The Longest Time (Without TP)

A Final Fantasy XIV-themed parody of The Longest Time by Billy Joel
Arrangement and Performance by Eyrhil Vimaxthri
Lyrics by Frodbro Swaggins and Eyrhil Vimaxthri
Video starring....
Frodbro Swaggins
Taka Gemelli
Sarda Evenwind
Eyrhil Vimaxthri
Miyabi Gemelli
Teensy Bogard
Laura Bush
Meno Forever
Special thanks Sour Worm for his invaluable advice on mixing and mastering the track.
Final Fantasy XIV: A Realm Reborn belongs to Square Enix
The Longest Time belongs to Billy Joel
This arrangement was composed by Eyrhil Vimaxthri using MuseScore and Linux Multimedia Studio. The vocals were recorded and mixed in Audacity.
Video was recorded using Open Broadcaster Software and was edited with Sony Movie Studio 13.

[@NatyaVT]

RIP TP 2010-2019. You won't be missed. xD

[@DarkRijin]

i really don't miss it!

[@Lufreine]

This feels like a requiem now /giggle. RIP TP!

[@zoaranasis29]

People miss TP?

[@KnightRaymund]

@@zoaranasis29 no, most of us do not

[@blackh9604]

I guess now none of us will have TP for the longest time...

[@Roxasedge]

I ran out of TP about 2 years ago and it still hasn't refilled

[@Dioxa]

holy crap I was expecting just to laugh but this is seriously quality work!! you've got a fantastic voice!

[@EyrhilVimaxthri]

Thank you so much! I'm glad you enjoyed it. =]

[@morprecewarangel3125]

Eyrhil Vimaxthri i have agree! Your is on point!

[@kagemaru026]

if you only had an A S T you could simply lean on good ol' me ask for the spire i know that's what you require you will have TP for the longest time

[@EyrhilVimaxthri]

Beautiful lyric! And so true. We're actually running ast/sch for raid now X3

[@Ranos17]

Still a masterpiece to this day

[@languidhusk]

Jesus christ that's impressive. Nice vocals you've got there!

[@Dracas42]

I'm so glad someone showed me this blast from the past, rest in peace Goad. You will not be missed.

[@Sovietr2d]

This is clever af. I'm sharing this with all my Melee friends in 14

[@EyrhilVimaxthri]

Thank you! I hope they like it :D

[@Sovietr2d]

They love it :3

[@james916927]

No joke.. watched this like 30+ times since last night I love it. Subbing!

[@EyrhilVimaxthri]

I'm so glad you like it! Thanks for the sub and the views =]

[@Staineless84]

I don't know why I thought of this in 2024 but such fond memories.

[@jamesfulton915]

not gonna lie. at first I was dissapointed that it wasn't toilet paper TP but was pleasently surprised by the lyrics and performance. Good on ya!

[@Balader1Cz]

Rly nice voice!

[@Deon]

As a monk, I need to set up some kind of discord bot to play a part of this every time we do A9S.

[@patriceguerrero7649]

Uhm wow the singing and harmonies in this were on POINT! Was smiling for the longest time (pun intended haha) well done!

[@EyrhilVimaxthri]

Thank you so much! Glad to hear I could make you smile :)

[@marcoklepsky]

this is what happens when arrow is put on the monk

[@zegichiban]

New players after 5.0: TP? What's that? Is it tasty?

[@mila_nightsafe]

This is the first FFXIV Music Video I've see and after all this years it's still one of my favorite songs I hear on KZbin! Thank you for this amazing and funny Song! Your voice is amazing 🥰 I'm still listening to your newer songs and I still love them all ❤️ thank you ❤️

[@brovskibouqloir]

that voice.

[@Ultimusvivi]

Sad tp is now a relic of the past

[@JetHammer]

I love this! Gonna link this everywhere

[@BurningBlood517]

TP? Haven’t heard that name in a long time.

[@tiniestcat1615]

Shared this with my raids monk and bard...they sing this whenever they run low now. I regret nothing xD

[@marks3301]

this deserves more views

[@Meno4lyfe]

This was a lot of fun to do. Good job on editing and the singing!

[@neophobicnyctophile8264]

Wow, amazing vocals!

[@vampirenimz]

That was incredible I enjoyed it. Well done.

