How Does COVID-19 Testing Actually Work?

[@thethoughtemporium]

Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/ SpikeF - AGGAATTTTTATGAACCACAAATCA MembraneR - CGGTGATCCAATTTATTCTGTAAAC NucleoF - AAATGAAAGATCTCAGTCCAAGATG NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT

[@sadface7457]

when is the next micro fluidic video ♡

[@wolf359loki]

Can you link to the Antibody test you used?

[@rougenaxela]

It's nifty taking those little primer sequences, doing the reverse complement, and putting it into a BLAST search, and seeing only SARS-CoV-2 come back in the results.

[@Ahnahtan0]

Very useful and informative! Valuable insight on this be-tweaked-st microbe toward its management.

[@vitezhrabri4054]

Hi so my question is the is a math solution how to do any kind of testing more efficiently, so is it possible to mix 4 or more samples together so it triggers if only one of them is positive?

[@Bigfoot_With_Internet_Access]

Luckily I've managed to avoid getting it so far by hiding out here in the deep forests

[@thethoughtemporium]

Username checks out

[@tonk8735]

Second time I've seen u

[@dismissing]

@@tonk8735 are you saying you've spotted big foot twice?

[@tyrstone3539]

Dude I see you everywhere

[@tonk8735]

@@dismissing yes

[@Ididathing]

i should have watched this video before i tried

[@XavierXonora]

Nobody will know, it's fine

[@boldey]

wooo i like your vids woo

[@t.lacey17]

Oof

[@bazzasoutdoorsandhunting1122]

Yes! 😂😂😂

[@blury6445]

Eh u shoud survive if u didnt die yet \○/

[@alexandrelanhoso5538]

I love how he casually use peas as coolant for his biological raw materials.

[@MudakTheMultiplier]

They're reusable!

[@supernoodles908]

@@MudakTheMultiplier and biodegradable

[@spokehedz]

@@supernoodles908 also great for when you bang your head on the fume hood...

[@superdupergrover9857]

There's also a pea shortage. No joke, the demand for peas from the fake burger industry has caused a shortage.

[@superdupergrover9857]

@@RoboticusMusic They can contaminate those vegan burgers all they want. Campbell's stopped production of their split pea soup (my favorite) because of the pea shortage.

[@Spit823]

Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.

[@StormBurnX]

it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded. Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!

[@DrakkarCalethiel]

PCR= Pipette, Cry, Repeat. Never change! 😂😂

[@Queekusme]

This needs to be a new T-shirt design

[@DrakkarCalethiel]

@@Queekusme Hahaha, thus needs to happen! Shirt design on back: PCR Pipette (pipette logo) Cry 😭 Repeat (uno reverse card) I would get one like this. :D

[@thethoughtemporium]

Already working on it. Will have it out soon

[@justalapwing]

I'd buy it

[@MultiPss]

@@thethoughtemporium I need it

[@JustOneAsbesto]

*L* (oop mediated isothermal) *AMP* (lification), I assume.

[@GasparLewis]

Either that or another language, like "SI" for SI units.

[@SquaredSmith]

Nah it's that thing on your bedside table what shines light. It can detect the virus through... uhhh... science magic

[@jrblast]

@@GasparLewis Or UTC where the English and French couldn't agree so they decided on an order that's wrong in both languages.

[@EnriqueGonzalez-pw7xe]

Or maybe it just was developed by moths, who knows?

[@grn1]

Just paused the video to comment this.

[@princesscheeseburger5198]

Back when the death toll was only 700k 😢

[@zuthalsoraniz6764]

Meow Ludo Disco Gamma Meow Meow has to be the most cyberpunk name I've heard, at least for a real-life person

[@MemesnShet]

I’ve read the “Gamma” as Grandma at first lmao

[@pineapplesareyummy6352]

I had to type that name into Google. That's his real name. He even ran for political office in Australia under the 'Science Party' and is a geneticist and entrepreneur. He is a serious guy with an unusual name.

