Primer Designing | Primer Specifications or Primer Requirements | Lec 4 Part 1 | Dr. Muhammad Naveed

Primer Designing, Primer Specifications, Primer Features, Primer Requirements.
The important design considerations described below are a key to specific amplification with high yield. The preferred values indicated are built into all our products by default.
1. Primer Length: It is generally accepted that the optimal length of PCR primers is 18-22 bp. This length is long enough for adequate specificity and short enough for primers to bind easily to the template at the annealing temperature.
2. Primer Melting Temperature: Primer Melting Temperature (Tm) by definition is the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability. Primers with melting temperatures in the range of 52-58 oC generally produce the best results. Primers with melting temperatures above 65oC have a tendency for secondary annealing. The GC content of the sequence gives a fair indication of the primer Tm. All our products calculate it using the nearest neighbor thermodynamic theory, accepted as a much superior method for estimating it, which is considered the most recent and best available.
3. Primer Annealing Temperature: The primer melting temperature is the estimate of the DNA-DNA hybrid stability and critical in determining the annealing temperature. Too high Ta will produce insufficient primer-template hybridization resulting in low PCR product yield. Too low Ta may possibly lead to non-specific products caused by a high number of base pair mismatches,. Mismatch tolerance is found to have the strongest influence on PCR specificity.
Ta = 0.3 x Tm(primer) + 0.7 Tm (product) - 14.9
where,
Tm(primer) = Melting Temperature of the primers
Tm(product) = Melting temperature of the product
4. GC Content: The GC content (the number of G's and C's in the primer as a percentage of the total bases) of primer should be 40-60%.
5. GC Clamp: The presence of G or C bases within the last five bases from the 3' end of primers (GC clamp) helps promote specific binding at the 3' end due to the stronger bonding of G and C bases. More than 3 G's or C's should be avoided in the last 5 bases at the 3' end of the primer.
6. Primer Secondary Structures: Presence of the primer secondary structures produced by intermolecular or intramolecular interactions can lead to poor or no yield of the product. They adversely affect primer template annealing and thus the amplification. They greatly reduce the availability of primers to the reaction.
i) Hairpins: It is formed by intramolecular interaction within the primer and should be avoided. Optimally a 3' end hairpin with a ΔG of -2 kcal/mol and an internal hairpin with a ΔG of -3 kcal/mol is tolerated generally.
7. Repeats: A repeat is a di-nucleotide occurring many times consecutively and should be avoided because they can misprime. For example: ATATATAT. A maximum number of di-nucleotide repeats acceptable in an oligo is 4 di-nucleotides.
8. Runs: Primers with long runs of a single base should generally be avoided as they can misprime. For example, AGCGGGGGATGGGG has runs of base 'G' of value 5 and 4. A maximum number of runs accepted is 4bp.
9. 3' End Stability: It is the maximum ΔG value of the five bases from the 3' end. An unstable 3' end (less negative ΔG) will result in less false priming.
10. Avoid Template Secondary Structure: A single stranded Nucleic acid sequences is highly unstable and fold into conformations (secondary structures). The stability of these template secondary structures depends largely on their free energy and melting temperatures(Tm). Consideration of template secondary structures is important in designing primers, especially in qPCR. If primers are designed on a secondary structures which is stable even above the annealing temperatures, the primers are unable to bind to the template and the yield of PCR product is significantly affected. Hence, it is important to design primers in the regions of the templates that do not form stable secondary structures during the PCR reaction.
11. Avoid Cross Homology: To improve specificity of the primers it is necessary to avoid regions of homology. Primers designed for a sequence must not amplify other genes in the mixture. Commonly, primers are designed and then BLASTed to test the specificity. Our products offer a better alternative. You can avoid regions of cross homology while designing primers. You can BLAST the templates against the appropriate non-redundant database and the software will interpret the results. It will identify regions significant cross homologies in each template and avoid them during primer search.
#Primer #Specification #Primer_requirements

[@YourLocalIndianSamosa]

Hello Dr.Naveed , this is Garima from USA (Virginia). I am postdoc fellow and really liked your lectures. It helped me to understand a lot regarding NCBI website. I appreciate that you shared your knowledge. keep the good work going !

[@Prof.Dr.MuhammadNaveed]

Thanks a lot dear Garima Bansal

[@hitkarshkushwaha2434]

Dear sir, I have sending love from India 🇮🇳🇮🇳🇮🇳🇮🇳... You are doing good job...

