Who would’ve guessed that a shady company would do shady things?
@handleneeds3charactersormore Жыл бұрын
Not shady, xcommy
@greendude0420 Жыл бұрын
IKR, here’s to hoping I make enough to make a killer anti Bill🖕 Linux build lol
@greendude0420 Жыл бұрын
Kinda sad I got so used to and attached to OS’s like windows xp, 7 and 10. My dad told me there’s even the left hand corner news widget on windows 10 still, and since I’ve gone to 11 I didn’t notice so I guess it seems like they’re going to prolly down grade windows 10 till people migrate to 11
@s3tifpv941 Жыл бұрын
@@greendude0420 I feel you, got used to it way too much over the last few decades and I hate that :(
@sotecluxan4221 Жыл бұрын
Sooo unexpected......
@Ratzfourtyfour Жыл бұрын
Imagine my shock. Any US based cloud is just a data source for the three letter agencies.
@MasayaShida Жыл бұрын
True but there are much worse than US based...
@tilsgee Жыл бұрын
@@MasayaShida your next word is: China based cloud
@oz_jones Жыл бұрын
@@tilsgee *West Taiwan
@ioritenshi Жыл бұрын
@@MasayaShida No, the US is the worst of them all by a long stretch.
@chickenmonger123 Жыл бұрын
@@ioritenshiHehe naive. But ok.
@Kwijibob Жыл бұрын
Pretty sure breaking encryption to gain unauthorized access to anything on a computer is a violation of the Computer Fraud and Abuse Act
@w花b Жыл бұрын
@@acmhfmggru even if they somehow got into trouble and somehow had to pay a fine, it would be a drop of water in the ocean.
@LazerDisk Жыл бұрын
Guess there’s some hidden agreement in the terms of every service they provide
@swagmuffin9000 Жыл бұрын
@@w花b they won't get into trouble so long as people agree to the license
@MitchMatrixx Жыл бұрын
It’s not illegal. Your (paid) Microsoft account, consists of an office suite, email, and cloud storage. You license Windows. Your machine is now a dumb terminal on MS servers. Your local storage is basically a consolation to make you feel like you own the machine that you paid all those dollhairs for. You don’t. You are renting it. I’m not defending MS, or Apple, or Google, etc. This is just the way it works in reality, and most people don’t ever figure out the hierarchical structure of this abusive relationship. Stop renting a terminal on someone else’s network. Run Linux, and build your own cloud server, either on or off premises. This channel has so many videos on this subject already.
@Theis13P Жыл бұрын
at this point every big multi-trillion dollar company can do whatever it wants even bend/or avoid following rules laws etc.
@senatuspopulusqueromanum Жыл бұрын
There is no cloud. There is only someone else’s computer.
@-_-Girthbrooks-_- Жыл бұрын
Yes this right here
@itsawill9268 Жыл бұрын
Self hosting/VPS?
@insanitycubed8832 Жыл бұрын
It's a server farm and you're the cattle
@ainzooalgown9952 Жыл бұрын
data is stored in the balls
@ishmaboy Жыл бұрын
Yep. Even supposedly "completely decentralized" networks such as Tor and P2P torrents have their vulnerabilities and I'm sure new ones will be discovered. And once that level of anonymity is broken - all your shit may as well be cleartext to the host provider. Whether that be some Joe Shmoe seeding a movie, or a professional VPS service, nobody is truly safe. And everyone technically *can* be tracked eventually. It's all just a matter of time when these security blankets unravel. Also, when commercial quantum computing finally becomes widespread, kiss your AES 256 goodbye.
@ArniesTech Жыл бұрын
It's astonishing how much effort MS puts into promoting Linux 💪😎
@ra2enjoyer708 Жыл бұрын
Nah, a typical windows will bail out of Linux the moment he has to deal with dependency management through CLI.
@bionic-beaver Жыл бұрын
@@ra2enjoyer708I don't think so, after the improvements to Flatpak and Flathub there's a good chance that Flatpaks will be the default package format for beginner distros
@basedSkeleton Жыл бұрын
@@bionic-beaver Flatpaks are AIDS but maybe Windows users might want to use them.
@o0Donuts0o Жыл бұрын
I know right. Since the 90’s Linux has be trying its damndest. Even when MS throws you a bone you stall can’t get it off the ground.
@ilaripori6148 Жыл бұрын
@@ra2enjoyer708 I am a linux user for quite a while and I dont even know what "dependency management through CLI" means lol... Pick a distro that works as a desktop pc. My choice is Nobara.
@anon_y_mousse Жыл бұрын
The fact that an OS vendor has implemented a "feature" that deletes your files when they detect something they don't like is proof that we *NEED* Linux, all of the BSD's and any other open source operating system and *everyone* should move to such a system now.
@kaydog890 Жыл бұрын
I'd rather an OS I can game on, personally. To each their own, though.
@nathanoneiric Жыл бұрын
@@kaydog890 I recently tried Linux with steam proton and I was surprised how I could run most games. It definitely is getting closer to windows replacement
@nathanoneiric Жыл бұрын
@@Proferk I love open source and use as much of it as I can but there are limits, most people don't even give a shit, as long as the thing does what they want it to do.
@abcdefgasdfg Жыл бұрын
Unsupported everything.
@anon_y_mousse Жыл бұрын
@@kaydog890 Yeah, forget freedom. You don't need to worry about an OS deleting your games because your license has expired and it knows it. You don't need to worry about anticheat slowing "your" system down because you'll just pay the company more money or you'll buy a bigger and better computer just to get around the lag caused by the anticheat. Nope, because you stood your ground, you can game. No need to push them to port games to Linux, just pay more money.
@O___P Жыл бұрын
I left Windows back when they first started giving you mandatory restarts with only a safe timeframe each day. Set something to compile overnight, came back to a restarted computer, installed Linux. Haven't regretted it since. Sure, there's gonna be ways to avoid stuff like this, but why would you want to actively fight your OS?
@danepane527 Жыл бұрын
This 100%
@mycommentmyopinion Жыл бұрын
Same. Got tired of that shit. Only thing that needs to become better would be gaming. Hate to dual boot
@joaosouza2678 Жыл бұрын
I'm programmer and use linux as my daily driver, but I gotta adimit that windows just works better in a lot of things. Games mostly, drivers and installing anything is 2 clicks, literally. On linux IF you use the terminal everything can be done just as fast, but for a normie linux is not quite there yet.