[@caca95cb]

Dude he's totally related to Catra Applesauce Meow Meow from She-Ra

[@Suninrags]

@@pineapplesareyummy6352 did he change his name? I would assume he did

[@waterunderthebridge7950]

Neon Red kill Yup, apparently he made a funny name list with his friends and picked one he liked to change his name to

[@haydennorris2913]

I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!

[@debug8377]

watching this in 2024 feels weird. a look back 4 years ago while not feeling it was 4 years ago

[@ernestkirstein6233]

Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.

[@KnakuanaRka]

Yeah, the sorts of people who would need to learn that aren’t going to watch a video like this.

[@drkastenbrot]

@@KnakuanaRka They definitely watch videos like this, skipping through it to find bits that support their narrative and pull them out of context. Too bad this video doesnt say anything easily pulled out of context.

[@KnakuanaRka]

@@drkastenbrot Wish more videos could be like this one in that way.

[@desmond-hawkins]

Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)

[@Tok_Janne]

You can use aquarium gravel instead of frozen peas! Can even use it to flash freeze stuff if you have access to a -80°C freezer. Keep up the good work! Your videos are interesting to watch even for us who work in labs all day long.

[@CodingCorvus]

aqua-rium gra-vel, okay noted, anything else? (to flash freeze throw some liquid nitrogen over it)

[@ayatotakema1194]

im guessing it has a higher energy desity right?

[@DrmedWurst-se8df]

As a healthcare professional I enjoyed your brief but scientific comprehension very much, to say it clear I love Your video! Thank you very much. (Of course I recommended it to many nerdy friends!) But I've been a bit suspicious with the Immunglobulines: As far as I know IgA (which is not present in your diagrams) is the only dimer (in humans), and IgD, which you present as a dimer is a monomer like IgE and IgG, too. Correct me if I am wrong!

[@thethoughtemporium]

You're correct, that was my mistake. Good catch! That was meant to be IgA. Must've gotten it confused in my notes at some point

[@Spree1775]

@@thethoughtemporium I appreciate your integrity

[@kurtnelle]

I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.

[@averagecornenjoyer6348]

watch more of his videos, this guy is awesome

[@jpjude68]

15:03 Ah yes, the most used refrigerant agent in biolabs : frozen peas! :D

[@MoritzvonSchweinitz]

at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore. Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?

[@selkywaters]

I know a guy that kept testing positive over and over. Finally somebody told him to rinse his sinuses out with saline. He did it three times a day for 8 days and finally tested negative.

[@gabrielcohen1538]

I thought such garbage was automatically kind of broken down but maybe it only applies to waste products from the cell and not from outside

[@CodingCorvus]

RNA is officially a proteïne so it can take a long time for it to break down under the temp it was meant to be in. (sorry i dont have a concrete number)

[@Spree1775]

@@CodingCorvus RNA RUBBISH..as a Physicist it's obsolete rubbish.

[@Luko3673]

It makes me happy to know that there’s 80,000 other people out there who are actually interested in how things in the world work

[@studioreep7449]

And then there are THOSE dumbasses

[@sababugs1125]

@@studioreep7449 dumbases ? Dude calling them dumb is an insult to actually dumb people . You're giving those people way too much credit

[@ryanc473]

