Group Bias & Black Pigeon Speaks

[@hbomberguy]

Really enjoying this new 'response video' format. Very novel

[@1980EW]

hbomberguy What you did with your stream for Mermaids was legendary. You are a beautiful soul and my favorite talking cannibalistic banana. Also, I watched your workout video- bench pressing comics really works! I’ve gotten in shape and renewed my love of the Flashpoint Saga at the same time. You’re the man.

[@manuelluna9187]

Hey this is the guy I love! Nice to see you here man! I used many of your videos to answer stupid facists here in Argentina! Keep up being awesome

[@RexOrbis]

If you cut out the random Bethesda hate, I would really like your channel.

[@soyborne.bornmadeandundone1342]

Yes! Banana Cannibal is here! Fucking love Banana cannibal!

[@dangrel]

ayy

[@LindsayEllisVids]

I never could think of a good name for my channel either.

[@Arrakiz666]

You are a brand entire of itself Lindsay.

[@moldycarrot9267]

Oh hey. Another youtuber I appreciate on a channel I apppreciate.

[@kozhedub]

Shaun is a badass name for a channel

[@catcatcatcatcatcatcatcatcatca]

Feminist Filmtheory and Baking with Lindsay Ellis? Or FFAB w/ Ellis for short

[@user-vv7bu2le4q]

black pigeons youtube channel name screams “please take me seriously”

[@briandoolittle3422]

Wait, so people are initially suspicious and nervous of people they dont know, but grow to be comfortable around them as they get to know them? Sounds preposterous.

[@totaldestruction152]

It's a liberal conspiracy!

[@cosmicjenny4508]

+Zanzibar Haberdasher “Racism is a biological fact of life-“

[@UCH6H9FiXnPsuMhyIKDOlsZA]

Right? Shocking! Don't they know those people aren't white? /s

[@IrvingIV]

@@cosmicjenny4508 "-and, as all other suspicions, will reduce with adequate levels and types of exposure."

[@BoraCM]

Proximity and repeated exposure increases familiarity.

[@mariuszj3826]

The Irish and the Italians created their own communities and their linguistic idiosynchracies when their early migrations were at their peak. It's no different from Hispanic communities. This happens to Jewish and Asian ones too. It's an outright lie this phenomenon somehow only exists in Mexican migration.

[@noalowenstein6741]

its the constant myth of the "model minority" that bigots use to good-cop/bad-cop their views on immigration

[@overgrownkudzu]

yeah, it's completely natural to gravitate towards people who speak your language and know your food and understand your culture, it's a stupid thing to get upset about. over time and generations, those lines blur when kids grow up in the culture they migrated to and it diminishes.

[@icyr0bin-794]

these dudes are gonna freak out when they hear about “chinatowns”

[@MrBrendanRizzo]

Yup. Five of my eight grand-grandparents were immigrants-_twentieth-century_ immigrants, mind you-and a sixth was technically a natural-born US citizen (yes, she was an anchor baby) but her family took her back to the old country as an infant and she only returned to America as an adult, so I could instantly tell BPS was talking nonsense. His claims were _exactly_ what nativists said about Irish and Italian immigrants 100 years ago, so I got offended on my great-grandparents’ behalf. The bigger irony? At least one of my uncles is a die-hard Trump supporter. At the time of his birth, his side of the family had been in this country for less than half a century.

[@pineapple7024]

Arguably, they’re still at their peak DECADES later. A lot of the people in my community speak exclusively Cantonese, despite having been nearly 50 years since they chain migrated from Guangzhou. Hell, some American born Asian kids I know have Chinese accents lmao. Black Pidgeon Shits or whatever doesn’t know anything about anything

[@andreasnaidero7472]

Schrodinger's immigrant: both integrated and not.

[@ScorpionViper1001]

"Integration" by BPS standards seems to be "voting Republican"

[@cbboone]

You'll never know till they're deported

[@justinhyde7075]

Also simultaneously draining the government of all its welfare funds and also stealing everybody’s job 🤷‍♂️

[@jamesclark976]

@@justinhyde7075 the enemployment rate was very low before this damn pandemic though. There are still millions of illegal immigrant as well so it seems everyone was doing well enough

[@notallopinionswerecreatede4465]

Someone else pointed this out (I can't remember who exactly), but mainstream right wing ideology is pretty much based on double-think. As the example stated by the commenter above: 'Immigrants take everyone's job, and leach off the welfare system at the same time'.

[@Salazzarslaan]

I really love how Shaun often uses their own sources to disprove their argument. Nothing is more crushing than displaying that not only did they not read the material, but they assume their audience won’t either.

[@julianbarriga8513]

Goes both ways your living in a bias as well, i cant people believe this shit.

[@AshDemonYoung]

@@julianbarriga8513 *you're

[@julianbarriga8513]

Its the interweb you understood what i said thats all that matters, your not my boss or my teacher get over your self.

[@AshDemonYoung]

@@julianbarriga8513 ... oh no you're a child.

[@jamesclark976]

@@julianbarriga8513 Whats your counter then?

[@skylithium462]

Also the whole "racism is natural" thing imposes one of the most basic logical fallacies in the book, an appeal to nature. Even if you can argue something is "unnatural" that doesn't necessarily mean it's good or bad. Apples are natural, apples are good, but asbestos forms naturally too, does that mean it's good for you? Of course not, such is the way of the appeal to nature.

[@tristanband4003]

It also presumes the thing is question is in fact natural as well. It's a double fallacy in many ways.

[@GaldirEonai]

@Proxy Effect Yep. Civilization has been a non-stop effort to get as far as possible away from our nature.

[@thegamerloc3882]

I wouldnt say racism is natural what so ever, but I do think resistance to a norm being broken is natural. So if you're raised only around white people you might feel a little out of place around other ethnicities. Then when someone tells you that feeling is ok and they're bad people anyway that's when racism comes in. Long story short is dont raise your kids to be assholes and actually teach them what the rest of the world is like.

[@mightyNosewings]

​@@joaquim_esteves "Natural means following from essence, often in a teleological sense." I doubt that when BPS says "racism is natural", he (explicitly) thinks about the telos of race. Of course, one could argue that he really does implicitly believe in a telos of race -- and, indeed, I think anyone who can use the term "race war" unironically must believe in such a thing. Unfortunately, much of the history of human thought is seeing telos where there is none.

[@TheDrLeviathan]

The internet is unnatural so BPS should prolly stop making videos

[@twistysunshine]

About your discussion on natural v. Unnatural, I was once in a basic emergency care class with a girl who said that "c-sections are unnatural, and we shouldn't use them" This girl said this while eating cheetos with manicured nails, after months of making fun of me for not shaving my legs and not straightening my hair. "Natural" means practically nothing.

[@HadalStreetlights]

I personally think "natural" says more about the people who use it than it does about the thing it's being attached to. Obviously the girl in your class wasn't putting the kind of energy into whether or not to eat cheetos than whether or not we should utilize C-Sections, or perhaps she would've noticed the same inconsistency as you. I wonder where she sits now as far as the natural is concerned. . .

[@twistysunshine]

@@HadalStreetlights Yeah, she really wasn't thinking, but I think it's very difficult to continue using the natural v unnatural binary at all when you've put any level of thought into it. That's a good question, though. I wish I knew. She's a nurse now, so you'd hope she'd have grown past it, but you never know.

[@HereComesPopoBawa]

natural == "my precious unexamined assumptions"

[@AtheistEve]

Everything is natural.

[@themoustachelady2937]

it's a literal fallacy "appeal to nature", using airplanes isn't "natural" either

[@Mezelenja]

People really do all this instead of just saying "Brown people scare me."

[@domeplsffs]

underrated comment xD And yes, yes 'the people are retar***' as someone once said

[@skye4082]

@@domeplsffspro tip: If you feel like you have to censor something, you probably shouldn’t say it

[@KingsandGenerals]

Black Pigeon. Why pigeon and why black?

[@basilofgoodwishes4138]

Aren't there Black Pigeons? i am not sure.

[@runaasmr]

Because pigeons shit on everything and black is an edgy colour, duh

[@Sorrelhas]

Isn't a black pigeon like a crow? Wouldn't "Dark Crow" sound more badass (although redundant)?

[@starmaker75]

Because like bps himself. Pigeons are annoying, constant shit, and creatures you wish they didn’t existed.

[@LOLquendoTV]

Funny how history channels tend to hang out on left tube, its almost as if the right has a terrible understanding of it

[@recordatron]

Ahh the pigeon saga continues! He's like a recurring scooby doo villain.

