Was Starship’s Stage Zero a Bad Pad?

[@HammerOn-bu7gx]

Just a point of clarification: The flame deflectors of launch pad 39A and 39B, during the Saturn and Shuttle eras, were steel frames covered in concrete. At least during a Saturn launch, approximately one foot of the concrete was ablated off of it. Also, the one shown in your graphic at about the 6:18 point is for the Ariane pad in French Guiana. It is a one sided deflector. The Saturn deflector split the exhaust to two sides. Also, the flame trenches were initially lined with ceramic fire bricks to protect the underlying concrete. I don't know if that has been replaced by refractory concrete or some combination.

[@JoshyCC]

"spit into two sides" I'm thinking that looked like an inverted aerospike?

[@andarkelorin8797]

​@@JoshyCC Effectively, yes. A linear AeroSpike anyway.

[@blindsniper35]

Thank you for the extra information on the flame deflector designs.

[@TheBleggh]

Actually, to correct your correction: The graphic at 6:18 is indeed LC-39B, and not the Ariane V pad. One of the SLS mods was to make the flame deflector one-sided.

[@TheDemocrab]

@repentandbelieveinJesusChrist9 I'll continue seeking retribution for all of the children victimised by the church before anything else kthx.

[@UrFavSoundTech]

Another big reason why 39 was so monstrous was that NASA was tired of building custom pads for each rocket. KSC is littered with single use pads.

[@MrGlobalSuccess]

Kerbal Space Center is littered with a whole lot more than just single use pads

[@thithi8793]

ok

[@vejet]

@@MrGlobalSuccess Like what?

[@Eureka092]

@@vejet dead kerbals

[@Catladybug]

Cant they take apart the old pads and build for new pad

[@petem6503]

I was part of the team that re-furbed the test stand at Edwards after Challenger failed. The mechanical systems to provide the water for cooling are impressive. The diverter there was hollow, with tens of thousands of holes in the "hot side" to shield the diverter surface from the flame with a "fog" discharge of water through the surface. The criteria was 5 million gallons of water, delivered in something like 3~5 minutes. The pump houses (there were two) had about 20,000 HP of pumps. The water into the diverter was carried in two 48" pipes. One of our guys took videos of the "dry run" (no flame) test of the water system. The audio can be heard "shut it down, shut it down!!!" once someone realized that without the flame, the water flew downhill into the sloped desert...right toward the tiny berg of Boron, CA. The "fishtail" bottom end of the diverter caused the water to jump right over the drainage canal that was supposed to carry off excess water. It was a fun project. Almost forgot to mention: we didn't determine the criteria for water flow, etc., but we were instructed that no material available (late 80's) could withstand the rocket blast, so the water protected the gantry, diverter, etc. When I saw the damage to the impact area of the flame, I wondered if the real problem was a mechanical one: not enough water? Pump fail?

[@sanjaymishra7892]

Great

[@PhysicsGamer]

For perspective, that gives a flow rate of around 8,000-30000 gallons per second over that time period. At the low end, if it were a river it would be around the 32nd most powerful river on the entire planet. At the high end, it would be the _eighth!_

[@petem6503]

@@PhysicsGamer The 5 mil gal criteria included a big safety factor, and as I recall the motor sections (Saturn V?) came in 3 minute and 5 minute versions (?), so the amount of water varied with the test.

[@PhysicsGamer]

@@petem6503 Makes sense. Still an enormous amount of water - more than enough to carry a house away under the right circumstances!

[@petem6503]

@@PhysicsGamer That's why the crew was trying to shut down the pumps: save the houses. The bar's? Not so much.

[@voicetest6019]

This brings me back to a retort of the "Mechanical Engineers build weapons, Civil Engineers build targets" joke from my uni physics days: Civil Engineers build cities, Mechanical Engineers build headaches for Civil Engineers.

[@jameswilson5165]

And politicians bedevil them both.

[@zagreus5773]

@@jameswilson5165 *architects

[@Greatdome99]

Mechanical engineers make things that move; Civil engineers make things that shouldn't move.

[@RC-fp1tl]

@@zagreus5773 both politicians and architects

[@Shadowmanchronicles]

And us electrical engineer does lines of coke!

