

[@peterii3512]

Exactly, people seem to forget we're animals. Even day to day plenty of examples of emotions in pets.

[@Tacobellcramps]

Animals are capable of it, and just like humans, some have absolutely no reaction. Some people comment about “well MY animal didn’t show any emotions” like humans don’t do that. My dad had a brother he loved, but when his brother died, he acted as if nothing was wrong and everything was normal. He missed him, but didn’t cry, grieve or anything. It was a bit disturbing, but he’s still doing well to this day.

[@stephenquinn5591]

They don't understand death, we don't, but they feel the affects of losing a friend, child sibling and parents. They suffer the loss of a regular interaction and bond. I imagine they're looking at the body confused, why is it not responding anymore???? Primeapes, elephants and mammalian Sea creatures might know they are in a state of death but don't know how to react to that

[@kriegenjoyer6913]

we didn't used too, we would wonder why people feel asleep and never woke up

[@foppypoof5195]

Crows absolutely 100% understand death though, they hold grudges against any animal/person that they think killed one of their own, and they even pass that grudge down to their offspring via communication, meaning they can hold generational grudges.

[@BlueRidgeCritter]

Oh goodness, in my years of farming, having pets, and being around animals, I have seen animals grieve. And I do understand there is a difference between a confusion, or a herd loss thing, etc that probably isn't "emotion" like ours. But especially with dogs and cats, absolutely. We had a dog stolen once, and her "mate" grieved to the point that he lost 25 lbs and the vet almost put him on antidepressants. He finally came out of it, but the grief was every bit as human as anything I have ever seen. And when we lost one of our dogs a few years ago (had to put her down), the other dog grieved, but check this out - the CAT was the one to show the most emotion. And no, they weren't bonded or anything. But you better believe he showed the loss very clearly, not as much as my wife and I, but definitely very much. Nobody will ever convince me they don't have a lot of our emotions.

[@bivashchaudhuri4]

I'm from india and here it's very common to have lots of street dogs and they have their locality where they stay together in a group. Once a familiar group of dogs in know had a deceased member they all gathered together and almost gave it a last tribute in their own way😢

[@sharmilamazumdar1981]

Good to watch this video . I certainly believe that animals experience grief. Human should pay respect when animals go through grief. God bless animal kingdom.

[@randomname285]

its no surprise at this point but still worth saying: amazing animation

[@aliud9904]

Well this made me cry in 30 seconds Oh god it doesn't stop

[@_Contrary]

Once a mother dog lost her 3 puppies in my neighborhood due to a contagious virus infection leaving only one and the mother was searching for them for quite a few days.

[@FaeriePrincex]

An Orca held in captivity screamed and cried for a really long time, using distance vocalizations after her daughter was taken from her. Other orcas would occasionally check on her but were scared off by the intense stress of the mother, who "cried" for ages after being separated

[@VectoorX]

I remember when I waas 7 yrs old, I had alot of pigeons in my back yard, when the oldest pigeon died. All 34 pigeons surrounded him, almost like a funeral ❤

[@masonharkness6437]

If you’ve spent significant time around animals you know they have emotions. Im sure it ranges from species to species and they probably aren’t as complicated or intricate as ours but imo it’s no question they have feelings in some capacity

[@mecahhannah]

Awesome as always thanks

[@krackacka]

I gotta say the soundtrack was well-picked. Felt very sad for the animals in the story, the music helped with that.

[@shanec3098]

If you have ever seen an animal lose a companion, you know they can grieve.

[@celesefernal2490]

I love the use of "other" in the title to remind us that we are also animals.

[@danielsantiagourtado3430]

You guys are awesome 🎉🎉🎉🎉❤❤❤❤❤❤

[@GAshoneybear]

When one of my dogs passed away, the other grieved herself to death. I couldn't feed her, console her, nothing. I definitely believe animals have emotions.

[@lyxthen]

When my cat passed away, my other cat became extremely grumpy and angry and she wouldn't let us touch her or get near her. I don't know if that is "grief" but she ceirtanly had to have noticed.

[@thehappyloaf]

The visuals are so so beautiful