And who knew, almost two years later and, well, we're still dealing with this crap. At least we've got some legit treatments now (you know, with actual scientific evidence in support of them) and a few vaccines. Though, despite getting the initial course and the first booster shot, I just recently got Covid myself (for anyone wondering, 0/10, would not recommend). I'm fine now, but it still sucked for about a week. And before you ask, I'm only in my 20s. Though, I at least don't seem to have any long term effects from it...one of my coworkers that got it really early on, relatively speaking at least (I believe it was in about November 2020) and she still can't smell or taste stuff. Which, I couldn't even imagine going through life like that. Edit: Oh yeah, and even still, +1 on the wear a mask part from a healthcare professional here (I work in a hospital lab). They really can make a difference. Although, I'll also say that while the cleaning EVERYTHING before bringing it into your house was solid advice at the time this video went out, turns out, SARS-CoV-2 doesn't spread that great on surfaces, so that isn't as necessary as originally thought. Still not bad advice in general, just not a major factor in terms of Covid-19 spread. Edit 2: oh yeah, and another thing, that is only relevant now that it's been a while since the video came out...The false negatives are far less common nowadays. They absolutely were a huge issue early on (i.e. back when the video was posted), but nowadays the tests are quite reliable, even for the newer variants. Edit 3: Just one more thing I wanted to add regarding PCRs...if you've never been around a hospital lab style PCR, the thing I think that'll stick out the most is they are loud. Like, really, really loud. At least, the ones we use are absurdly loud. It's reminiscent of what a jet engine sounds like from inside the plane. So not loud enough to require earplugs, but loud enough that it's very clear something is happening. Of course, the PCRs at the hospital are more than just the block that heats and cools to specific temperatures. I mean, yeah, it has that part, but it also does all the measurements and detection internally. No gel electrophoresis or additional manipulation of the sample. It's literally just mix the UTM from the swab with the reagents, load, and await results. So it's possible the PCR like described in the video isn't quite as noisy, but I'm far from an expert on the stuff lol. Oh, nice, he talks about the difference in the diagnostic PCRs vs the one he initially described. Should've just kept watching Edit 4: and now I suddenly know why some samples we've tested consistently come out with an "inconclusive" result. None of us were quite sure the reason behind it, and after watching the video, well, I still don't know the underlying mechanism but at least I know the problem. One of the two primers came up positive, the other negative (and the human gene control part worked). Thus, the machine would've given an inconclusive result, despite multiple tests on the same sample. We always just give up and ask the nurse to recollect after it comes up inconclusive twice, and 999/1000 that solves the problem. So I still couldn't say why the initial sample was problematic, but at least I know the reason the machine insisted on giving a result of inconclusive.

[@drugsr4thugs728]

He really put his blood, sweat, and tears into this video. He pricked his finger, did some pipetting, crying and repeating, and worked on this video for months. Awesome video.

[@charles8072]

as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?

[@nucspartan321]

great video, enough over my head to make me realize how complicated it all really is

[@flopilop3808]

I love the frozen peas used as cooling agent :DDD

[@bdnugget]

Wow, I've used TLC a lot at the medicinal chemistry lab to monitor chemical reactions. Those anti-body tests are like ultra overdrive TLC, it's awesome

[@coronal2207]

"We live in a cyberpunk dystopia" Video liked.

[@moncza1866]

I can't find it but I want to

[@aBradApple]

That moment when you realize how much more science you need to learn... and the moment persists throughout the video. Sadly, my rudimentary understanding of bioscience may have dampened the intended response to this information - but I am now taking this issue more seriously. Thank you for this extended content, good sir.

[@aBradApple]

I have downloaded this video for future reference and dissemination.

[@karak962]

❤️ it’s great you took time to learn! i don’t know much either even though i love this stuff.

[@sambrandner]

Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially 🤯

[@wesleymays1931]

This is called "tricking the enemy"

[@masonbarber871]

@@wesleymays1931 So I guess we are testing for covid by tricking, backstabbing, and quite possibly bamboozling a virus. I love science.

[@gizmop0ny]

"Build a neat and better mask" *becomes daftpunk*

[@kentclark9908]

I love your videos and learn so much from them, but i have a confession to make when I'm having a hard time sleeping ill play one of your videos and it knocks me right out.

[@alexbombbird353]

How is there almost a 7:1 like to dislike ratio on this video? You would think the people subscribed to this channel would be the sort to know better than to subscribe to baseless conspiracies. Not to mention you clearly spent a lot of time thoroughly researching this and cited sources that they could check and see are reputable.

[@Basement-Science]

Probably because a lot of CovIdiots get it recommended who are not subscribers.