[@DaSquareful]

He's a bad cartoon network parody.

[@spritelady4669]

This comment gives me life. 🤣

[@marchimedian]

*gasp* "It was fascism the whole time!"

[@recordatron]

@@marchimedian hahaha amazing 😂

[@attentatdefecitdisorder4348]

"And I woulda gotten away with it if it weren't for you pesky factcheckers and second-thought-givers!"

[@Bluehawk2008]

He's a white guy living in Asia complaining about immigration in the west.

[@plaguedoctor6134]

Not really he now lives in Canada and he has Canadian citizenship and American because he's dad is American and he's mom is Canadian.

[@plaguedoctor6134]

@@SuperbLobster I know who use to live now he's in Canada

[@hugechromepeach7916]

@@plaguedoctor6134 You just crushed 98% of their complaints against BPS. Good job.

[@endlesssolitaire731]

What is the problem? Moving to a more advanced society is in your interest. Allowing unlimited amounts of people from less advanced societies to move into your society is against your interest, because this makes your society look more like theirs. If you already moved into a more advanced society, it is in your best interest to stop all of your ex-countrymen to follow you, because this shall transform the place where you moved into a copy from the place, from which you fled.

[@hugechromepeach7916]

@@endlesssolitaire731 SHHHHH. This is the only complaint they can conjure up because their ideas and views can't compete.

[@gregorforrest5402]

"Entire swaths of the population now have divided loyalties, Dual nationalities, and transnational identities." -Says the American living in Japan.

[@perveilov]

Say what? divided loyalties? What kind of fuckery was that? He ain't the one saying that, right? So is that mean, you're being dishonest with your Japanese citizenship? I can assure you, he faking his Banzai towards the emperor, and vomited out whale sushi when nobody's around. Pathetic hypocrites

[@jrrodriguez5429]

He's Canadian

[@seaotter4439]

Username checks out

[@MasoTrumoi]

@@jrrodriguez5429 much to our shame

[@Killroy2112]

@@jrrodriguez5429 please stop bringing tht up it really hurts me

[@fyfef]

"The US assimilated the Italians and Irish, but won't assimilate the Hispanics cuz they self segregate" Totally unlike the mentioned Italians and Irish. It's not like there are like 5 different "Little Italys" that come to my mind and the Irish Mob and the Mafia never existed. It is almost like that change happens over generations...

[@kaziislam2785]

And not to mention the racism against the Irish, given stuff like “No Irish Need Apply,” making it harder for them to exist in the same places as white people.

[@Drownedinblood]

@@kaziislam2785 the irony of it though is that Boston a very Irish place is very racist itself and a lot of people seem to have forgotten the time they were discriminated against after they were let into the white club.

[@CraftsmanOfAwsomenes]

This whole thing is made even more amusing by the ending of the video. Where he says hispanics will start integrating and self-identifying as white. Like, huh? That contradicts what he said earlier in the video.

[@HereComesPopoBawa]

And not like the colonial English haven't been the worst at failing to assimilate this whole time...

[@Drownedinblood]

@@CraftsmanOfAwsomenes white nationalists see this as the white race being made "impure" by white Hispanics. I think this is him also trying to attack the idea that white people aren't dying out by implying these Hispanics and the ones that keep the census count of white people as a majority.

[@altromonte15]

"mexicans and other latinos are not assimilating, they're in fact forming their own cultural, political and linguistical enclaves across the country" and that's different from what the irish and italians did how exactly?

[@wmhaynwwsmn]

Umm we where around when the Irish where here!!! We been around since before they came.

[@no_peace]

I mean so like also how are we speaking English right now Textbook failure to assimilate

[@kaibeargaming244]

And the Irish Catholics and Italians were persecuted for it as well. Same old story. For the Irish it was that they were Catholic, and for the Italians it was both Catholicism and that they weren’t “white,” though mainly those from Sicily and southern Italy.

[@thedemonhater7748]

There’s absolutely no difference whatsoever, besides the fact that the new immigrants are brown.

[@quarkonium3795]

@@thedemonhater7748 And even then, Irish and Italians were not considered white for quite a while in the US

[@SSofIreland]

"Now, folks: would you believe it if I told you that Black Pigeon Speaks _wasn't completely honest about the results of the train study?"_ :O Do I look shocked enough?

[@carysbebard3690]

Imagine my shock! ;P

[@linkofvev]

I'm getting Ben Shapiro flashbacks now, dammit!

[@kassthered8452]

*Gasp*

[@starmaker75]

Guess you can said his study was an...train wreck *dumb beat*

[@LVoidtheEndless]

**O**

[@el_equidistante]

The way he speaks about latinamerica and Mexico in particular, makes it obvious that he has absolutely no idea how those places really are, he just believes in a menacing dystopian brown mythology. It doesn't matter that Brazil has around 80 million people of german descent, that in Latinamerican evangelical churches have been booming for decades, that we are diverse nations with western values since their conceptions. Nah, his delusional prejudices take precedence of course!

[@nathanielclaw2841]

Brazilian here, we have the largest japanese population outside of Japan in the entire world. You know the first thing they did? Segregated. There is a entire region in my city built only by japanese immigrants, with asian style buildings and all the stuff black pigeon hates. And since he is in Japan he probably knows he lives in one of the most proud and stubborn cultures in the world, not only they built this huge area inside my city, but they refused to even marry non japanese people, a fact here is that it if you see an old japanese guy or girl, you can bet that he is married to another japanese. Do you think anyone gives a fuck decades later? Fuck no. Also, its funny how black pigeon gets triggered just because immigrants (in his opinion) dont learn the local language, like this is the end of the world, while the japanese (that he loves because they are pure and dont cause problems) that immigrated here to Brasil made a real mafia during and after the second world war were they would propagate fake news that Japan was winning the war and Los Angeles had just been nuked (lol), until the point that the police had to crack them down with hard facts and logic

[@mathieuleader8601]

to add salt in the wound Brazil having the highest japanese dispora in the world

[@nathanielclaw2841]

@@mathieuleader8601 even more funny, japanese Brazilians going to Japan are treated like foreigners by their own "race". So much for proud homogenous race

[@mathieuleader8601]

@@nathanielclaw2841 that's my point and remember that biracial Ms. Japan and the issues that caused

[@el_equidistante]

@@mathieuleader8601 Yeah, also Peru has a high japanese population.

[@Jimbo55151]

It’s always been hilarious to me that the same conservatives who panic about this loss of conservative voters always seem to deliberately avoid the simplistic fix. Being more accepting to the large, highly religious, conservative leaning Latin American demographic in this country. Really does show what their true intentions are without even trying.

[@ratboii7656]

@Aaron Sanders lmao what

[@jamesclark976]

Yeah, it kind of pisses me off since i have some right wing tendencies and sympathise with republicans on many issues.

[@IDoesntKnow]

Yeah, I always wondered why the fuck the right don't accept people (Muslims and Latinos) who share generally lots of opinions with them. I mean it's all wrong, if we go on political opinions as a reason to ban immigration leftists should be the ones trying to stop it and rightwingers the one who accepts and encourages it😂. Now immagine Trump saying: "Mexico is sending us it's best, I hear that a lot of Mexicans are conservative, christian and respectable right-wing folks." (obv I am paraphrasing)

[@IDoesntKnow]

Yeah, I always wondered why the fuck the right don't accept people (Muslims and Latinos) who share generally lots of opinions with them. I mean it's all wrong, if we go on political opinions as a reason to ban immigration leftists should be the ones trying to stop it and rightwingers the ones who accepts and encourages it😂. Now immagine Trump saying: "Mexico is sending us it's best, I hear that a lot of Mexicans are christian and respectable conservative folks." (obv I am paraphrasing) The weird thing is that he would be saying something truthful.

[@n8m102]

I Don't Know no because leftists have actual principles

[@SkottiKimble]

I hate that my brain has been so over heated by baking and cooking for my parents and friends who're self-quarantined, that when I heard "The browning of America" I was like, but browning the meat makes it more flavorful, then I realize, my initial thought stands. The browning of America makes it more flavorful.

[@trevordavison4078]

What a delicious way to look at it

[@melharis4451]

Mm

[@profanegunman7586]

Chicago must look pretty tasty. Oh wait, that meat is red now.

[@anghusmorgenholz1060]

Right on I'm a chef and I couldn't agree more.

[@alexanderballa6152]

@@profanegunman7586 ngl thats a good pun

[@poisondamage2182]

Another episode of *Man didn't read a book, so Shaun had to do it for him*

[@IntrusiveThot420]

Poison Damage shaun’s great, too bad about all the liberal hating on breadtube though.

