Harder Drive: Hard drives we didn't want or need

In this video we make and evaluate several hard drives that we didn't want. Drawing some inspiration from vexing current events, we find that creative, structured thought on adjacent (but frivolous) problems is a sort of digestive act, and one that is ultimately laxative.
Paper, source code, ringtones (and for a limited time, the data and viewer from pinging the whole internet): tom7.org/harder
Errata (thanks to all pedantic viewers who catch this stuff):
- I got the escape velocity off by a factor of 1000! It's 11 km/sec, not 11,000 km/sec. I think the other calculations are correct; I just mistook a period for a comma in my bleary-eyed late-night editing.
- I got the size of the genome wrong due to a very silly bug from bleary-eyed late-night programming. It is 29903 base pairs, which can be stored in an economy-sized 7476 bytes.
For SIGBOVIK 2022

[@catcatcatcatcatcatcatcatcatca]

“Tetris is a an inventory management survival horror game” is one of the best jokes I have heard this year.

[@joshix833]

is it really a joke?

[@Ensign_games]

its true though

[@endymallorn]

How is it a joke?

[@mihailazar2487]

@@endymallorn because of resident evil

[@eklhaft4531]

@@Ensign_games It's funny because it's true.

[@Natibe_]

I can’t believe it. This man did it. He downloaded more RAM.

[@DudV2]

*Uploaded

[@joshyoung1440]

​@@DudV2 hey, how do you retrieve something that's been uploaded, the entire point of uploading? What do we call that process again? 🤔 They are two sides of the same coin. They are two halves of the same whole. They are the flexor and the extensor. And most importantly, it is a fucking reference to a joke so if you don't know the joke, at least don't ruin it

[@traumatizedgeworth]

​@Josh Young the dude said one word

[@hata6290]

@@traumatizedgeworthLMAO

[@snailll9929]

@joshyoung1440 hey man, i used to be like you and let me tell you from experience, being so angry and snarky all the time is not good for you lol

[@TheWretchedOwl]

You know, a chainsaw could either be turned on or off, much like a bit, 1 or 0. So if you become a machine that would both catch chainsaws and launch them into orbit at a steady rate, as well as determine if each chainsaw is on or off, and has the capability to turn the chainsaws on or off itself, then you could in theory build an orbital chainsaw drive capable of storing and retrieving data, right?

[@DUDA-__-]

If you could change the chainsaw state depending on the previous chainsaw state, you'd have a touring machine.

[@purplelord8531]

@@DUDA-__- an orbit isn't touring - that requires traveling on earth's surface and visiting multiple locations i think you meant Turing

[@DUDA-__-]

@@purplelord8531 oh that's a dumb mistake on my side. :D

[@TardMan1]

Now you just have to build chainsaws with big enough gas tanks to keep them running throughout the entire year long orbit, haha.

[@MrCubFan415]

Realistically, the chainsaws would probably burn up when you first shot them into the air

[@jacobstory8895]

"Why not ping the whole internet? So I did." Absolute madman!

[@VeritasEtAequitas]

He didn't

[@_Heb_]

@@VeritasEtAequitaswhat makes you so certain

[@jimijenkins2548]

Morris worm moment.

[@BozesanVlad]

I wrote to all courts and prosecutor offices in my country , if they have electronic signature. The law is from 2001 and I was curious if they respect the law after 20 years. Twice. Irl People can do silly things..

[@gaweyn]

@@BozesanVlad and? do they?

[@SollowP]

"We can of course ignore air resistance" Spoken like a real engineer.

[@kevin42]

I thought pushing components 10% above their rating was peak engineering

[@TheRogueX]

I mean, for 99% of the journey the chainsaws are in space where there is no air, so it's a good assumption isn't it? xD

[@Deadeye313]

Just like the Seattle Tacoma Bridge builders...

[@MrC0MPUT3R]

Spherical chainsaw in a vacuum

[@CreepilyCrply]

Including air resistance is gonna increase a lot of energy usage per chainsaw

[@HBMmaster]

opening this video with a story about juggling arbitrarily many chainsaws is so good. immediately hooked

[@alfiegordon9013]

It shouldn't suprise me that your here, but it somehow both does and doesnt

[@FosukeLordOfError]

It’s the other weird things video guy

[@actualhyena]

You have good taste in obscure channels Misali.

[@FaxonFury]

of course you’re here

[@MattachineGG]

The crazy part about that whole story is that it's also a hard drive.

[@Nacalal]

For some reason, the idea of storing data in active network transmissions makes me feel an uncomfortable sense of panic in the same way standing against the window on the top floor of a skyscraper does. It's that sort of "I know it's safe, the chance of failure is extremely minimal, but there's no way in hell I'm risking it" sensation.

[@00SEVEN28]

At most, a TTL is 255, which means after 255 hops on routers, it gets dropped/deleted.

[@crispico4727]

This must be how tribal elders thought about storing their knowledge before writing was invented

[@killroy42]

@@00SEVEN28 It's our generations "oral" history...

[@theoebola2367]

24:52 > bandits dont have access to the data I could only imagine the horror a potential hackerman would experience if they discovered that the secret data they are looking for is stored in this mind-boggling fashion

[@benhuyck9797]

Tom7: “I don’t want to lose my data.” Also Tom7: *stores data in transient virtual ping pong balls*

[@JohnSmith-ox3gy]

Today we'll be playing broken phone with millions of strangers!