[@C2H5OHist]

I disliked because I don't like politics in my scientific entertainment

[@microwave221]

People are eternally disappointing, and the number of comments alleging that the whole thing is a hoax should explain where it's all coming from. A vocal minority, but thankfully a minority none the less

[@nthSonata]

In this day, where the right are blatant anti-intellectuals who dismiss any science that they don't "agree" with, science is inherently political

[@Yildun28]

@@C2H5OHist Same here. The political digs undermine the credibility of the video. If I can spot fallacious reasoning/data on things I am well informed about, it makes me question whether I can trust him on things I am not and came to the video to learn more.

[@michaelpapadopoulos6054]

- "If you think this is bad ooohh weee are you in for a surprise as climate change ramps up". I know this vid is about the coronavirus but i think more people need to realise this. Climate change cannot be compared with little things such as a pandemic, a complete collapse of the economy and growing inequality. Everyone agrees that 2020 is going to be remembered as one of the most sucky years of modern history. What we need to understand as a species is that climate change is going to make it so that every year is like 2020 all the time but then it is going to keep getting worse. We are not killing the planet. We are just destroying the intricate balance on which our way of life is based.

[@combin8or]

Stellar video, Justin. Good humor, too. I’m going to have to watch it a couple more times and check out those papers.

[@Ryan6.022]

Okay if Meow's parents named him that just imagine the bullying he went through.

[@thethoughtemporium]

He named himself that later in life.

[@Ryan6.022]

@@thethoughtemporium then he is super awesome

[@nefariousyawn]

@@Ryan6.022 I'm imagining a hyper intelligent grad student that went on a psychedelic vision quest of a lifetime. From this he gained a sense of humor, a sense of purpose, and superhuman powers of chill. I've had friends attempt to rename themselves after a heavy trip, and none of them were this cool.

[@nahometesfay1112]

@@thethoughtemporium Is his first name Meow and his last name Meow Meow? Does his name follow the first, middle, last form?

[@davidmaisel8062]

@@thethoughtemporium He just got more awesome!

[@mystwalker479]

This dude's content is like the answer to my questions

[@SenorRu]

I hate how the most common anti-mask argument is "It gives people a false sense of security and they stop social distancing". Because simply educating people is too hard.

[@arantes6]

39:12 I was almost as impressed by the fact that the auto-subtitles transcribed "Cheeto von Gropensnatcher" correctly as by the quality of the video ^^

[@thenimbo2]

Please be careful about recommending ubiquitous testing. At very low prevalence levels, (sub the "prevalence threshold" for the test), the precision (PPV) drops rapidly. In places like NYC, where the prevalence is 1% or less, a large majority of positives end up being false. Until tests get to ultra-high >99.9% specificity, the prevalence threshold, given their sensitivity, is >3%.

[@ukaszMarianszki]

Getting a false positive is way less of an issue than missing a case, because the worst that can happen to you in that case is getting isolated, which you should be doing anyway

[@GigsTaggart]

@@ukaszMarianszki pretending that isolation has no cost is ridiculous

[@MrAntraxico]

Seeing that ending now... Oh boy, I sure love how we all got together and tried to solve every important problem we had! In any case, thanks for your videos man. I am not in the biomedical field but I love watching your videos and hopefully learning something useful.

[@afshinafshin6408]

why not geting in it ?

[@firstlast446]

"I hope this will be enough of a wakeup call" haha, god I wish.

[@StormBurnX]

the people watching these kinds of videos mostly are the people who already know it's bad. if there was a way to force this video's knowledge on everyone and force them to have a high enough IQ to comprehend it, then that would be a wakeup call. But no, the only brainwashing technology we have is 5G and coronavir- wait...

[@LimabeanStudios]

Yeah at this point everyone has already formed their opinions on this whole situation, and that usually only changes when someone who downplays covid loses a family member.

[@Herr_Brechmann]

@@StormBurnX The whole world is dying, ffs you guys

[@eideticex]

From what I have seen, I doubt the wakeup call will work either. I have seen plenty of people say "it'll all be over after the election" or similarly stupid nonsensical bullshit. All while having a friend or family member disappear to their home for a few weeks with COVID-19. They literally do not see or hear it happening right in front of them.