[@pebblepod30]

ALPHABET/KZbin has just deleted that channel without reason or chance for appeal. I don't listen to BPS but I think Alphabet/Google/Boston Dynamics/KZbin is standing for destructive principles as a "Privately Owned Public Space" that is behaving like a Law unto themselves. If that is the misuse of power that Alphabet stands for, then it that can happen to any other creator Alphabet or KZbin disagrees with it. PLEASE SPREAD THIS AROUND. BIG TECH IS ABUSING IT'S POWER.

[@Sarvusify]

TOP THINKERS 🙄

[@peterprime2140]

@TOP THINKERS You guys only have the one joke, huh?

[@TheAsymmetrical]

@TOP THINKERS your time is limited boomer.

[@LauraGrrrr5370]

"The Browning of America" a human said that

[@veemon]

A Canadian human living in Japan at that!

[@ladydontekno]

As a Latina I am pleased to be part of the problem.

[@useroffline9999]

ladydontekno As an Arab Berber, so am I

[@TheSolarWolf]

Sounds delicious

[@MrJustSomeGuy87]

Laura Griffin it’s a pretty ubiquitous phrase. NPR, Vox, CNN etc etc use this phrase regularly. Washington Monthly even reports “The Browning of America Is Making Us Safer”

[@czargreg8368]

He talks about the Irish and Italians assimilating and then says that Latinos aren’t. They literally said the exact same thing when the Irish originally arrived in America.

[@cacamilis8477]

@@AlmurTaad-gq4fd Before the 19th century, most Irish immigrants spoke Irish, not English. Also you conveniently dodged the above comment lol

[@Ih8G00gle]

@@AlmurTaad-gq4fd yes, sorry English and Spanish are both European languages 🖕

[@patrickhessman1349]

Shaun doing another BPS video gives me the mental image of a black pigeon strewing trash in your back yard and you drive it off by throwing a skull at it.

[@sottosopravoce]

That's beautiful.

[@aiabby8007]

Shaun, as a resident of Houston, Texas, I am very familiar with the fact that a location can be simultaneously segregated and racially diverse. Houston is iften praised for being one of the most ethnically diverse cities in America, but the truth is that while we're all in the city limits, we don't live together at ALL. There are white neighborhoods, black neighborhoods, hispanic neighborhoods, and even asian neighborhoods... perhaps, someday, there will only be neighborhoods, but until that day, diverse segregation will be the reality of Houston.

[@raptorz8917]

Never gonna happen, people want to live among people in their tribe

[@ChangedMyNameFinally69]

@@raptorz8917 I'm white and have lived with black people all my life, I'm fine. Ignorant and stupid people want to live with people they have nothing in common with barring arbitrary distinctions like skin tone

[@junkscience6397]

@@ChangedMyNameFinally69 Bullshit. You are the exception, not the rule (if in fact you're even being honest.)

[@atl5033]

Raptor Z it’s like you didn’t even watch the video

[@randomnessrules4971]

Judging by your picture, I'd have thought you lived in a "kawaii" science lab in the heart of Japan.

[@Arrakiz666]

I'm sure most of ya'll are aware by now, but Innuendo Studios made a great video about the alt-right phenomenon of swapping arguments without any regard to what one actually believes in so long as it serves the goal of "owning the libs". It's called "The Card says Moops" and it's a part of the larger series of videos deconstructing the tactics of the alt-right. I heartily recommend all of it.

[@atlas8827]

own the libs trigger the libs

[@HadalStreetlights]

Owning libs only works as a sport if it's harder than owning the cons. In fixating on the thrill of owning libs, they accidentally expose the pathetic frailty of their actual political ideology.

[@HereComesPopoBawa]

@@HadalStreetlights Most cons ARE libs, which makes it only weirder.

[@alexsmith2910]

I loved that video.

[@dewayner5388]

I’ve not seen it so brb gonna go watch that

[@luisnavarro5298]

I want to thank Shaun and the rest of left tube, for years I was watching these kinds of people and I knew there was something wrong with it, there were things they’d say that I knew were wrong but I kept watching, they’d make jokes about different kinds of people that would make me feel wrong, I wasn’t until I discovered this channel through his cinemasins videos that I finally realized that these people are actually crazy and that by watching them I was going down a hole from which I’m glad I got out before I reached the bottom

[@tjk9263]

Glad to see you have come back to truth, facts and reality

[@kazmark_gl8652]

I feel that. I was getting big into Thunderfoot and Sargon of Akkad before I unrelatedly realised Cinimasins was wrong about everything, falling down that anti-cinimasins rabbit hole helped me find Shaun, and having Sargon in my reccomend videos filtered in some of Shaun and Hbomberguy's responses to him not reading studies. so thanks to cinemasins I guess for accidentally saving me from falling down the Alt-right youtube rabbit hole, but you still don't understand movies.

[@connor3198]

Same

[@nico6143]

Ouff. The Sargon hump. Lots of people suffer through that at first. Dont be too down on yourself about it. It's a part of the learning experience. After all, how can you say in good faith that you gave the Republicans a fair shake if you dont listen to their stuff? It allows you to handle their arguements better too since you know what resonated with you when you enjoyed people like Thunderf00t. So, I guess Kratos said it best: "Don't be sorry, be better."

[@alexsmith2910]

Congrats for keeping an open mind.

[@subroy7123]

*"The Browning of America"* Lmao

[@amaka637]

+Sub Roy Like the original people here aren't brown 🙄

[@PitLord777]

Well, the BAR is a pretty good gun.

[@acciox3103]

He isn't even trying to hide his bigotry anymore

[@_Tree_of_Life_]

Yeah, let it cook most of the way through on one side, then flip it over for the perfect caramelisation..... 🥩

[@cediviannareeda4305]

Make sure to very lightly brown your America on your globalist melting pot, once the alt right starts screaming, take it out and serve topped with fresh basil

[@coryfice1881]

Let me guess the pigeons sources actually disprove what he says. Bonus points if said sources are decades out of date.

[@hammerhead1410]

Ding ding ding.

[@homeirotheveryfatmanwhoisa8270]

Move Right TV Proof?

[@FlaminFaux]

@Move Right TV nah

[@un959]

I've watched this vid a couple of times but I've just realized that Black Pigeon isn't just a racist, he's an OLD SCHOOL racist. Because, according to him my 3rd generation, "get sunburned in the shade", blonde, green-eyed, monolingual, American-born ass would still be considered one who hadn't assimilated because I was raised Catholic rather than adopting "the Protestant values that built America". Also: This makes it extra hilarious that people think that racism is over because we had a black President. We had one (exactly one) Catholic President in the early 60s and BPS is still saying this crap. But I'm sure all of his ilk think skin color is OK now.

[@katekursive1370]

Black Pigeon speaks... but does Black Pigeon ever listen? (Or shut up?)

[@soyborne.bornmadeandundone1342]

Unfortunately not because we live in hell and deserve to live in hell. Luckily we have Shaun and a few other folks who are not complete stupid assholes lol. So it's not all bad : )

[@wayfarerzen]

The name of his channel is so cringily pretentious that I ignored him altogether. After watching this, i'm glad I did just that.

[@n1w4]

maybe this black pigeon should stop speaking for a little bit.

[@lobomonos5009]

www.theatlantic.com/magazine/archive/2019/03/the-yuck-factor/580465/ I agree, Conservative thought often stems from fear and disgust above everything else, read more at the link.

[@lyoselli]

that was my first reaction to finding his channel first seeing his channel and thinking it could be a quality channel: "oh, black pigeon speaks, let's see what they're speaking about" after watching half of one video: "oh lord black pigeon please don't speak anymore"

[@nerveagent1905]

@@lyoselli "This is why God made it so only parrots can speak. The rest of them would be insufferable."

[@RIPKabosu2000]

Agreed, also love Archspire.

[@AJ_Battle]

true, I remember watching a few of his videos before and his video format is usually what Shauns pointing out. Misrepresent data to push ethnostate ideas.

