How Different Would 2015 Hearthstone Be Today?

Рет қаралды 78,374

Күн бұрын

Subscribe and Like the video :)
Checkout ‪@Roffle‬
You should watch me live on Twitch:
/ rarran
▶Discord: / discord
▶Twitter: / rarranhs
▶TikTok: / ytnarrar
Edited By: / avedaveed
#Hearthstone #Rarran #hs

Пікірлер: 81

@sillykyle17 3 ай бұрын

The self-ping play was in Ostkaka's semifinal match against Thijs, in a freeze mage mirror. Ostkaka had 10 hp left and was going to take 1 fatigue damage on his next turn, which would bypass his ice block and kill him if he was at 1 hp. Thijs had already used both of his ice lances, so his only damage tools left were fireball, frost bolt, and ping. If Ostkaka stayed at 10 health, Thijs could set him to 1 with fireball + frost bolt and win the game. So he pinged himself knowing that Thijs had no way of dealing exactly 8 damage. It was a genius move that bought him an extra turn, but he ultimately still lost that game.

@sunbleachedangel 3 ай бұрын

It's like that Disguised Toast clip, "When best face is own face"

@ShaggySummers 3 ай бұрын

The clip: kzbin.info/www/bejne/aXnEqXZ-pbqEhKc

@Chasmic 3 ай бұрын

Everyone's too busy explaining the self ping to notice that whenever Roffle's footage is shown, you can still see a single row of pixels from Rarran's footage at the bottom of the screen.

@montanamuse3617 3 ай бұрын

Man I was in a guild with hotform in classic wow. I have never talked to a more unlikable human.

@RAINBOWEXPLOSIO 3 ай бұрын

Day 243 of waiting for Rarran to play Plants VS Zombies Heroes.

@robertlupa8273 3 ай бұрын

It's kind of a dead (or undead lol) game so I'm not surprised he didn't pick it up, but it'd definitely be fun to see him play it.

@buckerly3987 3 ай бұрын

Dumb fun fact but did you know that the hearthstone player Ostkaka was swedish? And in swedish the word 'ostkaka' translates to cheese cake!

@Heatranoveryou 3 ай бұрын

based, unless swedish cheesecake is a lie.

@chimadang1573 3 ай бұрын

@@HeatranoveryouSwedish cheesecake is served warm with Berry sauce drizzled over it

@NovaCorpLive 3 ай бұрын

Been loving your content here lately since I found you. Keep up the work even tho we all know you actually hate hearthstone right now lol.

@AdvanceWarrior 3 ай бұрын

I guess I'll be the Historian. Ostkaka and Thijs were in a Freeze Mage mirror. Ostkaka had 10 health and was going to take 1 damage next turn due to fatigue. Almost everyone knows Thijs has a Fireball and Frostbolt. Thijs can do 9 damage and let the fatigue kill him after he ends his turn. Ostkaka pings himself down to 9hp, meaning Fireball leaves him down to 3hp, and Frostbolt will pop the block but keep him at 3hp, meaning he survives with 2hp afte fatigue. Ostkaka has Antique Healbot and Alexstrasza in hand.

@reinhath7665 3 ай бұрын

People in the comments legit expect you to know a random word in Swedish lmao. Keep up the great vids fellow chaotic enjoyer

@caternative 3 ай бұрын

You know, you should start such experiments with the decks the players used in the 1st match, not have your choice. And then also follow the sequence of deck picks unless there is a different result to what was in the championship. In that case you should be free in you choices for the rest of the experiment.

@catcatcatcatcatcatcatcatcatca 3 ай бұрын

Neutral windfury with bladeflurry going face again would be so OP that assasins blade would be playable. Just having three or more durability weapon would threaten so much face damage. It would mess with tutoring kingsbane so it wouldn’t be played, but you could build a deck that simply didn’t run kingsbane, instead running assasins blade as the budget option.

@arneb482 3 ай бұрын

We got 5 Mana Dr.Boom nowadays (the 5/5 deathrattle spawn 2 bombs guy)

@darkumineru1681 3 ай бұрын

all minions are stopped by sap xD

@CrunchRosey 3 ай бұрын

Typical Ice block, most unbalanced card ever printed.

@maelkashishi 3 ай бұрын

Rarran doesn't have any coin to flip irl 💀

@IAmE37 3 ай бұрын

Day 68 of asking Rarran to play Library of Ruina

@storotso 3 ай бұрын

Why are there more comments complaining about Rarran getting his pronounciation corrected than there are comments correcting it? None of them were even particularly rude, especially since Rarran literally asked "is that how you pronounce it?". He probably doesn't actually care, but you can't drop the question and not expect it to be answered.

@nickjoseph77 3 ай бұрын

The sass and back and forth between Roffle and Rarran still makes some of my favorite content.

@Kerwskinn 3 ай бұрын

Ostkaka has to be a swede, right? cuz that means Cheesecake in swedish

@juricapozder2206 3 ай бұрын

i wish i could go back in time, not to cause of money,its cause of good old hs

@DeadreavahTheSecond 3 ай бұрын

This. i watched the first game and went "wow their decisions actually mattered"

@bajlajs2137 3 ай бұрын

7:55 What a shame, what a missplay, play mad scientis, kill it with fireball, get iceblock and win in the next round.

@solin21210 3 ай бұрын

ostkaka pinged himself because he was at 7 health and was in fatigue. he dies to fireball plus fatigue so at 6, he cant die there

@DvirPick 3 ай бұрын

Wasn't he at 11 and knew the opponent had Pyroblast?

@impkiller5932 3 ай бұрын

@@DvirPick wasn't he at 30 and knew the enemy had 29 damage Denatrius?