[@TheComputadude]

@@eideticex And you also have people like Herman Cain who die from it and tweet from the grave about how it wasn't that bad.

[@jay-rad8303]

I am so glad you made this video! You are educating so many people about such a serious problem and it is honestly people like you that are keeping this world alive. Keep up the amazing work man :)

[@XxfishpastexX]

Mr Meow Meow seems like a pretty chill dude

[@wesleymays1931]

Implanted an Opal Card chip into his hand.

[@tyrian_rets]

Huge thanks for not over-simplifying this too much. Also, why are so many people down-voting this?

[@8b8b8b]

Instead of disliking the video, read the citation in the description and check the sources, and then compare that to the citation of sources that says otherwise, if said citation exists at all

[@XavierXonora]

You can't expect people to do work to debunk their own fallacies. It's a psychological disease

[@Danspy501st]

"It is like strapping a Corvette engine on your lawn mower" I might not be dumb, but I might be dumb enough to try that for shits and giggles XD

[@TerrierWhisperer]

People are so caught up with deaths that they don't consider what happens to the survivors after - no matter if the illness was severe or mild. I had a 'mild' case, and I still have abdominal discomfort, occasional shortness of breath, and fatigue. Symptoms started on july 14

[@thethoughtemporium]

I mention this near the end

[@socialamoeba6455]

@@savage101. Good for you, sadly that is not the case for many.

[@RBuckminsterFuller]

"Long-haulers" aren't unique to covid. A lot of people who are diagnosed with CFS/FM (chronic fatigue syndrome, fibromyalgia) likely started out with infections.

[@NullByte_-mm4dn]

Finally a comprehensive video on this subject. Love your content in general, but this particular video needs to reach a wider audience. I hope that the algorithm picks this up.

[@hikaru-hokkyokusei]

Lol, i am proud of myself that i made it till the end of the video. If our biology classes were like this, they'd be more interesting to attend.

[@averagecornenjoyer6348]

hentai ousama

[@xenonram]

If teachers could spend DAYS/weeks making a video about a single example of a single topic, that would be true, but then an undergrad degree would take about 2 decades to complete.

[@symik3]

This is unique content on youtube, i have not found anything similiar to it. I love your channel, altough i dont understand anything. Guess i will stick with my area of expertise. Great work tho.

[@remanjecarter2787]

Ah the science side of this I love your videos, they're informative and go into a satisfying depth of the topics

[@matthewsidaway1437]

so interesting I've watched it twice - good job

[@Psychaotix2001]

What a hell of an in-depth video about COVID-19 and how the tests work. And thank you for pointing out the simple things like wearing a mask and getting tested if you even SUSPECT you've been exposed. I'd be a patreon if I could, but can't afford to yet.

[@Psychaotix2001]

Bob Bobbertson think of it in the terms of a drunk dude naked. If you’re both not wearing pants and he takes a leak on you, you’re both wet. If you’re wearing pants and he isn’t, you get wet but much slower. If you’re both wearing pants, then he’s the only one getting wet. Using a mask is to protect others from you, not necessarily you from others. The exception being N95 or higher masks or those certified for viral loads.

[@lisawesome7588]

@@Psychaotix2001 that is the most moronic comparison.

[@timseguine2]

I work on software for an automated processing platform (qPCR and microarray), and it is nice to understand a bit better about how the primers and fluorescence markers work. The only real understanding I had to have was: it grows a lot and glows in this specific way if you do "biology stuff" to it. But it is nice to know what the colleagues are actually up to.

[@karak962]

that’s awesome!!!!!!

[@PowerhouseCell]

This is a really detailed and amazing video! This information is important for the public to know, and I'm glad you're putting it out there. I hope my videos become as well-explained as yours one day haha :D

[@CodingCorvus]

with hard work and dedication you will one day.

[@Poly_0000]

You're doing great work moderating these comments! The video is amazing and I'm sure I'll sending it to many people to explain the situation.