[@30SECONDSREMAINING]

loved it

[@ExplosivePeeps]

LOL! Corporal Punishment lyric got me. xD

[@Flaky1990]

Really good quality, keep up the great work!

[@TheRealLink]

Great job! Loved the lyrics.

[@Deadeye2907]

This video makes me so happy, thank you so much for making this

[@yeolliepop9017]

I love your song videos they're so funny!!

[@bbarrett726]

I've seen your other FF14 parody songs, and I think this is so far my favorite. Funny and just overall well-made.

[@EyrhilVimaxthri]

I'm so glad you liked it! I always hope my production technique in terms of video and audio improves over time, so this kind of feedback is really good to hear! =]

[@TheSirGummy]

just did this battle last night for the first time... now it makes so much sense

[@PleasantDevil]

this is awesome!!

[@MrCarlislec]

I just found this, f In the chat for everyone who did Alex during tp era

[@michaelbruen6565]

You did it again!...What an awesome job!!

[@LyconaDaCheeChee]

This is Beautiful. Please do more! :)

[@Nuptup67]

This was fantastic! Excellent work.

[@Gshadin]

Ngl this sounds really good

[@NicotineAndSilence]

I don't know why I love this as much as I do.

[@simplexbox]

Caaaaaaan we get a link to the lyrics? Y'know?... for posterity.

[@EyrhilVimaxthri]

Hey, thanks for the comment! If you want to read the lyrics, you can click the CC button while watching the video. Or, you can click the little "..." to right of the like / dislike buttons and select "open transcript". Not sure if that works on mobile, but you should be able to read all the lyrics there on desktop :)

[@shanegrayson7068]

That was so damn good.

[@catcatcatcatcatcatcatcat90000]

I started playing FFXIV very recently and I'm still figuring things out but this is rly fun to listen to while playing??? Its a genuinely good cover, too. You have rly good harmonies and i like how you sound a lot.

[@EyrhilVimaxthri]

Thank you so much for your comment! I'm glad you're enjoying the game, and my song :)

[@catcatcatcatcatcatcatcat90000]

One year later, still playing, and still listening to this song. \o/ Hope 4.0 is treating you real nice

[@ShouldIbeVacuuming]

omg, this is amazing on all sorts of levels! also, it took me back to how warrior felt for me awhile back, lol, thanks for sharing!

[@EyrhilVimaxthri]

Thanks so much for watching and enjoying! And, no, you don't need to be vacuuming :)

[@NarutoFoxBoy30]

Your vocal's got so much beter! Thank you for this

[@Xyniss]

Love it and I'm on Lamia too. Your voice is amazing and this is awesome c: Everyone in this video is awesome!

[@fetzel5055]

Yoshi p saw this video and took it a bit too serious i think

[@EyrhilVimaxthri]

Lmao, people who start after 5.0 will have no idea what this song is even.

[@GothKiitsune]

Eyrhil Vimaxthri I joined during the last few HW patches before Stormblood and I’m a tad confused :| Maybe cuz I just recently hit max lvl about 3 weeks ago and I don’t really raid

[@EyrhilVimaxthri]

@@GothKiitsune If you mean you're confused about Fetzel's comment above you, that's because he wrote it after it was announced that TP would be removed from the game in 5.0. Also, a lot of the song's lyrics are specific to just that fight, so don't worry about being confused. Thanks for watching and congrats on hitting max level :)

[@teejay818]

Dragoons don't get weakness, they get carrying exhaustion.

[@teejay818]

Great job Eyrhil!!! Instant classic :)

[@Yoji75]

sooooo.... when is the next song o.o

[@EyrhilVimaxthri]

Haha, I have two semi-abandoned projects that I will try to revisit. If I can't make them work, the next song is going to be approximately a month after inspiration strikes! :P

[@foxdash]

Still can't stop watching this, it's so damn catchy xD

[@jessicles23]

This is my new fave song ❤️

[@Zephyrnull]

Hah, no TP anymore boys!

[@deefour28]

i love the git gud hidden in there (check captions if u dont know what im talking about)

[@mr.reaper3093]

Tp isnt even a thing anymore and this is still great

[@Sarepean]

Amazing!

[@ordinaryguysgaming2655]

I'm so sad it took me this long to just discover these songs.

[@EyrhilVimaxthri]

Well better late than never! :D Thanks for enjoying them.