[@ukee31]

So many smart and witty people here... how did I get here? amazing

[@MrGeorgeFlorcus]

I love that we go from a dude juggling 1.2 trillion chainsaws in an elliptical orbit around the Earth, to, "We can now look at the entire internet" in like 4 minutes

[@oliviersavard8676]

"hey vsauce, tom7 here"

[@Ciurk]

and that is only like an eighth of the video 😆

[@TheWizardGamez]

@@oliviersavard8676 brain.exe is not responding

[@ticklefights]

The ultimate hard drive is the equations that govern the universe. If you want to know what your data was at any given time, you just play the simulation back up to that point and have a look.

[@benjamin6729]

Brilliant!

[@joda7697]

Unfortunately, entropy is a meanie and conceals which exact starting state resulted in the current state.

[@decide273]

and then comes quantum mechanics

[@wabibunny]

you know what, this looks like a great idea until you remember equations like Navier-Stokes.

[@godlia_]

laplace's demon :D

[@robertstevensii4018]

58 seconds in. I never want this ride to end. Better than 99 percent of entire videos so far.

[@robertstevensii4018]

It got even better

[@ts4gv]

hell yeah dude

[@cortster12]

1:00 As hilarious as it is to imagine a chainsaw going 11,000km/s, the escape velocity of Earth is actually just ~11km/s.

[@28mayhem]

Wolfram alpha tells me that 11,000km/s is about 20 times the escape velocity of the milky way galaxy. I won't apologize if I accidentally damage an intergalactic cruise liner while infinity wielding chainsaws.

[@Der1Metzler]

And also the escape velocity wouldn't put a limit on how many chain saws you could juggle in the infinity-wield, as is claimed in the video. That is because you can reach arbitrarily high altitudes and arbitrarily long travel times by approaching the escape velocity from below.

[@eideticex]

@@Der1Metzler At that point you could encode value via the height the chainsaw crest, a physical higher and low state but an arbitrary division of them.

[@YouKnowMeDuh]

Lol. Must have been a verbal typo to be off by 4 orders of magnitude 🤣

[@noneuklid]

@@YouKnowMeDuh I think he just had more fun adding "kilo" to the correct measurement.

[@thomaskaldahl196]

1:19 (Expanding brain meme) (1) Ignoring air resistance because it is negligible (2) Ignoring air resistance because it takes away from the point of a lesson (3) Ignoring air resistance because chainsaws cut through air like butter

[@awrsish]

Does your chainsaw not cut through air like butter?

[@t-o-m-m]

(4) calculating the resistance of a chainsaw through butter opposed to a chainsaw through air and appending the formula

[@almostanengineer]

Could you imagine being a network security researcher comming across his pings on their network, and reading the packet data and just being confused 😆

[@stromsky7352]

I found myself suddenly aware that I need to expand my friend pool when I could not think of any one I could share this video with who would properly appreciate it.

[@Hyraethian]

This entire video felt like, "okay bear with me." and I loved it. That map of the internet was so pretty.

[@cometkite]

For another interesting internet mapping project check out the "Internet Census of 2012".

[@monhi64]

This really feels like the long form educational version of the “never let them know your next move” meme that got pretty popular online not long after you wrote your original comment

[@madshorn5826]

"The map of the internet was so pretty." It was indeed. Funnily enough it looked a bit like drefragging old harddrives in the bad ol' days :-) And it reminded me of an old idea I had for navigating the internet way back when the net was new and we all read about William Gibson's cyberspace: Let each homepage be a square with user defined 3D art and navigate using a "double binary search". Using a fractal tesselation where a square is split into four squares which is split into four, ..., you can chose one of a billion squares with 15 up-down-right-left choices and see where you are going :-) I ever only convinced my brother that it was a good idea because storing that amount of 3D models and serving them to users was insane scientific fiction back then (1996). When Google Maps came around and showed the future was now ordinary navigation had won out... I made a mock-up 14 years ago in Visual Python. (It can still be found here on KZbin. Search for NeWS and DeStoreMaendDerLeger (The name derived from the corners of the world and the channel name) :-) When I get the time I will learn enough Unity to make a working 'city' :-)

[@masonaut0]

15:15 “Tetris is an inventory management survival horror game.” Couldn’t have said it better myself

[@HerobrineGaming]

"From the Soviet Union in 1984" 💀

[@Radar_of_the_Stars]

this is my favorite video on the internet, in the 10 months since it released I have returned to it many times, I have downloaded it on the off chance that an apocalyptic event wipes out the internet but not the power grid, I have recommended it at least once to every friend I have both real and digital, and every time I purchase a new screen, I use this video to calibrate color accuracy and contrast. I truly thank you for this

[@tom7]

Thank you for participating in the Emergency Backup Network! (:

[@electra_]

Make sure to back it up on all your harder drives :)

[@00SEVEN28]

At 8:00, be fully aware - some people have their ISP (gateway) "node" set to ignore/"block" to ICMP/echo requests; this is why these maps are always incomplete.

[@BillyBobCornontheCob]

Singlehandedly causing a new 'do not use for arbitrary storage' clause to be added to terms of service across the world

[@MrCheeze]

I feel like Cr*pto probably already did that by now...

[@ufffd]

@@voidify3 yeah that's the whole purpose of crypto, a distributed ledger. Node runners (bakers, miners) are compensated for the work

[@ufffd]

@@voidify3 I'm a special niche of bro that that folding ideas didn't prepare you for, my baker runs on a raspberry pi.

[@masken8355]

​@@voidify3 "I watched a video feed to me by the KZbin Algorithm™ to reinforce my confirmation bias." ftfy

[@codegeek98]

@@masken8355 what's the comment? Ironically, the algorithm won't let me see it

[@LARAUJO_0]

Fun fact: This video is literally about drives and about power.