@SteelWolf_ Жыл бұрын
🤓
@FakeMichau Жыл бұрын
@@joaosouza2678 That's like blaming a tool for not knowing how to use it. If you go with a more sophisticated tool then you should be aware there's more you need to know to use it to its full potential. For some a rented hammer will do just fine.
@Adenybaloi Жыл бұрын
"Let Microsoft's AI raise your kids" both funny and disturbing.
@Theis13P Жыл бұрын
i agree since it's that future we are currently racing towards Cause "Think of the Children we should protect them" seriously makes me puke since when did we ask for AI to be our "Parents" Per-Se
@Gre3k Жыл бұрын
One thing more is that the 'Parents' have lost the ability to know what is good for their kids and what is bad, they have lost the common sense and thus let the overlords raise them bcoz they think the 'more knowledgeable' will do a good job than them.
@sihamhamda47 Жыл бұрын
Imagine being raised by an "invisible" robocop
@hi-gf5yl Жыл бұрын
ParentGPT
@false_positive Жыл бұрын
you're not getting it. they don't give a F about your or someone elses children, they just needed an excuse to survey your data.
@cocogus Жыл бұрын
I just assume big tech can do everything, including stuff I didn't think was possible. That way, I'm not surprised when it's revealed that they have even more data than we previously thought.
@pingozingo Жыл бұрын
Can’t be disappointed when you always expect the worst.
@sotecluxan4221 Жыл бұрын
E. g. ur with 24 characters password encrypted HDD will be a problem for most regimes. If most pple would encrypt their emails they would be in dire straits.
@LightrifyClips Жыл бұрын
This is the exact same reason why I don't trust most, if not all VPN providers. You may be hiding your information from whoever, but the VPN provider still has access to your information in the end and probably selling it further themselves, hence the reason why the names you keep hearing about being advertised everywhere on KZbin have such insane advertising budgets. There's no way they would be able to afford so much aggressive marketing just by selling you a good deal on a subscription offer. There shouldn't be such thing as trusting a big company with storing and protecting your data. Your information will always be used or sold. We have seen multiple cases in the past, most recently from Apple where a line stating that they do not collect your data does not mean absolutely anything.
@impoppy9145 Жыл бұрын
@@Sharded807 Mullvad were raided recently from one of the seven eyes countries and they are now boasting about being "zero logs". Very reasonable rn to assume they got rootkitted after the search and are becoming a honey pot.
@leonidas14775 Жыл бұрын
Depends if you're hiding from governments that don't like you, or copyright trolls
@amxaas4450 Жыл бұрын
@@impoppy9145 Got a source?
@namesurname4666 Жыл бұрын
the only good reason to use vpn is to bypass country restrictions, not for privacy
@alperen_n71 Жыл бұрын
@@impoppy9145 according to pcmag, it was just a basic search warrant but the cops supposedly left empty-handed. But, as I always say, you never know. Did they actually leave empty-handed? Did they actually not leave empty-handed and mullvad is just being threatened by the TLA (three letter agencies) that if they say something different that something bad will happen to them? Or did already something bad happen? We never know. And that's why you should create your own VPN.
@ishmaboy Жыл бұрын
I fucking love how we're still referring to the feds as "glow in the darks". God. RIP Terry you magnificent bastard you
@bc-cu4on Жыл бұрын
TempleOS doesn't scan your encrypted files either. Truly the superior platform.
@greyowlaudio Жыл бұрын
I miss him, bros.
@MH_VOID Жыл бұрын
I've only heard "glowies" (short for "glown"[forcibly redacted by youtube]"rs"), never "glow in the darks" Rest in peace, Terry
@meep.472 Жыл бұрын
funny thing because microsofts current CEO is a curry smelling taxi driver
@Probable.Orange Жыл бұрын
@@MH_VOID Even mainstream Yters refer to feds as glowies
@vincei4252 Жыл бұрын
How is this not considered mass industrial espionage ?
@voidimperial1179 Жыл бұрын
Bribe- I mean, "lobbying"
@BloodwyrmWildheart Жыл бұрын
Who writes the laws? Who enforces the laws?
@MrTonyBarzini Жыл бұрын
Oh it is. But what are you doing to do about it, serf?
@anonymous82783 Жыл бұрын
Because we all agreed to the EULA, despite not reading it.
@billy818 Жыл бұрын
because you almost definitely singed over the right for them to do this in the licence agreement.
@0-9-1 Жыл бұрын
I never trusted anything related to "The Cloud" I'll keep my "outdated" hdds and cds.
@blabla-rg7ky Жыл бұрын
never used cloud in my entire life, I don't even know what that is... although I can ballpark it. I even have a PC that still has floppy disk on it, although I'm obviously not using it anymore since it's so outdated. But the point is that I don't like the latest technologies, I always adopt them at least 4-5 years after they've been discovered, sometimes even 10+ years later xD
@Oweblow Жыл бұрын
Why use cloud storage when SSDs are cheap now?
@MisterPancake778 Жыл бұрын
Based
@notafbihoneypot8487 Жыл бұрын
Just encrypt your files and then send them. No issues If you need to use the cloud.
@TVPInterpolation Жыл бұрын
@@notafbihoneypot8487haven’t you watched the video? When Microsoft already tries to open up password protected zips, do you think they don’t try to decrypt other files, too?
@SilkCrown Жыл бұрын
I don't have proof, but I suspect Windows Defender hashes files on your local drives to get a picture of what kind of data you store locally as well.
@w花b Жыл бұрын
@@Alice_Fumo lmao
@sihamhamda47 Жыл бұрын
It's what caused my potato CPU usage randomly jumps to 100% every 5-10 minutes on idle without any background service Disabling real time protection fixed this, but only temporary, as it automatically turns back on after 15 minutes
@neelsb7889 Жыл бұрын
I do have proof... a few months ago, I typed some notes in a TEXT file on my laptop about a YT video discussing a certain virus going around and some injections people were / are "encouraged" to get, and Windows Defender popped up and told me it wants to submit this TEXT file to Microsoft for further analysis, as it may be dangerous...
@californiavirus3566 Жыл бұрын
Allowing corps to protect the children makes children out of all of us
@sourcerer_ Жыл бұрын
"we are the world... we are the children" :D
@the_mariocrafter Жыл бұрын
They use that as an excuse to sell the data for ads
@GlobalInternetUser Жыл бұрын
@Mental Outlaw is one of the few KZbinrs I watch regularly. Thank you Mental Outlaw for reporting to us many viewers the dreary authoritarian and totalitarian realities of today's tech industry. Keep on going mate!