[@IzanagiTempest]

This song makes me cry I kinda miss tp tho it was a pain lol

[@Crabchann]

this song is so epic

[@etramoonsong592]

Fun fact, my gf has no idea what tp is because she started playing after the death of the tp bar.

[@sgbsflgbsf]

You are a surprisingly good singer :o

[@kazedan]

This is fucking amazing

[@EyrhilVimaxthri]

Thanks for the comment. Glad you liked it :)

[@genericasian]

This is hilarious! You win an internet :D

[@Lubbydubs]

you have the voice of a fucking angel my man

[@interstella57]

This is absolutely amazing! I gotta ask, did you do the harmony part and other backup vocals along with the main melody? :o

[@EyrhilVimaxthri]

Yes, I did all the vocals, recorded on my home computer. I'm really glad you liked it!

[@interstella57]

You're amazing. :o I'd love to do duets with someone like you. :o

[@EyrhilVimaxthri]

Send me an idea and a sample of your recording and I'll see what can work ^_^

[@yuriwolfvt]

2020: out of tp for the longest time

[@schneehase7834]

rly nice :D!!!

[@mattvermeil6662]

Awesome ! XD

[@rachaelsherry3593]

this is incredible it's as addictive as dangerous to go alone 😂

[@kiri92azel]

Oh I had forgotten to was a thing😂

[@dadoclear160]

Monk's life in A7S haha *pressing TP song macro* :p

[@roxxasthedemonslayer6935]

huh looks like TP changed a lot from XI -Gain tp In combat by landing blows (or getting hit) and was mainly used for Weapon Skills to hit hard and Form elemental Skilchains.... at the cost of ALL your TP for the one Skill.

[@7thdayfallout]

first for eyrhil smellz

[@Shalaca]

Sounds nice makes me curious what tp is

[@neophobicnyctophile8264]

All those abilities that don't use up MP used to use up TP, with very rare exception. Even Sprint used up TP....

[@neophobicnyctophile8264]

It was yellow

[@Shalaca]

Okay, I can understand why it was removed sounds interesting but deaths would be brutal.

[@neophobicnyctophile8264]

@@Shalaca It wasn't an issue and never really ran out... Unless you died.

[@darekun46]

Was it just my crowd making Bungholio jokes back when TP was a thing?

[@Kionu-]

What's the lyric at 1:19? "I wire stack tight"? Love the video, I can't stop watching it!

[@Kionu-]

Ahh, nvm, it's something like "high wire stacked high" - with 'high wire' being the debuff the boss gets on deaths. That makes a lot more sense.

[@EyrhilVimaxthri]

"Highwire's stacked high"... You can click "CC" to view the lyrics while watching =]

[@lorizanibackon]

there's "without MP" version too? XD

[@ReinGD]

Rip TP ;-;

[@deefour28]

by far the best parody. how long did this take to make. also if anyone cares to answer, whats so hard about A7S. i joined this patch so only savage i have experienced is A9S

[@Riyshn]

deefour28 A lot of semi-random elements that required everyone to react correctly at a second's notice, high party damage (each raidwide blast put a lightning vuln on everyone, stacking up to 2 times), superbeam (Sizzlebeam on random DPS while having 2 stacks of vuln, which also then applies a DoT with the vuln snapshotted), and a no-mercy mechanic (if anyone died for any reason, he got a permanent stacking damage up buff).

[@deefour28]

Nicholas Warren jesus christ

[@SyncOnari]

Anyone who hasn't been in AS7 won't get this.. ;;

[@Gandalf_the_White]

What's TP lol

[@The-Nomad1]

fucking great but uh... ever heard of invigorate :p

[@EyrhilVimaxthri]

It's on cooldown :( Thanks for the comment! :)

[@dieCG]

And the song you covered for a rewrite of the cover is... ?

[@ThatFreikugel]

LOL

[@RagDollEyes]

Great song but Invigorate? x3

[@MimiriaRuu]

Nico Cox it's on cool down ❤️

[@somaz.9294]

F TP

[@HyouVizer]

5.0: what's that?

[@HyouVizer]

"this song is the best, also *Arrow* " >:P

[@EyrhilVimaxthri]

Lol, we had no Astro in our group at the time, but maybe we should've had one ;)

[@Malexan06]

that voice