[@chi221]

if you get hungry during the video, remember to grab some snacks to devour

[@__lasevix_]

@@chi221 and if you wanna succeed, you need to put in the work (and put in the hours)

[@rolls_8798]

took me a moment

[@BBWahoo]

I smoke rocks of crack, but they taste sour

[@Flabulo]

@@BBWahoo That doesn't sound right. But I don't know enough about crack to argue about it.

[@jamespike5161]

“Aww, I can only ping 1,000 times a second. It’s almost like somebody THOUGHT OF THIS” Jokes aside this is fantastic work. ❤

[@somenobodyaspresident]

Being able to see every IP address on the internet visualized makes me feel like an alien zooming a telescope into someone’s backyard. It’s truly mesmerizing! Edit: I should have waited, the farmland allocation analogy is perfect!!

[@nickpickle7665]

Well it’s technically not every address because quite a few hosts disable icmp for security reasons

[@vincentlemoine3830]

I'm surprised at how many actually replied...

[@KoiosDusklight]

I do appreciate the sheer effort of making a 30 minute video on inefficient data storage solutions to dunk on block chains. 11/10 video.

[@user-sl6gn1ss8p]

I mean, 30 minute video with three projects each worthy of a 30 minute video, just to set the punchline

[@monhi64]

I am totally new to this channel and holy shit the first 5 minutes of this video was the definition of the “never let them your next move” meme. I had no idea whatsoever where the video was going (Slight edit: I meant that positively even if I didn’t make that 100% clear, utter chaos is fun)

[@chrissoares8062]

@@monhi64no literally I’m watching this just now myself, and enthusiastically laughing at all of the first 10 minutes

[@DanteLikesRock]

i don't know what's going on, I'm so lost lol.

[@Anonymous-bk9xy]

*Taco Bell dong*

[@calmkat9032]

This is like a Defcon presentation where the topic gets randomly changed about every 15 minutes. Amazing

[@artieschmidt3039]

Do you mind sharing which video you mean? :)

[@niggacockball7995]

@@artieschmidt3039 i think you read it as "like the" other than that OP doesnt refer any videos, just what the presentation would be like

[@heinrichagrippa5681]

@@artieschmidt3039 Um.. _this_ one? The one you had to click on in order to write your comment?

[@heinrichagrippa5681]

@@camdt456 "I saw the man in the park with a telescope."

[@rigen97]

@@camdt456 the original comment wasnt saying that there _was_ a defcon presentation like this lmao they're saying if there's a defcon presentation but the topic randomly changes it would look like this video.

[@Spolt_main]

9:29 the madman did it, he pinged @everyone.

[@f.d.3289]

22:00 seeing the letters emerging on the various tetris games is one of the craziest and wonderfullest things i ever saw. awesome!

[@flibidydibidy]

"Inventory Management Survival Horror Game." Tremendous. Fantastic stuff!

[@LeKukie]

Yo I wasn't expecting to see you here 😅

[@LeoStaley]

I had to pause, I was laughing so hard. Came here to the comments to makes sure someone talking about it was the top comment.

[@hjfreyer]

I almost choked to death laughing. It would have been a good death.

[@raybarker]

yep, this was the point I laughed out loud.

[@LuxurioMusic]

That fully killed me, I had to pause cause I was laughing so hard.

[@trainzack]

I think the capacity of the tera-wield is overestimated. 11km/s escape velocity aside, the density of the chainsaws at the point where you grab them is not the limiting factor, but rather the density of chainsaws at the furthest point. According to Kepler's second law, the velocity of an object in an elliptical orbit decreases as distance from the focus of the orbit increases. Therefore, the density of objects in an elliptical orbit increases as you get further from the parent body, so if the chainsaws are packed maximally at the closest point, they would have to be packed supermaximally at the furthest point, which would cause all sorts of problems.

[@notnullnotvoid]

I wonder if you can juggle multiple (multiplexed) streams of chainsaws with slightly different orbits to get around this problem. That way you get close to maximum density at periapsis (the only point where the streams converge) without exceeding maximum density at apoapsis (which is actually several different points for several different streams). But I imagine it would be hard to schedule since the orbital period of each stream will be slightly different, so they will go out of phase with each other.

[@petros_adamopoulos]

@@notnullnotvoid Hmm a teraplex-wield... You wouldn't speak of orbits anymore, but of a swarm.

[@trainzack]

We do have to consider that where we stand on the surface of the planet also matters due to the unfortunate fact that the Earth rotates. The easiest place to stand for the original idea would be on one of the poles, so that you can simply dp a 24hr rotation to cancel the effects, but a crafty chainsaw juggler maybe could stand somewhere else and throw them at a speed such that they sync up to the day cycle. And then there's the tilt of the Earth, which when combined with Earth's rotation around the sun, means that the plane of our orbits will also change.

[@IpolsYoutube]

@@notnullnotvoid throw at different Speeds to solve schedule problems

[@jazzpi]

@@trainzack I don't think that fact is unfortunate at all. Since we can ignore air resistance, the chainsaws will just stay in orbit while we rotate under them. This way, we can fit even more chainsaws in our juggle.

[@frankj.hoffmann7030]

Found this by chance. I have not been entertained more in a decade. I salute you for going through all these ordeals to make this content for the community. Kudos!!

[@senvr11]

the ping drive was wild as hell and the chainsaw explanation was probably the best cold opening since the walking dead

[@Onychoprion27]

I think my favorite fact about the blockchain hard drive is that it’s faster than the Tetris one, but not by much. Like, way less than one would expect considering the absurdity of Tetris hard drive

[@user-sl6gn1ss8p]

maybe snes tetris could beat it

[@misirtere9836]

@@user-sl6gn1ss8p No, the issue with the Tetris hard drive is that NES tetris is actually *too* intensive, causing the computer to struggle when rendering all the games. Switching to *GAME BOY* Tetris, however, would likely improve results.