[@2cleverbyhalf]

I live in California. White Californians used to deeply fear that Mexican Americans would outnumber them and reclaim this state for Mexico. Part of the reason for this fear is that there were extremist groups in the 1960s that had this goal. But for the most part Mexican American immigrants have no desire to do this. They want to be Americans if they become citizens. Black Pigeon doesn't understand Californian culture. Most white Californians got over their fears of Mexican immigration because we live, work, and go to school with Mexican Americans. Some of us married them, some of us adopted them into our families. My niece married a Mexican American man and had children with him. My sister adopted her daughter from a Mexican migrant farm laborer. Mexican Americans are not an "out group" for most Californians. They are our community members. As far as assimilating into our culture by building "enclaves", Mexican farm laborers have always had their own enclaves. We have many groups with many backgrounds in Southern California. We have Indian Town, Korea Town, Cambodia Town, etc etc etc. I have went to college with people from "enclaves", they are as assimilated as any other group that came before them. Most white Californians welcome this diversity because of how it has enriched our food culture, and we are all about the food culture here. We grow so many different crops that can be turned into different dishes with cultural cross pollination. There have always been first gen immigrants that had trouble learning English. Tomi Lahren is descended from Germans that came here without legal standing and her great grandmother never learned a word of English. That is so common you can find all sorts of depictions of this on television and in movies, of Italians, Poles, Germans, etc etc etc, that are from the "Old Country" and don't know the language and live in "enclaves". Black Pigeon himself has that Fargo accent, meaning he is descended from Swedes, or Norse, maybe German. There was a time that they were considered the garbage people from Europe, and that is why they migrated West where they could homestead and have land. I know this because both sides of my family have a long Anglo-Saxon history, my mom is descended from the first colonizers in Virginia. There was a time in this country that if you weren't from England or a particular region of Scotland, then you weren't of good stock. It never amazes me as someone descended from snotty Anglos that other Europeans were really anxious to call themselves "white", meaning of the same sort of background as the original colonizers to the USA. The idea that all Europeans are the same is ludicrous, just as anyone in Europe. And that is exactly why we know that these are not categories that mean anything, because they change over time.

[@RobertSzasz]

And a lot of the fears seem to be rooted in the idea that just perhaps, past injustice would be returned.

[@2cleverbyhalf]

@@RobertSzasz Yep, or as my momma always said, be careful of the toes you step on today, they may be connected to the ass you need to kiss tomorrow.

[@darryljones3009]

Just pointing out that BPS is a Canadian living in Japan, not an American.

[@2cleverbyhalf]

@@darryljones3009 I don't care where he is living now, and the dialect between those living in Northern border states, and Canada is very similar. I don't know where his original people came from, but since he is commenting on American demographics my comments hold. Most of those pining for a day where we go back to our original ethnic disposition probably wouldn't be considered "good stock" by historic standards. Some of them wouldn't even be considered white.

[@GachakoiThomas]

@CommandoDude Idk about that... High cost of living there, "pro-environmental" laws that cause wildfires to spread, being able to legally/knowingly give stds to people and not be at fault, alot of the wrong solutions to deal with the poor folk unable to get jobs or work(raising min wage), and this prob lead to the high welfare spending which also bumps up the cost of living for that complete circle effect. With so much poor it's no wonder it's a blue state because giving the government more power will increase the welfare benefits which is key for people unable to get a job/afford the cost of living/unable to work. It's also the biggest example of America's wealth disparity and destruction of a "middle class".

[@horrovac]

Here in Austria, the results of the latest election were largely seen as a reaction to the refugee wave of the recent years. This brought votes to the conservative/right wing parties and a power switch from a centrist to a right wing coalition. The wins of the right wingers were geographically correlated to the numbers of refugees living in the area, also surveys on the motivation for voting were done, and showed that the wins of the (far) right were motivated by the fear of refugees and were the strongest in the areas hosting... NONE OR VERY FEW REFUGEES. All of the top counties swinging to the right had nil refugees, the ones with most refugees remained neutral or even swung to the left like Vienna, which hosts the overwhelming bulk of them. This is the exact opposite to the effect claimed by black pidgeon and might seem somewhat counterintuitive to him and other right-wingers. However, it's rather logical. The people who never even saw a refugee have nothing to rely on but horror stories from the tabloids and mouth propaganda. The people who have contact with them on the other hand see them more realistically: not monsters, just people. They don't fear them, they sympathise. So I'm afraid I have some bad news for Black Pigeon: not only is the influx of immigrants not very likely to increase the number of republicans because all white people switch, it will shift the balance toward liberalism - not just because the immigrants will be liberal, but because the contact with them will turn some white republicans into democrats. So sorry about that. Not.

[@jamesclark976]

If the left gets control completely, there will be a split among them about something else. Its probably near impossible to defeat the left or right short of force.

[@soupalex]

these people ain't seen a brown-skinned man since their grandparents bought one

[@LVoidtheEndless]

I said “no” at the gasp pause and now I feel silly

[@JesseColton]

Your research assistant seems to be very dignified and intelligent, I hope to see more of him in the future

[@needthistool]

Rare is it to find such a good boy who is also such a good research-assistant.

[@ranz0u]

14:55 He thinks Irish Catholics and Anglo-protestants have no issues? Maybe he gets his history lessons via carrier pigeon.

[@starmaker75]

Republicans party demographic would replace by demographic *laughs in gerrymandering and electoral college*

[@user-tz6jl7qt8k]

Blue states use gerrymandering too...

[@Jacob-Day]

​@@user-tz6jl7qt8k Yes, but it's a matter of degree, not of kind. Republican efforts to marginalise voters are more extensive and in most cases more blatant (including district Gerrymandering, locations of polling places, discouraging early and absentee voting, unnecessarily specific voter ID laws and felon disenfranchisement). Fortunately, as a Democrat in the US, you don't have to argue that it's OK to do these things, because allowing more eligible people to vote is a winning strategy for you.

[@oof-rr5nf]

I wanna laugh cos I am not American. But I wanna cry because I care about Americans. And also. Ya know. It is _America._ Their fuck ups tend to resonate worldwide.

[@frrascon]

Don't forget voter supresion.

[@GhostIsMostly]

I feel like it's been years, Skullman

[@soyborne.bornmadeandundone1342]

I call him British Skull. Now we just need arrow boy to upload : )

[@soyborne.bornmadeandundone1342]

Oh wait... Heard arrow boy did upload recently. Gotta go!

[@caydenmichael98]

Hey! Oh sorry! I'm the wrong skull man!

[@oof-rr5nf]

@@soyborne.bornmadeandundone1342 Arrow's video was good shit. I'll be honest, my main reason for pointlessly replying (a rare instance when I have one) is to see your entire username. Worth it.

[@skyelouisekowe]

It's been 84 years

[@idkidc7513]

[Another alt-right KZbinr with a biased research/argument] *Pretends to be shocked*

[@breadpilled2587]

(rough quote) "i havent heard this before but it seems so obvious now: a group can be heavily diverse but also heavily segregated" Ah, Shaun is white. LOL, no hate, I just thought that was funny. As a Mexican who has grown up in LA, this part of the video gave me a laugh. I guess there are things that seem so obvious and "just the facts of life", that you assume everyone knows about them.

[@HadalStreetlights]

Shit, I live in Texas and I'm pretty white. I had a similar revelation in 2017 that kinda recontexualized quite a bit of my childhood. I grew up with an adopted family in suburban Austin. Daddo's a surgeon. They had wealth and we had no minority neighbors save a greek family that white-passed, save Yanni's awesome accent. In hindsight I lived in a pretty white neighborhood in a segregated city with high diversity, but I never noticed it because, I figure, it never bit me. I never overtly suffered because of it and now I only suffer by proxy, under the knowledge that I was conditioned to a level of unconscious racism by my environment, and have my work cut out for me in disentangling myself from that. I feel like I have to start over, to an extent, and I am kinda jealous of those that have been awake to these things more of their lives than me, for whatever reason they have.

[@breadpilled2587]

@The Dracobirthstonian .... What? If you're asking if I'm a fan of Shaun's, then yes. I'm far left. but SJW? Everyone seems to have a different opinion on what that means these days.

[@Rugybrat]

@The Dracobirthstonian People are throwing that word so much these days, soon it will loose meaning.

[@IsaVarg]

@@breadpilled2587 SJW just means "that person who seems left-leaning politically with views different from my own" these days. Everyone who uses the term uses it in different contexts to mean different things, so it effectually doesn't really mean anything. It's just a generic "insult", like calling people NPCs for having opposing views. When you can't think of a logical, well-reasoned argument, just throw out an insult and hope it makes people angry enough to seem like "the opposition" are the irrational ones.

[@alexbennet4195]

I think it’s just because he’s from the UK, which is no where near as segregated as America.

[@amaziahofjudah9722]

>expecting fascists to argue coherently that's not how power for the sake of power works

[@tristanband4003]

Reading the Anatomy of Fascism really hammers the point home.