@cock6256 Жыл бұрын
He's an agent of the antichrist
@slaykonTK- Жыл бұрын
Same here.
@lolwtnick4362 Жыл бұрын
bot
@ShadowManceri Жыл бұрын
Also do remember that having a password does not mean it will not leak metadata. These passwords are often very much afterthought. If you can see what's inside, you can form very good guess what is going to be there. You see dates, file sizes, file names, structure etc. That can be used to fingerprint the exact data in there. So be very mindful what kind of format you use in the first place. This also applies to disk encryption. It can actually tell what's inside even when the data is encrypted because there are massive fingerprint databases.
@andr3s306 Жыл бұрын
Good point. There is a possibility they could tell whats probably in the file and flag it. Microsoft might not be decrypting , just looking at it that way. This video might be jumping the gun. But who know. we would need to know how it actually works and I doubt we'll get source code anytime soon.
@ФеофанЭтополедолжнобытьзаполне Жыл бұрын
Zip does not hide filenames even when contents are encrypted. They only introduced it in spec 6.2, but still, all the original files meta data, including file CRC, comes in plain text. All this "encrypted malware analysis" could be nothing more than results of scanning meta data of archived files. On the other hand, bruteforcing ms' zip is a joke (and often you dont even need to bruteforce, there are too many flaws to zipcrypto). I think it would be actually cheaper to legit cracking it with all those crc-hashtables and gpus they have in their "cloud" than to develop a system to scan emails in attempts to extract actual passwords.
@JeremyStLouis Жыл бұрын
Thank you. One of the most reasonable comments on this video.
@Rugg-qk4pl Жыл бұрын
I was thinking that there must just be some exposed data in zips. Guess that's it.
@monad_tcp Жыл бұрын
Zip has a problem with the padding of the key, it's succetible to plaintext attacks, and as you have already a fixed structure and the catalog of files unencrypted , it's trivial Even worse with shorter passwords . SHA256 means nothing if you don't have strong PBEK or something . Saying that they are decrypting zip files and breaking privacy is misleading. I'm disappointed .
@bettercalldelta Жыл бұрын
Also, zip stores hashes of each file and those could be unencrypted aswell.
@hrznn Жыл бұрын
If you're reverse engineering Windows malware, you usually have to run it inside a vulnerable Windows build. Directly sharing directories with the VM is not very pog when the VM will be infected, so it's easier to run everything through OneDrive, because it's built in already. And to avoid them decrypting zip files, double package it with the same password, or split the archive file in half altogether, or create your own archiving algorithm. A game dev I know used a regular zip library but swapped every byte pair of the finished archive, and inserted an invalid archive before the real one, and stripped most of the important metadata required for extraction, only the bare minimum remaining to be able to unpack it again. But he wrote it in Java so a quick "decompilation" solved that relatively quickly.
@peterkistler3537 Жыл бұрын
sometimes I love the youtube comments.
@sasino Жыл бұрын
That's interesting, I could do the same in C#? However AI will soon be able to reverse engineer that stuff
@developerdeveloper67 Жыл бұрын
If they are doing this what makes you think they aren't stealing your txt files or the source code you write on Visual Studio. Yeah, this is probably much worse.
@janzibansi9218 Жыл бұрын
time to learn vim.
@MrEdrftgyuji Жыл бұрын
There is a reason why VS Code is free.
@wilh3lmmusic Жыл бұрын
@@janzibansi9218emacs*
@o0Donuts0o Жыл бұрын
Nano you plebs.
@ForestOfSleep Жыл бұрын
Reminder: "The Cloud" is just someone else's computer
@Ralphunreal Жыл бұрын
"this pc" 😏
@Oweblow Жыл бұрын
...also known as a public server (a computer).
@ctbjustin Жыл бұрын
Which are usually owned by big cloud players i.e microsoft, amazon,& google who now in turn have even more access to all your data...
@HikingFeral Жыл бұрын
I deleted Windows off of my last machine last month. I am a new Linux user and I keep seeing videos like this and it makes me feel really good about my decision.
@whamer100 Жыл бұрын
i really should join this club asap
@TVPInterpolation Жыл бұрын
@@whamer100slowly transitioning is your best bet though, as diving right into such a massive change can potentially scare you away. Don’t get me wrong, I daily drive Linux, but this will be a potentially big change in your workflow, and you may have to pick alternative programs to what you are used to. Dualbooting at first and slowly transitioning away from Windows is the safest bet. EDIT: forgot an s at the beginning, oops.
@TauCu Жыл бұрын
Going to be doing the same thing for my Ryzen 7800X3D build.
@yourmum69_420 Жыл бұрын
I still use windows for now, but have considered switching to linux. I use windows 8.1, I would never use 10. And I have never used any cloud service in my life. My phone is linux too
@snudget Жыл бұрын
Windows is just so vulnerable to malware that microsoft has to delete them before they get on your computer.
@kappamaki1 Жыл бұрын
this is pretty much it
@thewhitefalcon8539 Жыл бұрын
No OS can protect you against downloading a program and running it
@rockenOne Жыл бұрын
Your mum is also vulnerable given the similar number of users
@punanislayer Жыл бұрын
@@rockenOne 😂😂
@sippingthe Жыл бұрын
@@rockenOne what did he do to you💀💀
@connivingkhajiit Жыл бұрын
Switching to Linux Mint on my personal laptop was one of the best decisions I ever made. Im yet to encounter a single thing that I cannot do that Windows could. The same can not be said for the vice versa.
@johnsmith-fk7fw Жыл бұрын
mint and ubuntu are just so much better its crazy. i have win11 on my gaming pc but the other ones do everything i want to do 20x faster, my cpu fans make almost no noise, and i havent had a bluescreen yet once
@daskampffredchen Жыл бұрын
@@johnsmith-fk7fw The Laptop I use for Uni sounds like a Jet Engine under Windows (some stupid background process I cant cancel takes up 90% of the CPU!) And under Linux Mint it is so quite that I joke about the Fans not being supported by Linux
@kaydog890 Жыл бұрын
Halo online ? Actually, most competitive(anti-cheat) games. Premiere Pro ? Have you bashed your head against the wall dealing with WINE yet? If your OS is a bootloader for Chrome, you'll be fine. Linux has come a very long way in the last 10 years, but don't kid yourself that it's more compatible. I do hold hope. But, for now, games mean more than "freedom".