[@user-sl6gn1ss8p]

@@misirtere9836 hm, I think I thought they were all being ran at native framerates, but yeah, that wouldn't help either then

[@patrickgronemeyer3375]

He kind of lost me as a whole rambling about Bitcoin and energy. Current electricity usage for cookies, internet cookies is 500 times more than all of blockchain mining put together. Society waste more energy in ads and tracking people for targeted ads then all of Bitcoin uses put together. Thus the price of storing data in cookies is exponentially worse than Bitcoin because something like 93 trillion cookies are created a day. The sheer volume of data storage that is consumed by internet cookies and advertisement is borderline societal ending. You guys can hate on the blockchain all you want society currently uses internet cookies and it is a way worse burn of electricity and will grow exponentially worse and consume more electricity than the blockchain ever could consume.... His claims are not incorrect about blockchain but as far as from an energy wasting perspective internet cookies internet advertising is far worse than anything crypto could ever wish to become.

[@evilduck5691]

@@patrickgronemeyer3375 that's a whataboutism, and there's a difference between bitcoin and cookies - the energy used on cookies has utility, while the energy used on bitcoin is completely wasted just to prove your stake

[@mrscsi6472]

If you make a sequel to this video, the title is required by law to be "Harder Drive 2: Drive Harder"

[@OfficialReggarf]

next would be "To Hard To Drive" next "Die Hard Drive Trilogy"

[@rokaq5163]

Maybe even "Harder, Better, Faster, Stronger Driver"

[@rocket2739]

2 Drive 2 Furious

[@dhillaz]

Hardin' 2: Electric Boogaloo

[@ElDJReturn]

"Harder And Harderer 2" and Harder Drive 2: Drive Another Drive" Are also good candidates.

[@DarkDay2012]

I talked to this guy once who actually worked on building the hardware sorters for the particle collider at Fermi Lab in the 70's. He also apparently worked on a system to transmit financial data for stock exchanges using a series of radiowaves that would bounce off the atmosphere and then either bounce off the ocean itself or floating platforms that would be set up, and all this, just to get it there a few miliseconds faster

[@tapist3482]

I imagine if we implemented this method the node servers would need extremely large register matrices just to store all the ping request info, which essentially means storing the data in RAM.

[@RobertMilesAI]

The ratio of quality to views on this channel is completely absurd

[@LeoStaley]

And he basically only uploads once per year.

[@LeoStaley]

And several of my favorite nerdy youtubers always manage to watch him before I can, despite me having notifications turned on.

[@gigigigiotto1673]

i miss the times where people made video with passion

[@roseproctor3177]

Oh hey it's my favorite AI safety boi

[@laur-unstagenameactuallyca1587]

eyyy i know u

[@NavnikBHSilver]

Answers we didn't need for questions we didn't ask, tackling problems we don't suffer from, to make content that won't disappoint.

[@Prima10ne]

and the points dont matter

[@ultimategotea]

@@Prima10ne until the very end, the whole point is to dunk on blockchain

[@autohmae]

well, their are definitely people suffering from crypto currencies.

[@Prima10ne]

@@autohmae and grammar skills

[@billybbob18]

Very well said... and lol

[@MattRoszak]

This video is a work of art. Mad respect for all of the work and research that went into this, and I loved the punchline at the end.

[@RealRedRabbit]

I have tried to watch this video 3 times now but your voice is too calming and I fall asleep.

[@marloelefant7500]

This is "storing data on the cloud" on a whole new level!

[@chickennuggetman2593]

storing data on literal clouds

[@Brixster]

@@chickennuggetman2593 don't give Tom any ideas

[@andynn6691]

Actually an idea explored in science fiction. Made me think of Dan Simmons' Hyperion where the AI sort of lives in the farcaster network preying on humans passing through for compute power and sustaining their own existence. A kind of computational storage.

[@remotepinecone]

this isn't permanent storage false advertising. this is RAM

[@diablo.the.cheater]

@@remotepinecone It is not RAM, it is not random, it is sequential, it is more like volatile tape that degrades pretty fast than ram

[@Nicbudd]

The pingu system is like "storing data" by yelling at siri and waiting for her to go "I'm sorry, I do not know what you meant by _________"

[@tissuepaper9962]

It's the "hold my byte" protocol.

[@renakunisaki]

I've used Google to store data this way. Say someone is driving unsafely and being stupid. I don't have time to stop and write down their plate number or take a photo. What I can do is grab my phone, push the button and just speak the number. It will perform a search for that number, allowing me to later retrieve it from my search history.

[@Noah-wx7fm]

This video is pure art

[@CharlesVanNoland]

This is hilarious. Props and kudos for not only having the idea but also implementing it.

[@Palozon]

The seemingly meandering but completely logical narrative progression from juggling chainsaws to the final reveal is insanely impressive. Your writing is nuts, this video is nuts, bravo.

[@DanJanucik]

The seemingly unriveting review of this video hides within it a stark lesson: commentary does need to be needlessly detailed. It is sufficient to be concise, no matter how much the tortured neurodivergence mind yearns to endlessly expound upon each individual premise.