[@Shrekfromthehitmovieshrek]

Amaziah of Judah that’s how mafia works

[@amaziahofjudah9722]

which two sides are you talking about. politics isn't dichotomous. left and right are pretty useless terms, because the left consist of critical groups and authoritarian regimes at the same time, so too does the right consist of fascists plotting genocides, and economic conservatives. these categories make no sense, they are a dumb rhetorical device, to support liberal horseshoe theory, which is bs.

[@tristanband4003]

@@RedbadofFrisia We're mortal enemies.

[@amaziahofjudah9722]

Redbad of Frisia you claimed I'm part of an echo chamber, and that my claims about a fascist like black pigeon speaks are the same, as the claims supposedly leveled at my political group. this is categorically false. you also talked about two sides. black pigeon speaks is a well documented fascist and my statement about the incoherence of fascist politics is backed by the philosophical underpinnings of fascism, as explored by e.g. Walter Benjamin and Umberto Eco. Communism isn't logical in the sense, that it doesn't use the Aristotelian logos, as most previous philosophies, but instead utilizes the Hegelian logos, the so-called dialectic. In that sense communism is coherent because it has to be, it cannot revert to a reactionary stance, that's why historical institutions like the Soviet Union are largely regarded as not really communist​ because they were incoherent with regards to their philosophical outlook. Fascism needs to be incoherent, the fascist cannot co-exist with objective truth, he has to become the truth, he needs to merge objective reality and his imperative commands into one.

[@roondar6141]

Immigrants forming into semi-isolated communities in another country is fairly normal and explainable, you can see this with places like chinatown or cities having an Irish or Italian section. People tend to like what is familiar, and if you come from another country into a new one, the culture, food, and language of your old country are going to be more familiar than that of the new country. Over time your community will become more familiar with the customs of the new country and become less isolated. Black Pigeon makes it seem like Latinos forming small communities in places like LA and Miami is dangerous and scary, when it’s a fairly normal part of a group immigrating and eventually integrating into a new country.

[@RaisinBran1312]

Dude I thought the passenger pigeon died out like a century ago

[@MasoTrumoi]

Indeed it did, just like many of Black Pigeon Speaks' political views.

[@RaisinBran1312]

@@MasoTrumoi haha, true that

[@agilemind6241]

@Im.a.tea.addict They probably meant passenger pigeon, not carrier pigeon, easy mistake to make.

[@RaisinBran1312]

@@agilemind6241 edited now

[@caydenmichael98]

Hey Canada! I'm a fan of your healthcare system. If only my stupid country would adopt a single payer system such as yours. Sincerely, a concerned American

[@SmileAndWave]

THE SKULL GOD IS BACK

[@Calpsotoma]

The best of the best.

[@cyberdinedog2097]

HAIL THE SKULL

[@legendarybort01]

SKULLS FOR THE SKULL THRONE!

[@nico6143]

I loved your Anime!

[@allancastellon4432]

Where's my berserkers at?

[@Puzzleguy123]

do people really worry about this stuff? like, do they actually care that some brown people might live near them some day and speak a different language? right wingers are wacky

[@soyborne.bornmadeandundone1342]

Especially when that's already a thing lol.

[@cheese-je9xs]

J Field literally the only thing I care about is the language thing. As long as it’s English or you know English good enough to communicate well then I have zero problem.

[@KeflYeen]

@@cheese-je9xs Why not learn another language? Everybody benefits.

[@jertdw3646]

@@KeflYeen Yes because learning another language is easy and everyone has time for it. Also you don't go to another person's country and tell them to learn your language. I get the sentiment though.

[@janreal84]

BPS uses the old right-win classic Schrödingers immigrant: Does not integrate/assimilates perfectly and is lazy/dook der deeeerbs!

[@cpt.keaton]

*THEY TOOKER JERBS*

[@henrytep8884]

@Anemo R I wonder who they blame when we have full employment?

[@PitLord777]

@Anemo R Hey man, justifying racism isn't easy. Give 'em a break.

[@حَسن-م3ه9ظ]

"They are lazy jobless wights on society, and the want to steal our jobs"

[@ravenn2631]

This is basically stage blue thinking in Spiral Dynamics, which involves creating law and order in reaction to the previous stage red, that just reacted by basically being suspicious of everyone that is outside their small village or tribe. Stage orange then in turn, realizes that they’re all reacting in blind obedience to their religious, non-religious, and/or political belief system and calls them idiots. Stage green then realizes that stage orange is self aware, but doesn’t actually try to anything about it, and so does good. Stage yellow in turn realizes that stage green doesn’t focus on the root cause of the issue and so practices figuring things out. Stage turquoise then realizes that stage yellow can’t do this alone, and so learns to organize an entire community over it. Lastly, stage coral then realizes that people in the community are too dependent on the leaders, and so teach people to figure this stuff out by themselves, even when they’re at the bottom of the ranks.

[@psy_ducky1100]

Funny, I was just hoping that Shaun would upload another video

[@RilianSharp]

you're probably always doing that. i am.

[@SKuLLxKruSHeR]

Click the grey bell to be alerted everytime boneman uploads

[@psy_ducky1100]

@@SKuLLxKruSHeR I do, lol

[@zestroyerkelltron9858]

Psy_Ducky I’m always hoping Shaun uploads. Lol

[@HiromiyamotoDesuDesu]

It's funny. Like, every youtuber I follow uploaded a video today. It's like Christmas came early. 311 days early.

[@KneeCaps]

When is the next cinema sins video? Also tell Jen the thumbnail is pretty cool.

[@KneeCaps]

Pretty neat* mb

[@battleangel1506]

Love your videos dude

[@cutecommie]

It's close to Ben Garrison.

[@storyspice974]

My immigrant brother

[@Outoftime98]

KneeGro

[@Argumemnon]

"I'd suggest you watch that video first". Yeah, I'd rather not have someone take a dump in my ear for who knows how long. The man's a loony.

[@soyborne.bornmadeandundone1342]

Lol I hate it when Shaun suggests we watch a dumb ass video to better understand his points but god damnit shaun... You're simply asking too much lol. Just give us the highlights please. I like having teeth and don't want to crack them all from cringe tonight.

[@caydenmichael98]

Hey fellow Skeletor!

[@weatheranddarkness]

It's the right thing to do, but man, it's brutal. It's excruciating even in a video like this one where the excerpts are kept to a minimum.

[@demirc7009]

I bet you don't read sources when you read studies as well.

[@l.l.7631]

@@demirc7009 legitimate sources for studies are a bit different than a rant from a racially biased youtuber don't you think

[@megustAslagt]

Hey Shaun, for my studies I had to read a paper about the conservation of buildings, but it made a really interesting point you might like too. I quote here: "Traditionalism often pretended to be anti-modern but in fact, it was just as modern. It was just as self-conscious and activist, just as reliant on concepts of historical change and the human ability to control events, unlike the unselfconscious timelessness of premodern tradition and religion; often its ‘traditions’ were invented ones." (I know, it's a bit tough to get through) from The Conservative Movement: a Cult of the Modern Age by Miles Glendinning. Essentially saying (or at least that's how I interpret it) that people who claim to tradition, often claim to traditions that didn't exist before they needed to be claimed to. Personally I dare to continue by stating that it's not a tradition they claim to, but their own interpretation of the tradition, which is heavily influenced by the person's own bias to fit their narrative of the world. As such, it is not the tradition they claim to, but their own opinion instead. Since this is done subconsciously however, the person claiming to tradition does not notice this, nor do the listeners. I saw this as relevant for the video due to what was said at 15:37, where a fragment can be heard of Black Pigeon Speaks telling use about the "traditional identity of America", which I'd bet means a "past culture" that conveniently fits his narrative, but probably has never existed as such.

[@agilemind6241]

Even if it did exist it almost certainly existed for a much shorter span of time and more recently that he thinks. White nationalism or white identity as a concept is extremely young comparatively since before the influx of non-white immigrants people divided themselves on other lines (e.g. Catholic/Protestant) so the idea of a unified white identity would have seemed nonsensical. It's like how constitutional republicans are often super nationalistic despite the fact that during the area of the constitution most "Americans" would have identified themselves by state rather than a common "American" identity, indeed most acts of confederation are more about stopping pointless self-defeating infighting between smaller groups than expressions of an existing unified culture.

[@TheStarBlack]

There's an Hbomberguy vid that cover this very concept - I think it's one of the cultural Marxism ones.