[@saltyroe3179]

My dad worked on the designs of the launch pads and launchers for the Atlas missile. The issue of making reusable launch pads led to concrete turn buckets with refractor brick lining. Water flooding was developed latter by NASA at Cape Canaveral. The cost of a fleet of Atlas missiles pads that would be used once against the USSR led to the coffin launcher. This launcher had the missile horizontal until fueled, then erected to vertical for launch. The launcher was surrounded by a wall mostly to keep things out while waiting for years for a launch order that never came. If launched, the Atlas would destroy the launcher and surrounding wall. When the US went to silos for ICBMs there were extensive systems to direct the blast out the bottom of the silo and to vents outside the silo tube. This was intended to prevent the missile from destroying itself before leaving the silo. Over at the Soviet Cosmodrome the solution was brutally simple: dig a deep hole in the ground, canterleaver a platform over the hole, put rocket on platform. When the rocket took off the blast went into the hole and the effect on dirt in the bottom wasn't an issue. Of course you cannot (as you pointed) out, economicly dig a giant hole at Cape Canaveral (Kennedy) or Boca Chica. I cannot imagine that SpaceX didn't know that they had built an expendable launch pad. The question is do they want to pay for a reusable pad? It might be cheaper to build an expendable pad for each launch, just like the Atlas coffin launcher.

[@sysbofh]

They did know. This version (the concrete one) was to be substituted by a new one. The hardware was already there, but they thought it would withstand one launching. And so, decided to go ahead to save time (as it would take about 2 months to install everything). They were wrong. But this was the idea: do one launch with the old pad, change it to the new deluge system, launch the second rocket.

[@randomperson1731]

While it could be cheaper, they wouldn't want to use an expendable pad anyway because they need to launch within a couple of days at most for in-orbit refilling. These repairs are taking far too long for that to be feasible.

[@eustatic3832]

They know that they would likely cause the extinction of the piping plover at boca chica

[@dancingdog2790]

@@eustatic3832 🤣

[@ArrakisMusicOfficial]

I would love to see a garage model of a flame diverter with a deluge system, I know you can do it Grady!

[@yan3073]

And also a rocket engine for realistic simulation!

[@gus473]

😂 Go for it, Grady! 🤣✌️😎

[@esarlls3]

Collaboration with Dustin @SmarterEveryDay ?

[@carazy123_]

@@esarlls3*Destin but that would be a sick collab

[@dancingdog2790]

NSF has an hour-long video that features a concrete test slab being attacked with a power washer; hilarity ensues.

[@eliljeho]

I know it's new, but it would be interesting to hear your perspective on the I95 collapse and repair before the final report is finalized, and apparently repaired. Maybe a topic for a short?

[@personzorz]

I mean it's probably hard to have an overpass not collapsed with a tanker burns under it

[@jimbarino2]

I am more interested in the plan to rebuild it. I saw that they are using lightweight fill and I was like, "Hey, I know about that!"

[@Noneofyourbusiness2000]

Is it really that interesting? Tanker catches on fire under an overpass. Overpass predictably collapses. They're going to use gravel to build up next to the overpass and pave a temporary road as they fix the overpass. The finished overpass takes five years to construct as it's PennDOT.

[@nicholashartzler2205]

​@@personzorz but jet fuel can't melt steel beams

[@RedsPC]

Road Guy Rob just released a video explaining how they plan to fix the video, if you wanna watch it. Basically they are building sort of a thin bridge in the middle for people to continue using the i95 and they will build half a bridge beside it, then switch to those being used and build the middle

[@timeimp]

Can we expect a "I built a small-scale Starship in my garage" clip? 😂

[@andreabuzzolan9807]

There's a guy that has made a solid rocket that self lend

[@charleschristner7123]

As long as you don't tell the wifey 😮

[@bc-guy852]

Epic comment!