[@edgeeffect]

@Bob Bobbertson are you "liking" your own comments? I notice each one has exactly one "like"... no more, no less.

[@RabbeSandelin]

I have been looking for something like this for a long time, thanks. The only thing I disliked was the ”Don't be alarmed. But be alarmed, this is the new normal”-bit. In Finland we have a lot of new cases now, but zero people in intensive care for a month, and a just handful getting hospital treatment, even as very few bother with the masks. Is this because hand washing, distancing and protection of risk groups have been effective, or has something happened to the virus itself during summer? It is mutating, after all. I think the jury is still out on near future developments.

[@gobzanuff5078]

Ok gonna save this video... For night time sleep... (was watching during day... cause strong sleepiness)

[@DeathProductions200]

"each tan you open gives you a heart" oh no. I can get like 600 hearts a day just from forgetting how to spell

[@ericaburke2366]

Where I live, we’ve only had 27 cases (all recovered with no deaths nor community spread) and it’s been almost two months without a case. Hearing about what’s happening in the rest of the world seems fake, though I know that it is, unfortunately, true. All we did was follow our public health guidelines. ITS NOT THAT HARD!

[@hammerth1421]

My county has 15 imported cases (that were detected) through people returning from their holidays. School starts again next week. This is gonna be great.

[@Sporkekw]

You deserve 200 times more views... This sole video has given us more information than anything any youtuber has posted ... Thank you ❤️

[@rohitrathod1268]

This video deserves so many views 🧡

[@covodex516]

21:25 the googly eyes make your results more accurate.

[@CodingCorvus]

didn't notice that before, thx.

[@BrazilMentionedHueHue]

thank you, no other science channel is explaining covid detection carefully and detailed like you do.

[@joeblow4035]

at 32:08 : polyclonal antibodies are distinct antibodies and not one that binds to many epitopes.

[@hika8298]

this was a nice summary of what I needed to know and what is currently known

[@jules3311]

It's nice to have a real video on this channel ! Your streams are cool, but they may belong to a separate channel.

[@papastalin69]

i currently have covid and this video was very enlightening. thank you :)

[@bmw61j60]

I think it's interesting that at the beginning of your video you basically say that no political talk should be made in the comments, then you go on to make a lot of political statements for 5 minutes at the end of your video. That being said, it's a great video, but I lost the ability to use this in my classroom when you went on a political rant at the end. I love your videos, and I hope you'll make one about T-Cell immunity because it gets old explaining it to people who don't understand even the most basic parts of biology. Keep up the good work!

[@WarningStrangerDanger]

It is simply outdated at this point. The downside to such long videos is that you can't select for the information that withstood the test of time and set aside the parts that aged poorly.

[@gabelluc9573]

This video is absolutely great ! But I have so many questions. 1. Frozen peas ?? 2. Cabbage juice as pH indicator ??? 3. LAMP in HIS appartment ???? Drinking game idea : take a shot every time these guys do something that would make a lab supervisor frown.

[@serkanergun0]

Isnt it Loop mediated isothermal AMPlication?

[@Christian-os3kk]

AMPlification*

[@michaelkincaid9582]

Do labs ever do batch testing? Like, combining samples from 10 patients in one test, and retesting positives?

[@Lambda_Ovine]

38:35 This is something that people need to understand. People and the media get way to fixated on the mortality rate, but this is not the flue and the virus can do long lasting, live-changing damage in your body.

[@MayBugg1049]

And here we are 1 year later at 343 million confirmed cases and 5.58 million deaths... 😭

[@kalechapo]

LAMP I would assume is them using the “L” from loop and the “AMP” from amplification but it is a far stretch lol

[@mariamoon2]

I love how I dropped out of school and the first GED test I take I passed with pretty much just 7th grade biology. And here I am still interested in these topics. Then again maths and science were my middle school strong suits.

[@renegadethesandwing02050]

“Meow Ludo Disco-Gamma Meow Meow” That is the best name in the world!