[@needycatproductions6830]

Didn't the queen (ok, I don't really know which queen but I think I heard that in a documentary) even say: "Traditions are great as long as they work. If they don't work anymore, it's time to make new tradition."

[@enfercesttout]

Ive read same in the book Reactionary Mind.

[@LucasZawacki]

That's briefly touched upon on Philosophy Tube's Steve Bannon video as well.

[@jordank1489]

15:20 he says that Spanish speaking people are forming enclaves and "rejecting Anglo Protestant values", unlike the deeply Catholic Italian and Irish immigrant communities. Now, my family is Irish, so I'm fortunate enough to know how ridiculous that assertion is. The Irish in particular are certainly not noted for having embraced "Anglo" (English) or Protestant ideals. They have been staunchly opposed to them for centuries and this continued during their settlement in the US. Even so far as Irish people in the US provided refuge to IRA members fleeing British authorities. Both the Italian and Irish immigrant communities were hit with disparaging stereotypes of criminality, poor social integration, lack of moral virtue etc during their settlement in the US. Black Pigeon Speaks omits this to paint a false sense that "white people" are a monolithic group which shares all cultural and social standards, as well as implying it is the Mexicans/South American immigrants fault that they do not assimilate effectively.

[@williamchamberlain2263]

It's an awesome endorsement of the education systems across the world that he could even try saying that.

[@leftythat5833]

Thank you for making me a leftist.

[@djavanalderromero]

@Pinochet Pilot #666 i mean, genital warts that make the world better

[@leftythat5833]

@Scott Mamby A mental disorder? But I just got diagnosed with genital warts. There are so many doctors on KZbin.

[@FishPondHaver]

Ukaavan Thank you for having that beautiful profile picture.

[@Calpsotoma]

Welcome, comrade.

[@leftythat5833]

@@FishPondHaver Neeble is my spirit alien

[@salokin3087]

Shaun? BPS response? It's epic rationalist time

[@RUlYANG]

is that an r? an n? well, mayhaps I am blind to that small detail. viva la international squabbling and incoherence

[@patrickhessman1349]

Epic rationalist time, better raise the ceiling to contain these big brains.

[@Crlarl]

R A W D A T A A N A L Y S I S

[@oof-rr5nf]

TRUTH AND LOGIC ARE UPON US

[@kobayashi1194]

This guy lives in Japan? No wonder Godzilla’s been so pissed off lately.

[@abirdonacreek8705]

Black pigeon reminds me of a reoccurring villain in a cartoon.

[@jensohlendorffbrnd7125]

(Black pigeon mask is pulled off, and the most glorious smoothest brain appears) I only wanted to take this study out of context, leaving out it's conclusion, and I would've gotten away with it if it weren't for this meddling skull!

[@onalos1271]

It's hard to imagine why Black Pigeon even has an audience. I never realized people could be that easily duped.

[@jertdw3646]

It's people circle jerking each other, like the left has as well. He is a white nationalist that speaks to other white nationalist for the most part.

[@reaverfang377]

When I was duped, I only really watched pigeon in a first attempt for creator diversification, Pre 2021 Jan 6. However I actually ended up steer very far away from him because I at the time perceived him as overly negative and 'black pilled' about literally everything. After Jan 6 and I made my second attempt to spread my perspective and I came to realize it was out of disgust of his world view and the psudo science and psudo political science behind it. KZbinrs like BPS train biases in you, fabricating differences like the segregation experiment in the video which leads whites to become defensive and hungry for confirmation bias thus a increase in consumption of content from the likes of BPS.

[@theshitpostassistor155]

He's a white immigrant in Japan. His complaints about immigration to the West will NEVER be valid as long as he moves outside Japan and never looks back.

[@None-Trick_Pony]

But he's a Conservative so it's different because of reasons.

[@Noschool100]

immigration is the ever moving goal post of fear, it's funny he talks about how Irish integrated, when there were screams that "these Catholic Irish aren't integrating and will destroy the country" was the norm.

[@thejordanianphilosopher6666]

LoL sorry Black Pigeon just because you have nice animations and dramatic Music that does not make your videos valid or true , and BTW how about you stop preaching about immigration while you live in Japan is not that hypocritical? . I love this channel it really shows pseudo-intellectuals and how their ideas and arguments are nothing but a surface level ranting.

[@harshitmadan6449]

He doesn't oppose all immigration. He opposes mass migration of low IQ unassimilating dipshits.

[@RedbadofFrisia]

Japan is a prime example of a monoculture that is regularly used by the alt-right, even Jared Taylor used to live there when he was young. If you think people living there disproves anything they claim you haven't been listening to what they actually say. I know you might not like to hear this, but from the perspective of someone who watches alt-right youtube and leftube, you are both being self mastrubatory and congratulating dipshits. I know fencesitter hurr durr, but all the comment sections pretty much show this.

[@harshitmadan6449]

@Carlos Saraiva I haven't checked my IQ and don't plan to do so. But I'm willing to assimilate to the country I immigrate to.

[@RedbadofFrisia]

@Carlos Saraiva I just said I watched them sometimes, everything else is just what you are filling in, but whatever. Kinda indicative of something people likd you do. Avoid discussion with them and treat any opinion of their as a radioactive contagion and you'll soon see how big you are making them. They don't even have to do anything for it.

[@harshitmadan6449]

@touch me senpai pls IQ is not the ONLY factor for national success, but it is one of many.

[@j4genius961]

Thank you so much Shaun! You literally saved me, I was becoming antiWomen, antiIslam, and anti Black as a black man, it's so easy to fall down that sjw rabbit hole

[@xavier9146]

you should still be anti islam, religion is poison and divides people.

[@basilofgoodwishes4138]

Are you being sarcastic or stupid, can't tell the difference. Also the SJW's are our only hope against stupidity and the regress that is caused by the alt-right. I think you need to reconsider your ideas,if your post was nothing more but anti-sjw garbage, if not, then your post is still unfunny to read and need to learn how to make jokes that work.

[@paradisecityX0]

@@xavier9146 "Religion is poison", that's what Mao said. Politics divide people, I guess we should be against that too

[@paradisecityX0]

@@basilofgoodwishes4138 "Also the SJW's are our only hope against stupidity and the regress that is caused by the alt-right.", ROFLMAO. Are you being sarcastic or stupid? How is SJW garbage any better than anti-SJW "garbage"?

[@kuiperbelt2488]

@Stale Bagelz I think he meant to say 'anti-sjw'

[@surgeland9084]

The skull reclaimer has returned!

[@Calpsotoma]

Shaun will lead us to glorious victory!

[@raphaelchrist7765]

Don’t play with matches

[@Arrakiz666]

Excuse me sir and/or madam, could you direct me to the exit? I wouldn't want to burn down in this theater to a crisp in case that awful arsonist is in the audience tonight.

[@treeaboo]

@@Arrakiz666 The exits are to the *far left.*

[@squelchedotter]

Honestly, I love PhilosophyTube etc. But this edgy Don'T MeSs WItH uS xD just makes me cringe.

[@HereComesPopoBawa]

Baaaww - did you wake up with matches between your toes again?

[@spf18]

@@squelchedotter I'm not sure you're interpreting the "don't play with matches" thing right. In the video, the point of the arsonist is that he's pretending to be a sympathetic person talking about how awful all these fires are when he is, of course, the one actually starting them. He manipulates people into enabling his arson and shifts the blame towards those trying to stop him. From where I'm looking at it, "playing with matches" is enabling fascism.

[@eugenecoleman8525]

A related fyi for anyone interested. I read a study a while back that found overcoming language barriers tends to create a feeling of bonding and friendship between people. I can anecdotally attest to this. I used to work security for GE Appliance at a warehouse. Most of our inventory came from a plant in Mexico through Texas, and due to this many of the drivers were Hispanic, speaking very little if any English. Me only speaking English regularly had to find ways to explain what they needed to do to them, where to drop their trailer, where the office was, etc. I can tell you that every time we were able to figure out a way to get the information across to each other, through hand signs, broken single words of the others language, or translate apps that butchered grammar and used words completely differently (for example drop trailer here does not translate well, where leave trailer here is better) we would both tend to have a joyful moment and smile when we figured it out. I mention this because it showed me how impactful that feeling of overcoming these language and cultural hurdles can be, and how differently it can make you feel about someone. You go from being completely frustrated to feeling like you are best friends. With all this in mind, I think that longer term contact in the train study would have most definitely lead to more tolerant views of immigration and other cultures.

[@5Xum]

Ah, the classic "alt-right: 'This paper proves X' shaun: 'Actually, the paper only seems to show X if finish reading it the middle'". Who was surprised?