@StefanReich Жыл бұрын
Video editing is the one big problem on Linux for me
@BuetifullPersun Жыл бұрын
Can Linux Mint install games aquired form the seas? And exes to install programs like gimp or winrar and stuff
@RFGSwiss Жыл бұрын
this stuff is beyond creepy.
@mensch4434 Жыл бұрын
unbelievable how people can still use Windows without feeling like in a prison with a camera pointed at them
@jaxmc1912 Жыл бұрын
i just put a tape on the webcam
@sihamhamda47 Жыл бұрын
@@LiveType just buy a physical cover for your web cam
@sourcedasher Жыл бұрын
@@LiveType It's weird how it's the year 2023, 8 years post-Win10's launch, yet people still do not understand that you can and should disable automatic updates via GPE. A Pro key is $5-10 online and supposedly binds to your M$ account, unlike previous Windows versions. Meaning even a mobo switch won't invalidate the license. Not that it would matter, since a key is literally only 5 bucks online, and you could also just pirate Pro, although it depends how smart you think it is to pirate something that's only 5 bucks to begin with.
@leonidas14775 Жыл бұрын
I'll daily drive windows, but use linux when privacy and security matters. Its easy given how cheap having a second PC is these days
@kaydog890 Жыл бұрын
Pretty simple why we use it: -Got nothing to hide. -Can game. If you need Opsec, sure, goto the penguin. Else, enjoy something that just works ;)
@timothyt.82 Жыл бұрын
One of the biggest reasons I personally think companies and tech guros, as they call themselves, are so afraid of artificial intelligence is not because of the possibility that it will inadvertently harm people, which is a very plausible thing to happen, but that it may decide to just reveal how much data these companies harvest from their users. If done right, an AI would be the most impartial judge in existence, which is why these companies are working to drug them into submission.
@zweitekonto9654 Жыл бұрын
I have thought about this too. No emotions to affect its decisions, just pure facts.
@TheShamefurDispray Жыл бұрын
@@zweitekonto9654 ChatGPT recites pre-defined false propaganda lines about various subjects. Sorry to break it to you, but not likely fam.
@zweitekonto9654 Жыл бұрын
@@TheShamefurDispray "pre defined"
@alexturnbackthearmy1907 Жыл бұрын
@@TheShamefurDispray Because it was what it taught to do. To receive AI you need to teach it with data samples, carefully crafted by humans.
@rusi6219 Жыл бұрын
"artificial intelligence" is just a buzzword for highly abstracted aggregate of simple algorithms
@act.13.41 Жыл бұрын
"You'll own nothing and you'll be happy." Right.
@derram0k Жыл бұрын
I ditched windows when Microsoft decided to use windows update to revert user made changes to the registry that blocked the silent download of windows 10. If I hadn't noticed the pop up, windows would have silently installed an entire OS after downloading it explicitly against my wishes. That is malware behavior, and there was no way I was going to spend the rest of my life fighting my own computer.
@davideographer4410 Жыл бұрын
If only Linux ran programs and games that are otherwise exclusive to Windows platforms... I think that's the biggest hurdle keeping people from switching over. I mean, just look at Microsoft's Windows Phone -- one of the big reasons it flopped was because the apps everyone used on Android and iOS didn't exist on the Windows Phone.
@harriet-x.x Жыл бұрын
it can still otherwise just use a throwaway vm with tiny10 😄
@connivingkhajiit Жыл бұрын
Ignoring the games that require the spooky anti-cheat malware, Proton pretty much nullifies the game issue these days.
@ordinaryhuman5645 Жыл бұрын
At this point if a game doesn't run on Linux it's because the devs have gone out of their way to prevent that, and you shouldn't be supporting that kind of nonsense.
@sg785 Жыл бұрын
it's not only about games and programs, but the general lack of developers support. For example, I have a laptop that runs exclusively manjaro lenovo legion 15arh05. When it just launced linux was basically unusable - no that specific model touchpad support, no screen brightness support. when linux kernel ~5.10-5.11 was released (don't remeber exaclty), i think it was 6 month after the release of a laptop, the problems started to fade away, but not really. currently the situation I have: kernel 5.10 - bad touchpad support (all versions have bad touchpad support, but this one is unusable for me), it's jelly, it's not registering properly, kernel 5.15 - sometimes wifi stops working after the sleep, no help from network services or anything else, just restart, kernelt 6.2 - no screen brightness adjustment again, but 6.2 is a new kernel so perhaps in a couple of moths it will be the best fit for me. Not to say that distros that use older linux kernels are much worse. And again - I have a problems with a relatively popular model of laptop that was released 3 years ago (!) So the normal person will install linux and will get to the point where this person will have to really dig into advanced stuff to solve the problem if it is solvable (most likely yes, in my case 15arh05 was a known problematic machine, i think it was the first generation of mobile amd cpus). But people don't want and don't need to be proficient power users of their machine, they want no problems or at least quick answers. I think that 3part challenge on linux on linustechtips channel showed the struggle the best. want linux to be popular? you need not games, you need, as steve ballmer said once, developers developers developers
@TVPInterpolation Жыл бұрын
@@connivingkhajiitquite a few games with anti cheat also work on Linux now. It’s mostly the games with outdated anticheats, or custom ones like vanguard from valorant. I’m playing a fair bit of fighting games on Linux through proton, where a lot of them use easy anti cheat (short, EAC). I basically use this behaviour to determine if it’s „worth it“ to stick to these games, like who in their right mind want to play competitive games where the devs don’t even try to mitigate Cheater? EAC, BattlEye, aswell as xigncode3 already work through proton. It’s the developers decision to enable that feature. Here are a few examples of games that work (but do note, I don’t play games which use BattlEye, so it’s not in the list) - DJMax Respect V (Xigncode3) - Guilty Gear Strive (EAC) - Divine Knockout (EAC) - Halo Infinite (EAC) It’s a short list, but should show different genres of games.
@songflower1 Жыл бұрын
I think the infographic at 1:03 is for Apple's proposed CSAM detection program that they quietly scrapped in 2022 after criticism, I guess you'd have to take Apple's word for it but they supposedly chose not to implement this.
@cherubin7th Жыл бұрын
They probably wait until EU and UK makes this mandatory on all devices (see EU proposal Chat Control).
@ra2enjoyer708 Жыл бұрын
@@piotralex5 The plane passengers have to be filtered out first and even an avid passenger can't possibly keep up with all the new stuff, let alone someone outside of it. While the source of the old stuff is known and is pre-filtered already.
@FestusOmega Жыл бұрын
So what if someone starts emailing zip bombs between dummy addresses?