@weirdkd54 3 ай бұрын

He was at 40 health and already took 20 commander damage

@davesumman4741 3 ай бұрын

I'm sorry, but these plays were just not it. Rarran doesn't know how to mulligan, he plays explosive sheep which does nothing instead of frost nova to save him 9 life... 5:44

@NevirSurrender 3 ай бұрын

Ah yes let's expect the English content creator to know exactly how to pronounce a name from a language he doesn't speak. Get over yourselves man, Jesus. Anyways, great vid as usual rarran, hope these comments won't get to you too much

@loknaz97 3 ай бұрын

Ostkaka is Swedish for Cheesecake, also not a single syllable was pronounced correctly.

@CreeCore94 3 ай бұрын

Also you’re gay *plays enter sandman riff*

@derpderpin1568 3 ай бұрын

@@CreeCore94 hurr durr

@robertlupa8273 3 ай бұрын

@@CreeCore94 xDDDDD

@tomekk.1889 3 ай бұрын

How tf was he supposed to know how an obscure swedish word is pronounced get real guys

@Rainbow_Sheep 3 ай бұрын

Shutup dude how would he know

@kristianfagerstrom7011 3 ай бұрын

I really enjoy this series.

@Cheesypizza2011 3 ай бұрын

I haven’t played hearthstone since 2017 and this was my favorite meta, so this is a banger of a vid for me

@shardgunner4815 3 ай бұрын

Y'all should've flipped a coin for each match, so there was at least a chance of Roffle getting a good deck

@tommyhansen7600 3 ай бұрын

Ostkaka is literally cheese cake

@weirdkd54 3 ай бұрын

@peer263 3 ай бұрын

8:08 terrible order AND actually punished for it, deservedly so. How hard is it to use unstable portal before mindlessly spending six mana, for something you can easily do after casting the spell if necessary.

@algumnomeaihehe 3 ай бұрын

um 🤓

@TheSoulDivided 3 ай бұрын

I miss the days when Mana Wyrm was good. One of my favorite cards of all time

@byeguyssry 3 ай бұрын

Never lucky

@adamnorell8349 3 ай бұрын

Ostkaka in swedish means cheesecake which i find so funny

@krystianstawiarz5407 3 ай бұрын

Oskaka vs Thijs best match in hs esports

@Afasia42 3 ай бұрын

Comment for A god.

@neonoir__ 3 ай бұрын

I love when rarran punishes me

@velho6298 3 ай бұрын

Lmao ostkaka

@alexandrebertone4351 3 ай бұрын

Nice

@Assassin21BEKA 3 ай бұрын

Hearthstone was so much more interesting and fun when card generation was limited.

@rixflixx 3 ай бұрын

why did he ping his face?

@Cuestrupaster 3 ай бұрын

Crazy how many they discussed what the outs could've been, why they did what, so many consideration on what to do, instead nowdays we just have "I play this card, that generate this card, that generate me this other card, and then I get this random card and I win yay!"

@darkumineru1681 3 ай бұрын

u used to be able to use ice block to block fatigue not sure about hero power? has u used to be saved from fatigue (did not last long but it was a thing that was able to happen)

@mythcraft3445 3 ай бұрын

No it did not.

@neonoir__ 3 ай бұрын

@@mythcraft3445 it used to super long ago, they made secrets not trigger on your turn in open beta. From the wiki for keyword secret: Patch 1.0.0.4944 (Open beta, 2014-03-11): Secrets can now only activate on your opponent’s turn.

@glich6035 3 ай бұрын

@@mythcraft3445pretty sure it did. Iceblock received a change a while back.

@neonoir__ 3 ай бұрын

@@mythcraft3445 secrets received a patch in beta in 2014 to only trigger on the opponents turn, the only exception is competitive spirit, which got printed after the change

@andreassloth4076 3 ай бұрын

Just got a hearthstone commercial on a hearthstone video this is a first after 4 year's of watching hearthstone in general. So yayh !

@skydark5573 3 ай бұрын

@darkumineru1681 3 ай бұрын

cool mode can be skip every turn until 10 mana then play the game out but its like yugioh or whatever where every turn is 2 turns u player your turn then end turn the enemy has to end turn to give it to u again play your turn then the enemy gets to do the same with playing 2 turns can be really cool to see combos and how it will have functioned (maybe even make it so u can play secrets before ending the turn back to the enemy making them "free")

@alessioartiaco3832 3 ай бұрын

Im gay

@nataliep6385 3 ай бұрын

I hope we will get Vanilla Hearthstone again, just like we eventually got WoW Vanilla + TBC again.

@ajkcool 3 ай бұрын

We did. It was called Classic and it got replaced with Twist because no one played it

@nataliep6385 3 ай бұрын

@@ajkcool Exactly. I do remember when we had that for a short amount of time... But we do get classic once in a while through Twist.. But that's like 1 time a year, for a few weeks... :(

@hearthstonerevealed3990 3 ай бұрын

Have you ever wondered if blizzard scams you by making false claims? Yes, because the definition of scam is this, declaring one thing and doing another, very serious when there is money involved. For example, the cards that say "random" are lying, there are algorithms that decide which cards to choose, for example not ALL the cards with assault but only those that the blizzad itself decides periodically, and among these there are algorithms that favor one of the two players, in this way Blizzard balances the game artificially and favors those who give it money based on who doesn't pay, for example it has created a specific arena for those who never pay using gold, where it only throws in these players together with certain categories such as KZbinrs who buy accounts full of gold to chain draft and make "incredible arena" videos, this thing is even declared and admitted by blizzard itself which thus admits to manipulating everything as it wants and cashing in your dollars in exchange, to millions of dollars, yes you understand, you pay, you get scammed, you get stressed and the only one who laughs in your face... is your beloved blizzard...