[@Prof.Dr.MuhammadNaveed]

welcome dear

[@aesthetic3608]

Huge respect ❤ thank you sir

[@hidayatullah6740]

Great Sir! Very important lecture...........

[@Prof.Dr.MuhammadNaveed]

Thanks a lot

[@sundasfarooq]

Jazak Allah Sir.I am doing PhD your lecture is Very helpful.

[@Prof.Dr.MuhammadNaveed]

nice to hear that

[@kailashpatibhandari6561]

Very helpful lecture sir .....thank you very much

[@sabahafeez6503]

Great work sir..kindly make videos on autodock and chimera softwares will be waiting for more videos

[@Prof.Dr.MuhammadNaveed]

Very soon

[@farahseverydaylife3013]

Sir can you make a video on amount of DNTPs and other things used in PCR and their dilution method

[@Prof.Dr.MuhammadNaveed]

sure

[@AliRaza-hc9fn]

Valuable lecture for our research Thanks sir

[@Prof.Dr.MuhammadNaveed]

Most welcome

[@kiranghulam6186]

Sir is it is important to read ATGC sequence of template DNA where primers can attached and If so then how to read ATGC sequence DNA template for making primers

[@m.mithallaghari7763]

WOW :) superb lecture.

[@Prof.Dr.MuhammadNaveed]

Pleasures

[@m.mithallaghari7763]

@@Prof.Dr.MuhammadNaveed kis university se hain ap?

[@Prof.Dr.MuhammadNaveed]

@@m.mithallaghari7763 University of Central Punjab Lahore

[@saemrasool3304]

A.o.A! Sir, just bio py Jo primer anneal tool ha is ki detail bta dain? Ya koi is ka tutorial?

[@Prof.Dr.MuhammadNaveed]

will make video on it share soon

[@saemrasool3304]

@@Prof.Dr.MuhammadNaveed ok sir. But do fast.

[@Prof.Dr.MuhammadNaveed]

@@saemrasool3304 sure after scholarship lecture

[@saemrasool3304]

@@Prof.Dr.MuhammadNaveed thanks sir

[@tubazulfqar-bk2sy]

assalam o alaikum could you please design the primer of mdr1 of candida albicans

[@Prof.Dr.MuhammadNaveed]

follow it and design

[@nabeelayounas2930]

Sir hum RNA ka secondary structure use krny k liye kn sa tool use krty ha

[@Prof.Dr.MuhammadNaveed]

USE expasy in this regard

[@ma_bodla]

Sir how we design TETRA ARMS Primer set for missense of DNA change in MYO7A gene?

[@Prof.Dr.MuhammadNaveed]

use primer3 for this regard

[@mariababar34]

sir how microRNA primers are designed?

[@sabgaminggamer2256]

great sir. love from gcuf.

[@Prof.Dr.MuhammadNaveed]

My pleasures

[@sabgaminggamer2256]

@@Prof.Dr.MuhammadNaveed please motivate us by making a tour in gcuf....

[@Prof.Dr.MuhammadNaveed]

@@sabgaminggamer2256 my pleasure and set a lecture I will come as Dr Ammer ur HoD know me

[@sabgaminggamer2256]

@@Prof.Dr.MuhammadNaveed i will wait

[@ilsaashfaque1250]

sir kuch cheezein clear nhi ho paa rhi 1) primers should not end in base pairs complementary, but as in 3rd point it is said they should end with G/C/GC so it becomes complementary, how is that, wouldn't it affect binding? 2) 3'end of a primer should be complementary to target sequence but as if it should end with G or C, it may not be always complementary to target seq, what if at that position the target sequence has A or T how would it bind? Plz reply

[@Prof.Dr.MuhammadNaveed]

yes because at 3 end it bind with target G which is strong bind than A:T and helps in PCR amplification

[@muhammadawaisawais778]

Primer specifications means?

[@ahmedawan5909]

Sir I have designed primers in which forward primer is 5 to 3 direction and reverse primer is written 5 to 3 direction is reverse primer read from 3 to 5 direction?

[@Prof.Dr.MuhammadNaveed]

both 5-3

[@ahmedawan5909]

Sir if Forward primer sequence 5 prime ATGGCAAGGAAAAGTTTGATTC3 prime Reverse primer is 5 prime TTACCAACTTGATCTTGTTGCTCCT 3 prime then reverse primer is 3 to 5 direction ?

[@Prof.Dr.MuhammadNaveed]

yes