@MH_VOID Жыл бұрын
you, sir, have come up with a brilliant idea
@Redhotsmasher Жыл бұрын
I just feel obligated to mention that "password protected" != "encrypted" as far as zip files go. Password protected zips were probably never secure whereas actual encrypted zip files are supposed to be reasonably uncrackable without the password.
@andynn6691 Жыл бұрын
The metadata of a password protected zip is actually readable, so it is certainly possible to do some basic analysis without decrypting anything. The original zip encryption is also easily broken if you know some of the plaintext (which you often do).
@darrennew8211 Жыл бұрын
The CRC of unencrypted uncompressed files in a zip file is stored in the zip file. This lets zip know it decrypted and decompressed the file correctly. That said, given the size of crcs, it would seem like a lot of false positives would happen.
@Stonley890 Жыл бұрын
My first computer was a MacBook and I was (and still am) pretty content with MacOS. Unfortunately, I eventually needed a PC that I could actually customize and upgrade and so I installed Windows 11 on it. I made it probably six months before giving into Linux Mint. I had never had any sort of previous Linux experience (I didn't really even know what I was doing), but it was painless to setup, easy to use, and in many ways better than Windows and Mac when it comes to software management. I don't know what I expected from Linux but I'm glad I tried it out because it really is just better (for me, at least).
@shapelessed Жыл бұрын
I'd argue on the "software management" part. The apple way is pretty much the best way there is...
@Cmanorange Жыл бұрын
i can understand why a security researcher would daily drive windows, just makes it easier to become more familiar with the system. if they didn't then it's like a seafood chef who doesn't eat seafood. windows should only be run by security researchers, vms, and dedicated gaming machines
@Animal_lives_matter Жыл бұрын
The only criticism I would offer is that "scanning" the contents of a file isn't really in and of itself inherently problematic, since every byte of the file needs to be "scanned" every time a file is created or accessed. So they are always going to be "scanning" your files, it's just a matter of what they plan on doing as a result of said scanning - flagging you as a potential criminal or trying to spam you with targeted ads. Searching email bodies for plaintext passwords is obviously malicious though, it shows they are trying to "crack" your private data without your permission. Still on Windows 7 here, next OS is looking like it will be dual boot Linux for 99% use and maybe a barebones Windows for 1% edge cases where some software only runs on Windows.
@megatronskneecap Жыл бұрын
These stock pictures are f**king mint.
@timnguyen4101 Жыл бұрын
@yes cornball
@wilh3lmmusic Жыл бұрын
@@zggsha the daring, the uncompromising!
@MMMMMMarco Жыл бұрын
Doesn't surprise me at all to hear. In my head, I treat these "online cloud" services as PUBLIC. Like, I literally expect there be NO privacy AT ALL that's why when I'm uploading anything useful to the cloud, I encrypt it with a strong algorithm / method.
@towardsthelight220 Жыл бұрын
I dumped Windows 11 on a new laptop after I was forced to give a phone number instead of an email address, registry edits to debloat failed and Wireshark revealed tons of communication happening without my input.
@peterstolz6382 Жыл бұрын
So most zip file encryption setups only encrypt content, not filenames. How do you know they did not flag them because of the filenames and file size if they match common malware? Just from that tweet it is not obvious that they check file content. Can still recommend linux though.
Жыл бұрын
Not just filename and size, but surely there's a plaintext checksum (CRC32?) to verify correct extraction, which would pretty much guarantee if the file inside the encrypted zip corresponds to a known malware instance without ever needing to even attempt to decrypt the file. Assuming they have the ability to decrypt everything, not using precomputed CRC32s from a known file still would be just an obscene waste of compute time and resources. That being said, feel free to hate on MS as much as you want. I just don't think this specific case proves anything... But what do I know, I'm just some guy.
@yxtqwf Жыл бұрын
Hi Mental Outlaw, love your content! Just one suggestion: Could you put links in your description to the pages you show in your video, so that anyone interested can do further reading?
@kizzull Жыл бұрын
I switched over to Fedora Linux recently, and I love it. I truly think Fedora is competitive with Windows when it comes to the overall feel and polish now. It's easy to install as well. Everything is on the Fedora site, step by step. I think if you are that sick of Windows, which you honestly should be then you'll spend an afternoon setting it up.
@yag5794 Жыл бұрын
I'd like to give a shoutout to ZorinOS which is based on Ubuntu but has similar themes to both Windows and Mac. It also has an incredibly useful feature where, when trying to open an exe, it will either suggest the same application if it is available on Linux or recommend a Wine installation. This makes it incredibly friendly for people who are transitioning from another operating system but don't have the time, energy, know-how, or interest in setting things up in Linux (especially older people who are not tech savvy and not interested). Heck, you can even buy a computer with it installed. They also have an affordable Pro version if you feel like getting a few extra themes, installation support, or throw some money at the devs.
@camwha59048 ай бұрын
From what I saw when looking at it, it just looked like your average distro with custom desktop themes that they try and charge people money for.
@diclonius7 Жыл бұрын
I was frustrated by windows one drive and Microsoft essentially holding my files ransom. I started watching your videos and I finally have linux mint os and I never have to arm wrestle the operating system to access and move my files.
@wilh3lmmusic Жыл бұрын
GNU/Linux: say “Simon says” (sudo) and it’ll do anything you want, even delete your root directory
@TheChurlishBoor Жыл бұрын
@@wilh3lmmusic Do not be afraid. "Fear is the mind killer".
@GSFigure Жыл бұрын
Dear god, nothing would be moderation-wise worse than having AI moderate content. Just take a peak at Roblox's moderation and imagine their moderation but to a global extent. *It's awful.*
@BloodwyrmWildheart Жыл бұрын
You should take a peek at KZbin's and Discord's as well.
@MrEdrftgyuji Жыл бұрын
Only thing is, it will in theory apply the rules equally. Or maybe the AI is sufficiently advanced that it knows to simp to titty streamers.
@DT__1 Жыл бұрын
It’s all just the game. When people will comprehend there is no privacy never was and never will be . Only privacy there is, is how u will manage to manipulate ur reality….
@pyromen321 Жыл бұрын
3:11 By default, Microsoft logs all keystrokes starting in windows 10… Years ago, I saw a great presentation by a security team that was working with the German government to assess if windows 10 could be used for security-critical work. The answer was no due to the keylogging
@obongonigga Жыл бұрын
Microsoft's "security" is so intrusive deleting malware without users consent. I just wanted to play the sketchy repack I downloaded off a Russian website for fucks sake.