[@Ftfwjdndfjw]

Thanks for bringing me out of the alt right.

[@daveharrison84]

I'm glad you're out.

[@Ftfwjdndfjw]

@@daveharrison84 Me too, even have a beautiful latino fiance now. I'm a socialist race mixer now lol.

[@alexsmith2910]

Thank you for keeping an open mind.

[@VB-dp1vs]

What made you leave the alt right?

[@satellitebreakfast]

@@VB-dp1vs It was Shaun, he just said. He burst in through his dining room window, grabbed him firmly but tenderly in his strong arms, held him in a fetal position close to his bare pecs before the skullman whispered hard facts and progressive truths into his ear before injecting him with a stupidness vaccine and leaving out the same window.

[@cnacma]

He said “from Los Angeles to Miami Hispanic people are not integrating into the Anglo American culture”, unironically not realizing both of those cities have spanish names because they were settled by Spanish speakers first (after they murdered the natives of course but don’t bring them up to Black Pigeon).

[@mynameisjack0618]

“The Browning of America” Ew

[@useroffline9999]

Smash 456 As an Arab American, I am happy to bother him with my existence

[@levhdv2117]

I’m excited for it

[@Lmaoeatrr]

It doesn’t have to be seen as racist. He’s being objective, viewing it as it is. America is being more diverse.

[@trazyntheinfinite8393]

@@Lmaoeatrr It does seem racist when the context obviously implies its a bad thing.

[@mayorenstein5316]

So black pigeon either never fully reads his sources or lies and knows his audience is too ignorant to find his sources. This bird makes my head hurt.

[@chrome_disco]

BP says italian and the irish immigrants are ok and then proceeds to claim that having "protestant values" is important, lol. people said JFK had "dual loyalty" to the pope

[@TheZectorian]

Damn I didn’t think I would see a paper published by a relative of mine in a Shaun video. The “o” in Enos is pronounced like the one in “no”

[@MadJackChurchill1312]

Oh boy, another episode of “Black Pigeon dabs himself”

[@무군]

15:22 If being "assimilated" into the majority culture means I have to acknowledge and accept a racial hierarchy that places whites above me (which is what the alt-right is pushing), of course I'm going to hold onto my transnational/transracial identity, I'd be crazy not to.

[@무군]

@Blue Crusader I'm a scandinavian Korean. I was raised in Norway since I was 8 months old. My parents are white norwegians, yet I've always been a Korean in the eyes of the world. I'm not welcome in any "ethnostate" because culturally I am a misfit. Ethnicity doesn't mean shit without culture.

[@sealogic4552]

Blue Crusader Even if they were from South Korea, You think OP is responsible for the actions of the government they were born under? I have absolutely no idea whether or not what you claim about SK is true or not, but it’s irrelevant. OP is not in control of that government. Seriously, do we owe fascists money, or are they doing this slapstick comedy show they call “reasoning” for free?

[@Commy01]

"Browning America" sounds like a fancy ground beef dish.

[@klakkat]

I will say it took me awhile to cool down enough to not post a highly inflammatory comment. Not because I like trolling, but because of my feelings in general towards my fellow Americans these last four years. This is no fault of your videos, they just bring up topics that are, shall we say, heated. I am very appreciative of your content, and I generally agree with you, it just brings up some bad blood with the opposing viewpoints, some of which I know are held by my own family members. So, Shaun, thanks for another in-depth analysis and a balanced and even look at the issues at hand. I enjoyed this video, but since it is still 2020, I'm going to go get more alcohol, because I hate this year, and I hate a lot of the past four years... and there were issues before that that we STILL haven't addressed, but, aw, crap, ranting, ok, time for rum and cola...

[@jlrolling]

It’s almost as if calling someone white doesn’t really mean anything… as far as I know, USA is the only country who asks people to identify with a race. I am Spanish and I think I would say I am white because… well because I am white. But I am not sure an american would agree. It’s just very stupid to me to ask someone to put themselves into such vague categories. Like asking someone wether they are “tall” without specifying any height threshold.

[@basedjenny7362]

Got kicked out of my high school last week. Shaun destroying Black Pigeon Speaks will surely cheer me up.

[@pewtercamaro]

GRAPE SNX -LOL In your dreams anti white!!

[@basedjenny7362]

pewtercamaro broooo you’re an actual nazi that is subbed to David Duke. I didn’t know they still made those.

[@SEAL341]

@@pewtercamaro Why does Duke look like a burns victim?

[@pewtercamaro]

Mr. Braddock -Too much Louisiana sun. I think he looks more like a fish personally.

[@Calpsotoma]

Well, I hope you got kicked out for punching Nazis at least.

[@thequixoticman]

I worked for the 2010 census and the racial self-identification question was actually really confusing for people filling it out. That was one of the most common questions we were asked about. People who identified as latino wanted that to be their racial identification but weren't given the option. I'm not sure the identification on that census was a great predictor of how people actually self-identified as much as it was a demonstration of demographers bottlenecking respondents into categories.

[@tbsn1fan]

Ive fallen for the "go watch this video first" before Shaun. Now my recommended is filled with Paul Joseph Watson. Thanks for that one mate.

[@promoteroflibertyfromgloba8225]

That’s bad? My recommended has Paul Joseph Watson and it’s enjoyable!

[@somebodyonce5976]

@@promoteroflibertyfromgloba8225 How do you stand even 5 minutes of Paul "Punctuate. Every. Word." Watson?

[@brain_apostrophe_t]

The browning of america, followed by the covering of America, the slow internal cooking of America and the plating of America.

[@ozzymandias8137]

The slicing and serving of America

[@brain_apostrophe_t]

@@ozzymandias8137 ooOOooo *that weird resturaunt clapping*

[@JordanSullivanadventures]

ah but you forget the lemon pepper seasoning of America

[@kuiperbelt2488]

THE EATING OF AMERICA. DEEEEELICIOUS

[@Lmaoeatrr]

It doesn’t have to be seen as racist. He’s being objective, viewing it as it is. America is being more diverse.

[@Redpy5]

15:25 ... Maybe we should look at how the local population arrived at places like Arizona and California. I feel like Mr. Pigeon is really putting out whiteness as some kind of default state that is being infringed upon, but "Mexican culture" was pretty much the norm in Arizona considering it was a part of northern Mexico until it came under US possession and was flooded with white people who failed to assimilate. The culture has never not existed there, the people have no need to assimilate. This shouldn't even be up for discussion to anyone who understands the history and has any kind of philosophical consistency imo... Edit: not to mention the indigenous peoples who have been consistently fucked over and whose culture has almost been erased.

[@abnercoelho9720]

Well said ! People seem to forget this.

[@colleennewholy9026]

Which is why we resist. Why assimilate with people, who failed to assimilate WITH US. Like... That's why a lot of Tribes liked the French. The French who traded actually wanted to maintain boundaries, honor deals and allow tribes to live how they've always lived. Of course, the French aren't perfect. But were there a choice, plenty Tribes would have went with the French and Irish

[@GachakoiThomas]

Well it did change sovereignty+influx of citizens, thus changing the dominate culture. Citizens overnight and border disputes are nothing new.

[@vathek5958]

Racists also fail to see the failure of their primordialist worldview in which group divisions are natural and unchanging. This flies in the face of all evidence that shows that we socially construct our in and out groups, and which factors we chose to be important (socio-economic status, ethnicity, religion etc.) are entirely arbitrary. For example, the Rwandan genocide was one of the worst instances of racial violence since WW2. But did you know that before German and later Belgian colonisation, the categories of 'Tutsi' and 'Hutu' were primarily socio-economic (Tutsi's were the rich farmers, with Hutu's being poor farmers, allowing people to move between the groups during their lifetime)? The colonisers enforced European ideas of race upon the two groups and, as the Tutsi's were richer and better education, started to arbitrarily see the Tutsi's as more European. To this day, Rwandan's perceive Tutsi's as having lighter skin, thinner noses and greater height than Hutus (i.e. as being more European looking). After decades of colonisers perceiving the two groups as ethnic and unchangeable (for example, issuing ID papers that listed you as being Tutsi or Hutu and that couldn't be changed), the Rwandan's themselves started perceiving themselves as split into two opposed ethnic groups. Years later, people murdered and were murdered for these entirely arbitrary groups. The group of Hutu's that disproportionately didn't take part in the genocide were the Muslim minority, who perceived their primary difference with the rest of the country as religious rather than ethnic, and hence didn't have much time for ethnic violence. In conclusion, ethnic division is arbitrary and counterproductive to say the least.