[@TheActual4982]

@@DanJanucik Ah, my esteemed interlocutor, perchance might we pause to reflect upon the diverse symphony of voices that forms the vibrant tapestry of our shared digital discourse? Each individual, with their unique perspective and expressive modus operandi, contributes to the rich and multilayered narrative that unfolds in the comments beneath the creative beacon of the video in question. Your observation, although succinctly articulated, seems to bear the weight of a somewhat judgmental undertone. It is indeed true that brevity can be the soul of wit, as our bard of Stratford-upon-Avon once opined. Yet, should we not also make room for the ebullient expansiveness of those who choose to delve into the depths of analytical discourse, to dissect and ponder the myriad nuances that others might overlook? In the grand theatre of human interaction, there is a part to play for both the concise critic and the verbose analyst. To dismiss the latter as the product of a "tortured neurodivergent mind" is to stifle the richness of our collective conversation. The beauty of discourse lies in its diversity, and in that spirit, I entreat you to adopt a more charitable stance towards those whose expression takes a different form than your own. So, my friend, while your viewpoint is appreciated, let us remember to approach each other with respect and understanding, cultivating an environment where all voices, whether succinct or expansive, can resonate in harmonious symphony. In this manner, we might avoid falling into the unsavory role of the discourteous critic, and instead uphold the principles of empathy and tolerance in our shared journey through the realm of digital discourse.

[@KeinNiemand]

Now you need to combine all these harder drives into one RAID array.

[@svampebob007]

Raid 0 for sanic speeds, or raid 6 for proper harder drive security.

[@paulpinecone2464]

Sorry. A Raid array is a storage modality of calling in strategic SWAT (Synthesized Wide Area Transport) teams on addresses that encode information. The memory is made persistent by causing each Raid to uncover intel linking the operation to another address which refreshes the SWAT propogation. The loop is closed by identification of a drug cartel which requires an addition Raid on the original address, known colloquially as a Token Ring.

[@svampebob007]

@@paulpinecone2464 oh yeah he should take some drugs while building the raid 6! That's harder harddrive level 10! Level 99 is calling the DEA on himself and trying to make it work before they raid his raid attempt.

[@stillmoms]

Redundant Array of Inconvenient Disks

[@KaiserTom]

5:30 This is the difference between a carrier-grade router and a home router. Packets/sec. Most home routers can't do many, but it's usually not an issue since real home user packets tend to get maxed out when they really need the bandwidth. Also memory to store a lot of connections. Especially if each packet is going to a different destination and can't just reference an existing routing entry.

[@TheBinarygenius]

You are a maniac and i love it, keep up the insanely great work

[@Mentalbox52]

Hey. I know the bits format was for visualization, but there's actually a serious optimization you can do with the tetris blocks. I notice the blocks come in 3 different colors. If you count the empty one as a color, that means we have 4 possible values or 2 bits per cell. Which means you can store one byte in 4 squares instead of a single line. This equates to 2 bytes per line.

[@benjaminoechsli1941]

Underrated comment.

[@AlNexus]

@jelly boy801 Tap on a clip to paste it in the text box.

[@eyesore8555]

with this improvement it might even surpass the blockchain!

[@evilduck5691]

that would increase the effort needed to write each line, though. that only improves write times if you can write each lines in less than double the time

[@omnipresentcatgod245]

​@@AlNexus Use the edit icon to pin, add or delete clips.

[@CodeParade]

The part you mentioned in the beginning to use feedback as memory is actually a real thing. It's called "Delay-line Memory" and it used to be used in a lot of old technologies.

[@Alex-qq1gm]

You missed out the best part. You can make them with large amounts of liquid mercury in a pipe!

[@jonny__b]

My guess is this is probably what inspired the idea!

[@sweetchocolate431]

I remember visiting a particle accelerator and they used a several kilometer copper wire to "store" data from collisions

[@wherestheshroomsyo]

hey codeparade, didn't know you watched tom7

[@kargaroc386]

So the obvious use for this would be to write a UNIVAC emulator that stores its RAM data on a system like this.

[@tychothefriendlymonolith]

This is like delay line memory from the 40s. Impressive stuff. Also the line at 15:15 had coffee coming out of my nose.

[@kuruselva]

I had no idea where this was going but 10/11 for the presentation and script

[@BrightBlueJim]

Both the Internet ping and the chainsaw juggling are just delay line memories, which was one of the most popular forms of storage in early computing. Actual implementations included pressure waves through mercury tubes or quartz crystal polygons, torsion waves through magnetostrictive wires, electrical pulses through coaxial cables, transmission lines or chains of inductors and capacitors, and later, semiconductor shift registers. There is really no limit to what you can do with delays, since these involve storage in some kind of medium (which can be very close to free, in cost per bit, chainsaws notwithstanding), where the longer the path through the medium, the higher the capacity but also the longer the latency, but you can mitigate the latency (as was done in practical applications) by adding parallel channels. As you mention, slower media is more useful, since it holds more data per unit time, which was why most of the historical implementations used acoustic waves. Harder drives I've seen either proposed or actually tried, include moon-bounce lasers, spots of light on glow-in-the-dark tape, ultrasonic chirps through air, and magnetic tape loops.

[@soylentgreenb]

Another early form of memory was Williams tubes, which used charge buildup on a CRT screen for storage. As completely retarded as that sounds, they were at least actually random access, which makes them one step up from these delay-line memories.

[@4.0.4]

TIL

[@macslash5833]

Can I guess you have a degree in computer science?

[@BrightBlueJim]

@@macslash5833 You can guess. But it's electrical engineering. Just long and deep experience with computing.

[@macslash5833]

@@BrightBlueJim ah ic, cool

[@uzimonkey]

Using ICMP reminds me of the Sega Channel. Sega wanted to launch a service where people could download games via modem, and they'd offer a number of officially licensed games per month for a fee. But the problem was that dialup was slow and unreliable and they'd have to make big servers that hold all the games and it would be too big and clunky. Their solution was to send low cost servers to cable companies around the country and every month they'd ship a hard drive containing that month's games. This server literally just broadcast the games over and over in a loop. The "modem" was not a modem at all, it only demodulated. You'd start up the modem (plugged into the cartridge slot, the Genesis just thought it was a game) and it would wait for the menu program to come around on the loop. It loads the menu program, you pick a game, and then it waits for the game you picked to come around. You get on demand content without ever having to communicate back to the service.