[@Ispike73]

It's really not. He implores people to take this seriously but then references someone whose name is meow meow that works out of an apartment...

[@darkhoodchief]

Very informative. I wasn't aware of the LAMP testing but it's very interesting. This video explains why testing is slow in some countries.

[@iskrenvichev]

Thanks for this great video - really informative to people with sufficient knowledge. As I studied Biotechnology, we did PCR in the University lab, and we all experienced similar problems as the ones shown here, although I never in clinical setting. Based on experience and stability of RNA, it makes me wonder: 1. Can we quantify the odds of a true positive? I guess it's 3 divided by the total number of things, which may go wrong in the process. 2. For the second type of RNA test, I will do some reading - I wonder how lowering pH impacts the sample in the process and why the false negatives are less likely than more positive. 3. For the antibody test, I wonder if all SARS-Cov-2 proteins are being tested for, and whether an immune response via CD8 cytotoxic T-cells which detect infection via the MHC receptors, can be detected? 4. Also, if antibodies were produced in response for another Coronavirus, which also bind to SARS-cov-2 proteins, how we avoid the false positive? 5. It's not the first time I hear that coronavirus mutation -a simple RNA virus - it mutates more slowly than say HIV virus, and I'm struggling to understand the reason. My understanding is virulence and spread of disease increases the mutation chances and HIV is transmitted by means of sex or blood transfusion. Anyone have a good source of reading or simple explanation why mutation would be slower here? Thanks and again - great video - might be a bit sceptical on test accuracy and impact of the new normal on the demographic crisis - but definatelf quite interesting and a deeper dive details may interest folks like me!

[@jaboris2536]

Virology is a lie that’s why

[@cjbrenner13]

All of that logic and he couldnt reply. It would undermine his and their entire theoretical superiority complex over a 97% +/- survivable virus. Thank you for sharing this beautiful knowledge.

[@JCake]

You have no idea what a god you are in my eyes! I had the utmost respect for you when you cured your lactose intolerance (I know, it wore off again, but still) and now this. Please know, I appreciate you.

[@kareng4294]

I was expecting to see something on the PCR thresholds, but they weren't mentioned. What are your thoughts on the recommended threshold of up to 40 cycles? Also, would appreciate any insight on why breakthrough cases only get up to 28 cycles. Thanks!

[@crazystuffproduction]

I wish this was 2 hours long in a way, but very great info here. and good final points, Really agree with your summery

[@edol33t]

Great video, one of your best and one of the more detailed analysis on covid19 I've ever seen. Only thing is, imho, the tone in the summary section got a bit preachy and I feel like it diminishes the seriousness of the rest of the video, irregardless of the fact that one may or may not agree. Great job nonetheless.

[@xardnaslp3171]

21:26 love that you gave the robot googly eyes

[@joshjosh6714]

You inspire me to pursue an MS degree and possibly PhD in Biotech. ❤️❤️

[@C2H5OHist]

Nice, watching this while waiting for my test results. Will share the result and the test type when I find out, likely on saturday.

[@dallinlaw6785]

Please change your thumbnails, it's really hard to tell the difference between streams and normal content.

[@julianwalde4810]

Great video! I have a friend who's working on lamp tests and while she tried diligently I feel I just now understood the major differences to the pcr tests. Thank you!

[@anthea9697]

Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones? Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.

[@thethoughtemporium]

The easiest way to get started is probably on your own, but there's nothing stopping you from taking an intro to bio or biochem class. Though fair warning, they'll bombard you with an enormous amount of information. But if you just want to learn on your own, crash course has a bunch of great series on the topic. I also suggest the book "the manga guide to molecular biology". It's cute, well written, and covers a ton of stuff. Beyond that, look at places like amino.bio, biobits or carolina biological and get yourself one of their fantastic kits. You'll get some hands experience and get to see how some of this stuff works for yourself

[@alima9353]

What a coincidence I’m studying molecular biology at university but maybe want to stem out into physics. Maybe biophysics? There are similarities between biology and physics which may be surprising like molecular motors. Anyway good luck with your journey !