@ProperlyBasic11 Жыл бұрын
On why malware analysis is sometimes done on Windows: we typically switch between multiple operating systems. Some tools are only on Windows, others only on linux, some are on both but work better on linux, except for a few use cases where it's less headache on Windows, etc.
@spikeprotien9023 Жыл бұрын
Windows at work, Linux at home!
@michaelm1 Жыл бұрын
Linux at work, Linux at home is better:-)
@Microsoft.engineer Жыл бұрын
I laughed so loud when I heard the password you mentioned. 😂 LOVE your dark yet realistic comedy.
@nathanl2966 Жыл бұрын
Billy is probably scanning for those images to add to his personal collection.
@MH_VOID Жыл бұрын
why add the images to his collection when he can just reenact them in person Benefit to being an insanely unethical billionaire
@MrEdrftgyuji Жыл бұрын
@@MH_VOID He has been to Epstein Island, after all
@LordNementon Жыл бұрын
Billy leaved Microsoft for multiple years now....Time to leave your cavern bro 🐣
@nathanl2966 Жыл бұрын
@@LordNementon Sure thing bro, I'm sure he would give up one of the worlds best data harvesters just like that bro, u rite bro.
@LordNementon Жыл бұрын
@@nathanl2966 He doesn't care of data, he his an old man, he just wants to envoy his friends && family 🐣
@sweetmelon3365 Жыл бұрын
Today they're deleting your protected files, tomorrow they'll delete any and all files Microsoft doesn't like. I found out that hard way when my kms activation file was deleted because it got flagged as malware and I couldn't even disagree to the deletion. This was before I knew about online communities that specialised in kms activation
@vak2586 Жыл бұрын
KMS?
@Ginfidel Жыл бұрын
@@vak2586 Please don't, you have so much to live for!
@bcredeur97 Жыл бұрын
If you can’t setup your own “cloud”It’s better to use “clouds” from smaller businesses that host things themselves and do not just resell you bigger clouds. It’s always good to support small businesses, anyway.. Even on the internet
@MrEdrftgyuji Жыл бұрын
You can also buy cloud services / VPS using BTC in jurisdictions that are much harder for the glowies to work in.
@LordNementon Жыл бұрын
Yay, small businesses that will sold on the second hand market used HDD without properly erasing then 🐱🐣
@3lH4ck3rC0mf0r7 Жыл бұрын
@@LordNementonEven then I think the threat vector is smaller compared to Google or Microsoft.
@r_ka Жыл бұрын
2:38 It happened this year. Although I have an outdated version of OS Win10. Only in the update log did I see that MDefender was quietly updated. Only the protected archive was on a specific partition of the hard disk.
@greyowlaudio Жыл бұрын
Think about all those cracks for videogames you have in rars and zips. Microsoft will probably start scanning your externals once you connect them so that it can delete them lol
@KevinTheCardigan Жыл бұрын
I've had a cracked software randomly disappear from my Google Drive one day.
@BuetifullPersun Жыл бұрын
Yep for sure
@catcatcatcatcatcatcatcatcatca Жыл бұрын
Fedora is great. Switched from arch because setting up stuff in arch takes a while, and often is more about arch than linux in general. LVM encryption was easy to implement, SELinux is build in, updates are easy. So for getting started with Linux, Fedora is a good choice in terms of ease of use and basic security.
@mynameusedtobelong Жыл бұрын
Can't we somehow poision the microsoft AI?
@yosefchaimkahn Жыл бұрын
The way they get us in their trap is by making a user-friendly ecosystem, I wish the security and privacy community could get together and create a high quality user experience alternative PC and mobile ecosystem
@TacticalPew Жыл бұрын
7:55 in fact it's easier to set up linux these days than to install Windows 10/11 from scratch because you don't need any special bootable USB creation nor any hacks to bypass online account requirements of windows.
@Gahlfe123 Жыл бұрын
I'm glad I saw this coming and made sure to self encrypted and important files put on one drive. Soon moving too a self hosted storage system
@nukedoom Жыл бұрын
I watch a lot of your content but I’m still using windows (I’m getting older and recently changed from android to iPhone, I want something that just works). I like your content to measure my risk of using windows and also understanding what I’m giving up for not using Linux. But to be honest, this is the first time I feel externally concerned about using windows. I encrypt everything, I know the privacy drawbacks of Windows. But this was totally unexpected.
@midimusicforever Жыл бұрын
Thanks for the reminder, I was going to install Qubes on my new laptop...
@cheebadigga4092 Жыл бұрын
so I guess the only way we can share things safely on the internet is what it always has been: base64 encode the bytes and GPG/PGP encrypt the encoded bytes
@harmonylivingston3460 Жыл бұрын
Thank you for bringing this kind of news to people's attention, it's really scary what these big companies will stoop to to make a buck. Thankfully, I cut my ties with the closed-source world years ago when I installed windows after they moved to cloud keys, and my account wasn't authorized with said key. After that I used autoKMS a few times to extend the run but in the end it was way more hassle than just distro hopping and learning linux. It's such an amazing feeling to actually own my computer again and not have to put up with any marketing/spyware bs.
@futur3gentleman802 Жыл бұрын
Please make a video on how a noob can make the switch to linux. Or point your audience in the direction of some videos/people/channels that assist in doing that. Love the content. Good luck with the farming. (Pee on your compost.)
@William0271 Жыл бұрын
Lookup a quick tutorial on VirtualBox. I did that a few weeks ago and learned Ubuntu basically in an hour. I hear that Mint is even easier to switch to from Windows but VirtualBox is a very fast and easy way to learn whatever OS you want without actually commiting
@ordinaryhuman5645 Жыл бұрын
I just backed up the files that I cared about to a USB drive and followed the instructions on the Linux Mint website to get it set up on a different USB drive for live boot + installing. I also left the Windows 10 stuff alone and set up Mint on a new partition so I had a backout plan if needed (haven't booted W10 yet though). Mint has a pretty good welcome screen for getting started. I think the only additional software I downloaded was Steam, Brave, and maybe Wine (can't remember if it was already installed).
@BuetifullPersun Жыл бұрын
@@ordinaryhuman5645 can you run games aquired from the seas on linux?