[@GStarGoku3]

WOW that is weird thank you for sharing.

[@tom7]

Interesting!

[@stupossibleify]

Sounds directly analogous to Teletext from the 1970s

[@fishypugbruh]

@@stupossibleify Was thinking the same thing

[@NiHaoMike64]

Would be interesting to get that running with a fl2k adapter emulating the broadcast server.

[@FrankConforti]

This is effing cool! Next, should be a method that gives us the best ROI on resources versus level of difficulty. In the end, the perfect “harder drive” is one that balances the cost of the write and the read by some exponential value. Meaning, it costs a lot to put the data in, but is cheap to pull it out with as close to 100% accuracy as possible. This is a fantastic thought experiment that’s got me now subscribed. Cheers!

[@Alex-ck4in]

To me nothing is more awe-inspiring than a person who can take two traditionally separate concepts, and realise they fit together. This is probably the most creative study I've ever seen being done with computers. As a network engineer, I bow before you!!

[@kylerbelshaw7042]

I actually created my own Harder Drive in Minecraft using Shulker boxes and a clock controlled chain of hoppers. Items are pulled from the box in sequence, all non-stackable to ensure the correct order. Each hopper feeds an item into a brewing stand, then deactivates, ensuring one bit per stand. If the item in question is a potion, it will enter the brewing stand, triggering a comparator and registering a one. If it is a sword, it enters an overflow hopper instead, leaving the comparator off. Reading amounts to waiting for each item to travel through the system and power a series of indicator lamps. Writing requires all bit detector mechanisms to be emptied before a new pattern of items is piped in, which I can't yet do automatically. My sporadic interest in this project, plus my habit of not backing up my Minecraft worlds, means I've probably never built it the same way twice. Maximum capacity amounts to an incredible three bytes, with two or three slots left over. This could be doubled if I used a large chest instead of a Shulker box, but I wanted to emulate a "removable drive."

[@creativecraft_mc]

send a screenshot

[@PondsideKraken]

I did it with pumpkins.

[@wingdinggaster6737]

Now go update it with the new one block T Flip Flop :)

[@randomuser6110]

I love how the analysis of his map of the internet was limited to just talking about the patterns it made, not looking up what was actually at those obvious sections.

[@mcrsit]

My mind is blown away. I can't put into words the utter awe that I have regarding this man's intelligence and skills.

[@EliKennedy]

This is the first of your videos I’ve seen. This is awesome!

[@quirtthedirt]

Theoretically, one could fling the chainsaws into a solar orbit which eventually brings them back to earth after an arbitrary number of years, allowing for actual infinity wield

[@ruben307]

not actual infinity. You hear to often in maths that some number is higher than the numbers of atoms in the observable universe. So there is a clear upper bound.

[@renakunisaki]

@@ruben307 eventually you're gonna run out of chainsaws

[@YodaWhat]

@@renakunisaki - Who needs atoms? They can be virtual chainsaws, made from virtual particles. Virtual Photons (a.k.a. "photons") would work in some slightly different cases, such as the lightspeed orbits around a black hole. BTW, did you notice how the Blackbody Radiation curve emerged from the data at 18:50?

[@cheshire1]

you're still limited by the speed of the chainsaws and the amount that can be packed into the volume where you can grab and re-launch them.

[@Bruno-el1jl]

Use orbits which would benefit from arbitrarily high speeds, such that relativistic lenght contraction kicks in, and your chainsaw density can arbitrarily increase. That is... until it collapses into a blackchainsaw hole

[@LampDX]

still laughing at “instead of using radio waves, let’s just use internet waves.” good stuff.

[@hissingfaunaa]

0:25 is this that new anime that everyone is talking about

[@p4stagg448]

Man Saw

[@ozornayashoujo]

Knee-activated-saw-man

[@trainskitsetc]

I've seen a lot of fun stuff on youtube. This is possibly the most fun so far.

[@rose52152]

New harder drive: The sigbovik drive. Every year submit a paper to sigbovk. Append a block of data at the end of your submission. The if you make the drive large enough you might be able to increases the throughput, but the latency is always going to be an issue.

[@Vegas242]

🤔 This is potentially one of the Hardest Drives

[@trainzack]

You should certainly take a look at the paper for this project ;)

[@rose52152]

@@trainzack The absolute fricken madman. Has anybody been able to decode the codes? I can't figure out what he is storing here. XD

[@klausstock8020]

People have been using the Bitcoin blockchain to store data. Millions of backups in a very short time.

[@rose52152]

I can't decode them. So if a smart person tried then I would love to hear what is in there.

[@andydouble07]

The cycle of confusion as elements are introduced followed by horror as I realize their purpose was extraordinary.

[@sammikinsderp]

This was wicked cool. Can't wait to check out your other content.

[@OGsploorp]

its been a while since i enjoyed a KZbin video this much, thanks!

[@Vegalyp]

The best most understated joke is you saying "And like all living things, they are made up of pixels, or blocks." Gets me everytime.

[@bretunderhill4178]

You were demonstrating a fluent understanding of electronics and logic for the entire video, then there was a 30 second segment where you sounded like you could be a biochem major. earned my sub.

[@timbokalimbo482]

This is amazing. So creative and so nerdy XD. Pls keep doing this.