[@drkastenbrot]

I am doing EE at a uni and biochemistry and whatever else interests me on my own terms. Doing any biology at uni is very, very harsh.

[@arjunlagisetty]

Should have stuck to that bio chemistry classes in college. I surprisingly enjoyed this video

[@rosspeterson2658]

Why should I wear a mask in public if I touch my face more when I wear one? Also, if a test takes a stick up my nose or in the back of my throat why do I need a mask? If breathing in someone will spread the virus couldn’t I just breath on or spit on a stick instead? Also, if the day to day masks won’t stop things like the virus then why wear one? I’m a firefighter so I took an exam on all sorts of masks. These masks don’t stop viruses. Wouldn’t it be better to always wash your hands, cough and sneeze in your sleeve and use hand sanitizer a lot?

[@rosspeterson2658]

@@coolcucumbers7601 maybe you don’t understand the word stop in this context. Here’s an analogy that might help. If you try to fit a fridge into a hula hoop it won’t fit. The same goes for viruses. You may think it shortens the distance but idk if you know how small a virus really is. It might stop water droplets but it won’t stop the virus.

[@rosspeterson2658]

@@coolcucumbers7601 viruses don’t have to be attached to water droplets or anything to survive. If they wanted to survive for an extended period of time they’d have to but in the case of a mask, a mask may decrease the distance of the water droplets but it won’t stop the virus from going through

[@efrainolivencia3856]

I'm in my third year of my microbiology mayor and I find your videos so well made and explained. Keep it up!

[@oaxis8198]

“250 more death by the time you watched this video” Me thinking video is 15 min long: oh shit, that’s like 2 death a min or somt Me seeing that it’s 48 min long: oh ok but still

[@RadiantPhenom]

the best video I've ever seen on youtube -

[@SebastianHasch]

sadly, I can only like the video once. This was a great one!

[@GothBb666]

ngl watching this video at 1 AM really feels like the online school kicking in

[@Igor-dy6wx]

Very interesting. After 3 years of pandemic, perceptions changed. Looking at your own video now, what would you change or maintain?

[@olivercharles2930]

Nothing I hope.

[@VariantAEC]

​@@olivercharles2930 You are just as dangerous as the people pushing radioactive health wear, you just don't know it yet. The above video was made almost a year after the pandemic began so I can forgive his ridiculous opinions, but I'm guessing any reasonable scientist would reflect on his own personal opinions about the future of society post-pandemic and say, 'Gee, I got that wrong.' without being too offended.

[@olivercharles2930]

@@VariantAEC You speak confidently for someone ignoring all the reasonable scientists saying the opposite of your claims. But hey, only the ones regurgitating the opinions you have matter, right? Peak confirmation bias right there.

[@VariantAEC]

@@olivercharles2930 After 2021, all the reasonable scientists changed their minds about masking up. Weird, right? Also, I didn't say this video was bad, nor did I even imply that the non-opinion based content was bad or wrong in other threads. Elsewhere under this very same video, I commended the work of this video's creator. The issues with his personal views are the reason I didn't like the video, but his explanations of the processes of testing for a virus are the reason I didn't dislike it. Why do so many people like you get so upset that the reasonable people are in the middle. If you and people like you made more sense overall than you and your 'opposition,' I'd agree with you and your side more. Somehow, you can't ever just step back and see that the problem can be you and your side.

[@olivercharles2930]

@@VariantAEC Except for the fact they didn't. All reasonable scientists agree that a mask was a small, but necessary step to minimize the spread of the disease. Oh, and the reason I "get so upset" is that seeing someone casually deny science while pretending to be "reasonable" is aggravating. Maybe you should rethink your beliefs if all you seem to get is criticism? Nah, it must be the scientists who are wrong!

[@Maxim_The_Tea_Taker]

Ironically I am currently in bed sick because i finally got my second dose.

[@BillEngwall]

[@claudiog.7397]

Great vid and great link collection in the description. Thank you.