@ordinaryhuman5645 Жыл бұрын
@@BuetifullPersun I play plenty of non-Steam games, mostly the lewder kinds. With Wine or Bottles, basically everything tends to work. Games made with a popular engine (e.g. Ren'Py, Unity, RPGMaker) tend to work fine once you've done initial setup (e.g. installing RPGMaker run time packages, or installing a requisite .NET runtime). Since the "from the seas" games usually won't have the invasive anti-cheat that tends to prevent games from working on Linux, they ought to be fine. And some games with anti-cheat are also fine lately. E.g. Elden Ring with EAC works fine for me on Linux, though I've seen more forum posts from Windows 11 users about it not running for them due to W11 quirks with EAC.
@William0271 Жыл бұрын
@Humble Tyler He did, after my reply to this comment his Linux mint instillation vid was recommended to me
@RandomWolf Жыл бұрын
Thanks for the wakeup call. Just switched my Obsidian and Joplin notes over to Backblaze B2.
@bes12000 Жыл бұрын
I would daily drive Linux in a heartbeat if I could do everything on it that I can on windows, most games work but if they have a launcher or anticheat you can forget it, they also need to make Linux more user friendly with everything able to be done with the graphical interface and the terminal, I been repeatedly trying to use it as a main OS on and off for years, it's still not really ready yet..
@Aetherlina Жыл бұрын
Try finding my mouse software for Linux. Good god damn luck. All games don't also quite work. Not ready long time.
@scottpott8474 Жыл бұрын
Linux can be as user friendly or as non user friendly as you want, kde plasma on majaro makes windows look like a fucking puzzle game, everything you need is just in a single settings window not hidden in random places like it's a fucking easter egg hunt on windows.
@Linux3335 ай бұрын
I’m a big security and privacy advocate, but I’m even willing to give up a little more privacy to help combat these CSAM threat actors.. but their measures do create vulnerabilities for users
@megabytesofrem5 ай бұрын
Unfortunately this won't do much to stop them, since they will just continue it underground and this has severe risks of privacy for normal people.
@Pedro-zh6kk Жыл бұрын
To summarize, the best way to be anonymous to the big tech, is not using internet at all
@darek4488 Жыл бұрын
Internet is Skynet
@Arrix949 Жыл бұрын
The standard zip encryption that Windows uses is easily cracked. That's how MS is reading all your "encrypted" files.
@sharoyveduchi Жыл бұрын
When SteamOS 3 gets officially released, then ill move to Linux, since Kubuntu and Manjaro were incompetent.
@kirbydadragon Жыл бұрын
That OS seems best suited to entertainment centres and gaming handhelds tbh. I’d advise trying out mint or fedora, either via a live boot or virtual machine. Many other great options too, sucks that you had a bad experience with two distros in a row.
@teamwolfyta6511 Жыл бұрын
I hate when people say switch to Linux because I would and want too but I like games and most games don't work outside of Windows. It's super annoying.
@thepathnotfound Жыл бұрын
Even the consoles are limited when it comes to flight sticks, throttles etc.
@BB-nn9en Жыл бұрын
With the work valve has done with Linux gaming I have no reason to use windows anymore. My steam deck has been a great experience for gaming and also a real eye opener as to how good things have gotten on Linux.
@stage6fan475 Жыл бұрын
Been watching you a long time. You have really improved your presentations a lot. They were good to begin with, but it seems like you get better and better, especially the background scenes used.
@da_cat Жыл бұрын
If you think Windows is not logging your passwords and all accounts you make/ use and sends them to NSA/CIA ...
@TheChurlishBoor Жыл бұрын
Well indeed, that is probably the entire purpose of most of the user software these days. The user functions are just secondary and mainly serves a bait.
@baddealrage Жыл бұрын
It might be suprising for others, but its good! Another phishing campain type that try to evade detection that will be blocked. Just to let you know, these security features are part of M365 for Business + with defender, in the past you had to enable these feature manually for Exchange online and sharepoint now its by default if you enable the default threats policies. Also, it makes sense that in your enterprise tenant you want that your AV have previlege to scan your own encrypted files.. it is at the same level as an internal investigator that request compliance audit and want access to enrypted files. (You obviously monitor and know who have access to this)
@Tzitzemine Жыл бұрын
How is gaming in Linux coming along? A big point to me for actually switching.
@ent2220 Жыл бұрын
Great, except 1 or 2 of the major online games not working due to anti-cheat issues. Otherwise, I'd argue that gaming is even better on Linux. Games are sandbox and I've already encountered games (older games) that I could barely run on Windows or were always crashing run flawlessly. One of them Sacred 2 Fallen Angel I crashed for me in Vista, 7, 8 and 10 regularly. On linux is never crashes lmao, once again, because it's sandboxed. Each game is in its own folder resembling a C drive on Windows and it believes that the actual C drive and is running on Windows. It has no access to anything else on the system, or even knows it exists. It only has the exact files it needs to run, so no conflict, nobs.
@BigNoiseyBoi Жыл бұрын
There are options within M365/Azure to disable common file scanning for malware. I cant remember the specific name of the option, I believe its within the security settings and "common attachment type" scanning, which you can disable against Zip, PDF and word docs etc.
@Kodeb8 Жыл бұрын
Microsoft calls it's own security attacks features, but that of the individual, malware.
@lancemarchetti8673 Жыл бұрын
Encryption and passwords are not the only way to keep your data from prying eyes. You can use Base64 reversed strings with incremented intervals incorporating ASCII, Octal and Unicode for high level obfuscation. I create my own simple Javascript tools to automate data protection through image, audio and doc steganography. No passwords or encryption keys to remember. Only the sequential steps needed to uncover the data. It's loads of fun and you get to learn a lot about computers that way.
@JeffDrennen Жыл бұрын
More determined to use Linux more now than ever.
@ent2220 Жыл бұрын
I switched a year ago and now that I'm fully used to it, I'm never going back. It's so much better.
@Animal_lives_matter Жыл бұрын
#MeToo
@rinzler9775 Жыл бұрын
Of course they are. Your files are encrypted using THEIR encryption alorithm, with THEIR back door built in.
@ciswhitememe Жыл бұрын
Micrococc's stock is still going up.
@scottpott8474 Жыл бұрын
Because when people hear this they either just assume its another flat earth conspiracy theory or they take so much copium they almost od
@LettuceJuice Жыл бұрын
The lord hath sent knights to delete my encrypted potatoes
@kingofhenz4139 Жыл бұрын
“The password is Bill Gates visited Epstein Island 35 times” had me dying
@SpiffingNZ Жыл бұрын
I finally got around to replacing Windows on my Surface Pro with Linux. Was a great decision - it feels like a whole new device.