[@timelikeinfinity5142]

compress the pings in max-size groupings, program the pings to self-decompress on the way and recompress on the way back, find a way to read compressed pings and you're in business! also program these ping-packages to bounce one or more times to greatly increase total storage

[@LinusNil]

3:19 Sending data over and over again around the earth remembers me of these incredibly cool old delay line memories used in early day computers. This was before we had semi conductor based RAM. Instead data was kept in memory by tapping it onto a coiled wire and reading it out of the other end, modifying it and looping it back to the wire. There were also delay line memories using tubes of mercury.

[@massimocole9689]

I was thinking the same thing! I first heard of delay lines from watching a numberphile video on an early electronic calculator which used a piano wire for its memory. kzbin.info/www/bejne/aHOsqWWuYrZlnKc I thought it was so strange and clever.

[@renakunisaki]

I've also heard of using sound waves traveling through wood for this.

[@fixfaxerify]

...and gin!

[@leahcornelius]

@@fixfaxerify Gin?

[@fixfaxerify]

@@leahcornelius That was Alan Turings idea of the optimal fluid for an ultrasonic delay line :)

[@allboyshatebras]

This represents some of my favorite KZbin. A low-volume channel that I subscribed to who knows how long ago for who knows what reason spits out this absolutely high quality video with bananas amount of effort expended containing actual knowledge that is abused for a laugh. Love it.

[@fernandossmm]

15:15 I really love this description of Tetris, it cracks me up every time

[@ToekneeToe]

Hah. Tom's manual efforts has comedic value even though he didn't have to do it. Kudos! And I can't believe those COVID test packs actually exist. They are subliminally like the original NES in a way. 🙏 Thanks!

[@jovanpoursamadi7477]

I went from enjoying an analogy about chainsaw juggling to one of the most unique, creative, and beautiful projects I've seen in a long time. Even just the heatmap of the internet itself is art! Put it on a poster, haha. Way to go, dude.

[@zainio]

The QR code at 7:55 says "IPv6 sux" if anyone was wondering.

[@user-gr1vv4pk2i]

IPv6 isn't much good for pinging the entire internet, but it doesn't suck, right? :(

[@trainzack]

I wonder what the QR codes at the end of the paper are

[@meiskam]

@@trainzack it's the enwikipedia article on QR_code, plus a secret message

[@haphazard1342]

One wonders if he actually got control of a large enough chunk of IPv4 addresses to put a real QR code in their ping responsiveness on the real internet... "That would be embarrassing", he said.

[@fllthdcrb]

@@haphazard1342 Given that it isn't there initially and just fades in (and not even completely opaque, either), that's clearly not true. He just added it in editing.

[@nootnoot42]

In my eyes this is art, thank you for making this.

[@grahamornstein]

I run the amateur radio HF station at my school and we can and have (quite easily) hit the back of our own antenna while transmitting Morse (aka it went all the way around the world) like at 3:14 and now i really want to try storing data like that

[@Garbaz]

The Tetris Harder Drive(R) with all the boards arranged on one screen makes me think that it would be a funny idea to try to use that arrangement as a screen, with each board representing a pixel, using dithering for grayscale coloring, and then again play Tetris on that board. Kinda like implementing GOL in GOL.

[@tom7]

I like it! As you can see from the part at 22:40, there's a bit too much distracting other junk (the parity/support columns and the rest of the interface) but I think it'd be a good demonstration if that stuff were cropped out.

[@danmerillat]

If you carry the 1 you should be able to use odd-numbers of 'bits' per line, no? It should change from a single write strategy to 3: the existing strategy for an even number of bits, the strategy for an odd followed by an even, and an odd followed by an odd. That would give you 2^10-2 potential patterns or roughly 4-options per byte, which could be used to optimize write speed by planning ahead.

[@brunofzb]

@@tom7 This video was really good! Maybe do another video on useless technology?? These things are really interesting, it's like making science from scrap. Like, weird/useless technology ideas, that no one really cares enough, cause yes. They're completely unnecessary.

[@AtomicShrimp]

Maybe the eproms from the covid test modules could be harvested and soldered onto smaller boards that link together like a stack of jacquard punch cards. The drive would spool through them and drop down some contacts onto the right board to read the data on that section

[@DialecticRed]

Fancy seeing you here! And Jan Misali . . . what is this, a crossover episode?

[@martinhorner642]

While we are at it, what does it take to change the i2c id on those things? Iirc that's like 128 devices per bus and that has to cut down on the switching/complexity.

[@AtomicShrimp]

@@martinhorner642 Sounds like the ID is baked in to the chip (or maybe the package) - I suppose there's probably still a way they could be multiplexed with shift registers or some such

[@nothingtoseeherelolkek]

But it makes it easier, not harder

[@iskende]

@@DialecticRed This is definitely some kind of crossover episode.

[@-vias]

The spec sheet is so appropriate. I love it.

[@Ailun__]

This video is stupidly good. What an insane amount of effort good god.

[@Klblaz]

This is one of the few channels for which I actively anticipate each upload. Keep up the good work!

[@idontwantahandlethough]

Idk how I got here, but I'm definitely subscribing.. this dude really knows how to reel me in (that chainsaw hook really got me invested lol), that was downright fascinating!

[@Laborejo]

Escape velocity is 11km per second :). 11,000 km/s is a substantial fraction of lightspeed. Throws the chainsaw on a course to proxima centauri :)

[@abacussssss]

if the universe turns out to be positively curved this could still work

[@Brightgalrs]

Did you take into account the circular polarization of the chainsaw's light? That might explain the discrepancy in escape velocity.

[@richardbloemenkamp8532]

True this video is very earth-centric, there are lot's of great orbits around multiple massive bodies.

[@silvercomic]

@@richardbloemenkamp8532 I like to juggle my chainsaws in a circumlunar free-return trajectory, myself.

[@RealNovgorod]

That was the joke. Like the bitcoin section.