[@pewtercamaro]

Vathek -So the social constructs we create aren’t natural? -What about the division between Shaun fans and us, black pigeon fans? -Why did you guys socially construct yourself away from us? -Rwandan genocide was not racial or ethnic, it was class war. And when the poor got power through democratic elections they eventually took their revenge.

[@vathek5958]

@@pewtercamaro On the Rwandan genocide, it was in fact perceived as an ethnic conflict, and today Tutsis and Hutus do perceive themselves as ethnic groups rather than class groups. I don't know what I can say on that besides asking you to read sources like interviews with participants. As for Shaun vs. BPS 'fans', clearly these are outgrowths of other political groups. I don't know, but I assume that BPS also has a ethnic and gendered underpinning given that much of his work appears centred on re-affirming the identity of white men. Personally I'm not a socialist and see myself as less left-wing (especially economically) than Shaun, so I wouldn't really say we share a political in-group except that we both see ourselves as feminists and vaguely 'progressive', hence your question isn't best answered by me.

[@pewtercamaro]

Vathek -Then that perception is objectively false. They are of the same ethnicity no matter their perception. The conflict was inter-ethnic divided mostly along the lines of class. Since Hutu and Tutsi were essentially synonymous with poor and wealthy one assumed, and were usually right, of ones class based on their tribal affiliation. -And I’m glad your closer to sanity than Shaun, who is the ultimate collectivist. The absolute epitome of groupism.

[@HereComesPopoBawa]

@@pewtercamaro - "-What about the division between Shaun fans and us, black pigeon fans?" - It's a matter of process, the content is secondary. Fanaticism is essentially uncritical, so fans of either aren't really thinking.

[@ChangedMyNameFinally69]

@@HereComesPopoBawa How are Shaun's fans fanatical?

[@fmadiva]

Can you and Big Joel not upload quality content at the same time? I'm trying to have a life here but Progressive youtube is suddenly super active with these 30 minute videos lately wtf

[@abirdonacreek8705]

The Leftist Cinematic Universe is colliding. I wonder when an epic crossover will happen.

[@Jvictorbas]

I am not a leftist, but I really like the consistency and quality of your channel. Keep doing this great work! Wish there were more youtubers with this level of quality in other ends of the political spectrum as well.

[@HadalStreetlights]

Mad fuckin props for watching the content of the 'other end.' It's how I got here, anyway.

[@user-tz6jl7qt8k]

@Brocialist Party of America I'm not either. I'd be surprised if either side could convince me. haha

[@nico6143]

Heeeey, welcome to Lefttube comrad. We've got Bananas, creepy milk, and a Universal Dessert Table. Have fun

[@narvuntien]

Me to man. I find that leftist youtube are such great artists that I enjoy their content even if I don't quite agree with them. I got pretty disgusted with the behaviour of my former ingroup of (youtube) atheist that I enjoy seeing their arguments getting torn apart. Also centrist is different in different countries, I am just a social democrat, not a democratic socialist. I have concerns about the history of failure of leftist movements/countries. But these leftist videos really help sharpen my resolve to fight racism and for human rights regardless of the economic system.

[@alexsmith2910]

Thank you for your openmindedness.

[@WhammyReviews]

So, I'm a political science graduate student who actually knows Ryan Enos somewhat (follow on Twitter, he's presented at my department, met him at conferences, etc.), so when I saw him popping up in this video I got a little nervous. Just, you know, in that way you tend to get whenever someone you know got wrapped up in a "KZbinr quoted them" kind of deal. Fortunately, I can say you did a good job representing his work: it's not diversity + proximity that's the problem, but proximity absent integration and positive interaction between groups. If you're interested in going down the rabbit hole of political science work on identities, Liliana Mason's work that's presented in "Uncivil Agreement" is another good book with a focus on partisan identities. Michele Margolis's book "From Politics to the Pews" is another recent good one that delves into life-cycle changes in identity as it relates to religious and partisan identities.

[@bobmiller3627]

So what you're saying is...that he has a bird brain....

[@soyborne.bornmadeandundone1342]

Birds might get offended if they knew you said that lol.

[@svgarpaws]

Three Arrows AND Shaun uploading so soon after another? I feel spoiled 🌝

[@NAWWMANNN]

Imagine the pure, visceral shock I felt upon realizing that the fascist little garbage bird was misrepresenting data and attempting to manipulate interpretations of said data. GASP

[@Aconitum_napellus]

'Living naked in the woods is natural in one regard, and most of us don't do that.' Maybe we should?

[@Ricardo-fv2qi]

"They are in fact forming their own cultural, political, and linguistic enclaves." or why people have a hard time integrating into a set of values and beliefs that is often used to justify their segregation and discrimination from self appointed superior groups (I wonder why)

[@justabitofamug6989]

Ah yes, irish people, famous for their love of *Anglo-Protestant* values

[@ClayburnGriffin]

It's worth noting that in the 2000s, the ethnicity question changed for some reason. Hispanic, Latino or Mexican/Chicano had usually been an ethnicity option. However, from most questionnaires, that ethnicity was removed and a separate question, "Are you of Hispanic decent?" was added. So, Hispanics were then forced to pick an ethnicity after answering "yes". The most relevant options were usually "White" or "Native American". And sometimes the "White" option would specify "Not Hispanic", which further confused things. Long story short: recent changes to ethnicity labels in the US has made it very confusing for Hispanic people.

[@VSPhotfries]

...so basically a youtube personality with strong political bias read a book and used it to confirm their bias, safe knowing nobody in their audience would bother to read the book themselves (or at least without also using it to confirm bias as strongly)? Shocking.

[@buncha3arrows195]

You know, if Republicans weren't so racist towards Hispanics, they would gain a huge amount of voters. Many Lartinos that migrate to the US are catholic and conservative.

[@disappointingperson9162]

THIS. Also "racist to Hispanic" is a bit of an oxymoron since hispanic isn't a race and the term also includes Spain.

[@joshuacoleman8000]

Racist or not they still would openly show disdain for their constituency.

[@disappointingperson9162]

@@joshuacoleman8000 Yeah true, it's not like conservatives ever cared about nuance like that anyway.

[@inkher0460]

I always reel back when I hear people talk about the US like that. Like... BRO... our whole fucking THING is being a nation of immigrants. Like we have a giant metal lady and everything that says so when you get here. I can't think of another country that has that same reputation, and yet BPS is talking like we all sprang up from pure, Minnesota soil. Why do Alt Right ppl even have youtube, do they seriously think people are going to keep buying this forever?

[@hollandscottthomas]

Australian here! We’re in an election year and it’s all about that anti-immigrant fear rhetoric atm. This coming from a fricken prison colony! It’s insane to me that people can bemoan immigration when that’s exactly what we all are - immigrants. We have whole sections of our national anthem explicitly encouraging us as a multicultral people to accept others and share our weird nightmare island, but noooooo. Gotta stop those boats and also Muslims are unChristian etc! Bunch of godsdamned hypocrits.

[@TheMightofDab]

15:21 "Latinos are rejecting the Anglo-Protestant values" Should someone tell BPS that the Irish are not, in fact, Anglo-Protestants?

[@tinamoul]

I know this video is a few years old. And Shaun isn't from the U.S, so this might not have occured to him to point out. But California and Florida use to be Spanish territories. And California actually used to be part of Mexico. So Black Pigeon somehow expects people from historically Spanish speaking regions emigrating to historically Spanish speaking regions to somehow assimilate White Anglo-saxon culture. Wow 😳 the audacity

[@lukegibson9209]

“I would only trust a liberal as far as I could throw them” liked after that

[@missmorbid1439]

I felt offended, I’ve been a liberal my whole life.

[@lukegibson9209]

Miss Morbid no, be a socialist

[@missmorbid1439]

Luke Gibson I don’t really want to be a socialist, though. I support capitalism, but I also want a strong safety net in place. Therefore, I am a liberal.

[@legrandliseurtri7495]

@@missmorbid1439 Those labels are confusing anyway.

[@satevo462]

It would be just awful if republicans had to change their policies to reflect the will of the people because the country became more diverse, absolutely awful......

[@nakenmil]

21:49 Lots of organizations exploit this. Sports teams, miltary units (I remember competition against "the other company" was a big deal back when I was in the army), consumer brands, etc.

[@Zanimater]

Black Pigeon speaks is good at propaganda. His heel is only his hubris, sometimes I wonder if he starts smoking his own stuff. Then, that’s just a shame.