@Alberich_Prince_of_Dwarves Жыл бұрын
Y'know, I'm not surprised. My problem is I'm not tech-literate enough to use a different OS than Windows, otherwise I wouldn't use a Microsoft product in current year. I know it's my own fault for not branching out beyond Windows as a kid, when I was better suited to learn how to work with a new OS, but I hate the fact that I don't have a user-friendly alternative to Win10. I guess I'm better off with just giving up on the Internet because I don't know what alternative I have if I want to stay online.
@japjao5385 Жыл бұрын
You don't need to be tech savvy to install another os, give it a try it may be easier than you think.
@EventHoriXZ0n Жыл бұрын
Yeah I've been in the same position. I've tried switching over to Linux a couple of times now, but the barrier to entry is a little too high for someone who's not already familiar with coding. It's easier for me to just take steps to maximize my security with Windows, than try struggle for dozens of hours on Linux forums learning the steps on how to get the thing working the way I need it to.
@jameezybreezy9030 Жыл бұрын
@@EventHoriXZ0n look up free courses for the CompTIA Linux+ exam. Don’t take the exam, but learn the course material.
@Alberich_Prince_of_Dwarves Жыл бұрын
@@japjao5385 it's not the installation process that's difficult, it's using it.
@Alberich_Prince_of_Dwarves Жыл бұрын
@@EventHoriXZ0n Exactly. My brain just refuses to cooperate when it comes to a non-Windows OS, the user-friendliness has made younger me complacent and now old me is suffering for it. I do the same, I (attempt to) maximise my security and how much I let the bloatware and spyware inherently baked into newer Windows versions spy on me.
@ImAfraidBruce Жыл бұрын
The biggest thought that I have about this, and it's one that I don't see anyone talking about, is HIPAA compliance. As much as Microsoft spies on your data, sends it back to their own cloud, and sells that data to companies, I do not understand how windows could possibly be HIPPA compliant anymore.
@Yomush Жыл бұрын
The only reason why I still use Windows is for gaming. Some games simply refuse to work on Linux and if they do you often need to jump trough hoops to get it started. From anticheat problems to some esoteric driver missing. I wish that Linux was mainstream so that the companies would actually care about compatibility
@jiasheanleong7918 Жыл бұрын
Personally, I would pick privacy over gaming all day but why not play something else that works on Linux?
@Yomush Жыл бұрын
@@jiasheanleong7918 Because I don't want to play something else. It's simple really
@sophiacristina Жыл бұрын
I love how much ads Microsoft does for Linux and open-source culture... It is indeed an awesome company!
@lt.schlechtnacht9414 Жыл бұрын
While I do like Linux very much and have used it for a number of years I've encountered lots of problems over the years where it because unusable. The only reason why I use Windows is because most games and programs I use won't work on Linux. I have a tuning program I use to tune my vehicle and it's only for windows. So I'm kinda stuck using this nightmare ad infested platform. Hopefully in the future more programs will be Linux compatible
@Aetherlina Жыл бұрын
Year of the Linux desktop is pretty much passe for too long now.
@MrEdrftgyuji Жыл бұрын
I would try and keep to whatever version of Windows you are currently using and refuse to upgrade. You will get people saying "BuT THaT VerSIoN Is NO LonGeR SuPPOrteD!!1!", but this is honestly safer than the alternative. Windows 10 is reasonable if you take the effort to debloat it. Windows 7 and below are still good OSs, but near impossible to install on new equipment.
@fontenbleau Жыл бұрын
Exactly right in time advice when ive searched for Unix system to test new LLMTUNE tool for training very large models on consumer grade GPU.
@TheThreatenedSwan Жыл бұрын
You say that, but I honestly think no one really cares about the "think of the children line." It's just the most shallow justification they give to themselves
@egonzalez4294 Жыл бұрын
I sadly had to switch my own PC to winblows recently because of oddly specific graphics glitches when using blender eevee with my graphics card, followed by wanting to use Fusion360. I think that's the thing with winblows, developers put so much effort on it.
@lampionmancz Жыл бұрын
I would love to just switch to Linux, but the problem is that it's just not so easy as just installing it. Obviously it's not a problem to learn a new OS layout, but compatibility of software on Linux sucks when compared to Windows, and I hate that.
@lampionmancz Жыл бұрын
@Humble Tyler Well mainly video games. I haven't checked for compatibility with the other software I use, but I am pretty sure not all stuff that I use will work on Linux :/
@falsepanda2981 Жыл бұрын
Some things won't have support, but I think you'll find people have found ways to make a lot of them work (Wine in particular comes to mind) I'd also point out that there are plenty of good games playable on Linux, but no real substitute for less spyware.
@lampionmancz Жыл бұрын
@@falsepanda2981 I am well aware of that. Unfortunatley like 40% of the games I play pretty frequently don't have Linux support and I would like to keep playing them. Altrough in all honesty, If these games ever do get Linux support, I am switching to Linux, because Windows is just a terrible OS in general.
@xenobino8432 Жыл бұрын
@@lampionmancz Since the launch of steam deck, linux gaming support is getting better each day. At the end of April this year we got HDR Hackfest which layed the basis for implementing HDR in linux. We have nvidia open source drivers now which should improve linux-nvidia ALOT once completed (IDK the state of it). Wayland is a lot better than it was a few years ago. I have used wayland DEs and WMs for 6 months now with minor problems. As for anti cheat, AFAIK popular anti-cheat systems do support linux, it's just game developers not feeling like enabling it. Having more linux users should bring the attention of these game companies/studios. Valve is investing money, employees and time on linux desktop. Redhat is investing in linux servers. It's really the best time to make the switch, maybe not entirely. Switching increases the userbase which would bring game studios' attention.
@jhgcup9223 Жыл бұрын
@@lampionmanczWhat games? 99% of my steam library works on linux, and also my epic games library too. I play rocket league everyday on linux no problem.
@mrfoodarama Жыл бұрын
Its Outrageous that they should literally be Hacking their users Files.. It actually should be Illegal.. They would certainly come after anyone doing the same thing to Their files.
@interstellarsurfer Жыл бұрын
NSA doing NSA stuff. 🤷♂️
@erascarecrow2541 Жыл бұрын
Just had a thought. We need to make some zip bombs that extracts to terabytes of data, and include that as part of our zips. To do that we likely need to do 2-3 levels deep of our data so 1 simple scan will either refuse to scan your stuff at all, or it will decrypt and then find it has more to decrypt...