[@TommyMaverick]

Okay, I have no experience in this field BUT this was very interesting to me and I loved the Tetris section

[@RandomKSandom]

This journey was absolutely marvellous

[@Beanybag2]

Every April you never fail to make me so incredibly happy. I've been watching your SIGBOVIK videos since you started making them with your original doctorate thesis learnfun. I am truly thankful for your contributions to computer science and humanity as a whole. :')

[@tom7]

Thanks very much and thanks for watching! (:

[@andriypredmyrskyy7791]

Things Tom did in this video without breaking a sweat: ping the internet, hack Tetris forwards and backwards, reverse engineer a COVID test (and talk about it like it was a child's toy), design a pcb, get those COVID tests to talk to a raspberry pi (almost)... And then, after having shown his mastery of nearly every technical field, pulls a coordinated and simple teardown of our modern scourge.

[@brendn]

And draw!

[@TheVonWeasel]

"Because we can't trust banks?" He queries in all seriousness while millions of innocent people have just had their financial lives shut down by said banks.

[@pieterzegers7788]

@@TheVonWeasel the problem with banks you’re talking about was never about the storage of money, but with the nature of loaning and credit, which cryptocurrency doesn’t solve in the slightest

[@bugjams]

Wonder what he did with all those covid test boxes after he was done. They seem like a horrible piece of garbage - can't really recycle them due to the chemicals inside (as well as the human snot and possible disease), yet they take up a lot of space. They'll probably just end up in a landfill, inevitably starting the Covid pandemic all over again once we're cured of it and someone happens to walk by a landfill. Great, now I'm depressed.

[@TheVonWeasel]

@@pieterzegers7788 they literally shut down all russian citizens. Have you seen the people in Canada that had their bank accounts completely shut down if they donated to the truckers? And if you want to argue loans and credit, you cannot create crypto out of thin air like banks do where they loan out 100x more money than they actually have because they control the software that lets them add zeros where they didn't exist before.

[@doce3609]

Thank you for asking and answering the question no one wanted to ask but everyone needed to hear

[@Yixdy]

Beautiful.

[@maadneet]

15:48 Fun fact, NES Tetris has a specific glitch where clearing the top row can leave a full line without clearing it. The same glitch also clears the bottom line regardless of it's state, allowing for a way to change the board's parity. Unfortunately there still is no way to build above an empty row as far as I can tell.

[@tom7]

Fascinating!

[@monad_tcp]

I find it amusing that people discovered all the possible states of a simple old 8-bit game.

[@enbyennui]

this was the most carefully orchestrated dunk on crypto I've ever seen. excellent job

[@quinn_m]

This is video is incredible man, I think I'm falling for you

[@litterbox0192]

can't wait for better faster and stronger drives

[@actualhyena]

I really love the commentary on solutions to problems we don't have.

[@tissuepaper9962]

Is "banks are untrustworthy" really a problem we don't have, though? I'm there with Tom about Bitcoin being a waste but I can't help but laugh that his rebuttal to "I don't trust banks or any other financial institutions" is to say "lol why not, just trust them". There's a reason the goldbugs are still around. That's a hard money that has really stood the test of time. Bitcoin is a fad, but I wouldn't say it's a solution looking for a problem at all.

[@whatr0]

@@tissuepaper9962 I mean at the end of the day, crypto is functionally just a ill fitted proxy. Because you have to convert your ponzicoin into local currency to functionally make any actual use of it. It's not really a case of "lol just trust the banks" but more "it's just the way it is". As long as we're in this current system it's nearly impossible to *not* rely on banks in some capacity (unless you want to move to the middle of the woods and become a nomad).

[@tissuepaper9962]

@@whatr0 the point is to *store the value* of your money somewhere that isn't directly controlled by governments and financial institutions, and then only convert as much as you have to, and only when the price of your store of value is high in the currency you need. Yes, ultimately you have to expose yourself to the financial institutions, but you only have to expose as much money as is strictly necessary to perform a certain transaction at any given time.

[@8_Bit]

This was amazing. I feel bad that so much excellent creative and technical work gets somewhat hidden/buried behind the KZbin thumbnail / title paradigm. Splitting it up into a "Harder Drives" series with titles like "I Built A Storage Device Out of Pings" etc. would probably give your work the visibility it deserves. Of course, I'm sure you know all this. I'm exhausted thinking of the work you put into this video at so many levels. I literally LOL'd several times too. Well done!

[@PondsideKraken]

Yeah I also lol'd and upset my family. Awkward timing.

[@aeonikus1]

Amen to that!

[@PeterMcIntyre0]

i would have been happy to watch a segment about axe throwing, but it just keeps getting wilder!

[@erikziak1249]

Had to stop at 2:15. LOL. Your humor is astonishing. I really literally laughed out loud. Of course, I am too drunk and too lazy to do the maths myself, but I trust you on this one. I wonder where the rest of the video is leading to. EDIT 4:17 I see where you are going. Laughing even harder. At the same time drinking another glass of wine. EDIT 29:13 Whoa, you really did THAT?

[@brettanderson7285]

Michal Zalewski wrote about this in his paper "Juggling with packets: floating data storage" His paper was a .txt file; certainly not the a fancy academic paper made using LaTeX with benchmarks and all that, but I think he beat you to the punch by 20 years. I didn't see him cited in your paper, so I'll give you the benefit of the doubt that you were previously unaware of his work. He actually expands upon the idea quite a bit more with ideas like opening a connection to something like an SMTP server, sending a bunch of data as part of the HELO handshake, waiting until just before the connection times out and then sending the newline, at which point the SMTP server would happily tell you that it doesn't accept mail for the host [HUGE-BASE64-BLOB-OF-DATA].