[@MikeHarris1984]

Lol

[@willimnot]

Nasaspaceflight did this with a pressure washer

[@Darisiabgal7573]

The problem with boca chica site is its built on the rio grande flood plain. The sand is essentially delivered down the rio grande during historic floods that occurred before the two upsteam dams were built, falcon lake and lake amistad. Within the sand laid down since the last ice age when sea levels were lower is a spongey like material with organic material and bacteria trapped in an anoxic environment. While the surface may look firm, putting pressure on the surface can cause the sand to become more maleable. Now imagine, you have a set of rocket engines with their thrust vector pointing down at a sheet like structure laying over something that is hard agregate on top and spongey below. The ISP of the engine is in the 350 range which we multiply a 9.8 m/s for and exhaust velocity of Mach10. This does not reach the launch pad, but the rocket engines resonate and their wave functions create pulse waves that travel at hypersonic speed to the sheet of concrete. This is much like a sonicator used to clean off surface debris but a million times more powerful. The sheet itself begins to vibrate and the substrate below begins to undergo liquifaction. The pad is now free to vibrate, and because concrete is fairly weak under stretching it just breaks up. Because of the nature of the sand below this causes the substrate to give and the action of the Ve on the concrete itself scours it away. I am been to boca chica, i had the fortunate exoerience of sinking a car in that sand, Its not like other soils with tightening layers as you go down, its just goopy sand, often pitch black layers of bacteria laden sand. When they chose the site I pondered how they were going to stabilize the soil, just to build the equipment. They had problems with the soil in the begining because it was so wet and soft. They demonstrate some magical technique they use to dry things out. But look at boca chica, on any given day it looks dry and sand, until you get below the surface. The region has suffered from storm after storm, flood after flood. After hurricane allen, the main road up S. padre island was chopped into a dozen pieces, 8x8x8 blocks of granite were torn out nowhere to be found. There were tropical fish from the offshore island living in the large ponds that Allen created were the road used to be. This is the nature of boca chica, its not stable, over thousands of years it gets torn up and completely rebuilt, what looks like dry land today is just an illusion.

[@WhatIsThisVid]

They brought in loads of dirt and let it sit for years which stabilized the soil, then they took some of it away and built Starbase on top of it.

[@Darisiabgal7573]

@@WhatIsThisVid They tried to draw the water out by mixing drying agents, but its still in the flood plain of the riogrande and you can only get so much compaction of that type of substrate.

[@counterfit5]

The water deluge system was as much, if not more, for protection the pad from the incredible sound pressure rather than thermal protection. Saturn V nearly maxed out the possible sound pressure possible in 1atm of air

[@Amradar123]

It also was to protect the lower stage against sound waves from hitting it

[@BenState]

@@Amradar123 thats what he said.

[@Sappo7]

Given that there's a lot of suspicion that all those motor failures during the starship test launch were directly caused by that sonic damage, the new plate probably won't fix the problem either. They need a deluge or other acoustic solution just to keep acoustic effects from rattling the engines apart again.

[@807800]

@@Sappo7 That's just suspicion from internet commentators. There's a NASA doc [Acoustic loads generated by the propulsion system - NASA SP-8072] that stated in order to have an effective deluge to minimize the acoustic load from a big rocket, you would need to launch it on a large lake.

[@Hybridog]

One of the major components of Saturn V sound generation was infrasound. That is, sound below 20Hz that cannot be heard by human ears. The rocket produced a lot of super powerful infrasound that created enormous stress on the rocket stages above. It had to be accounted for in the design and they worked on ways or reducing it via pad/deluge design and some tweaking to the engines. Powerful infrasound can cause internal hemorrhaging in humans and shake buildings apart.

[@Zanthum]

NASA also used asbestos in the flame trench at 39a, I believe in the joints between the concrete slabs. I remember mesothelioma lawsuit ads talking about the flame trench specifically as a potential source of exposure.

[@Robert-cu9bm]

Asbestos is a very good material, it does things no other can do. Shame it gives cancer.

[@scythelord]

Meh. Asbestos is still used in applications where it is necessary.

[@Zanthum]

@@scythelord yes. I thought it would be an interesting inclusion to the engineering discussion, though I suppose it fits better in a materials or mechanical engineering discussion rather than a civil engineering discussion but the video was already starting to straddle that boundary.

[@tlskillman]

Thanks for the historical perspective. Seems like NASA was all over the launch pad issue from the start. I wish you had said more about the SpaceX water deluge plan. I couldn't tell how you felt about the odds of success.

[@snuffeldjuret]

he didn't say a single word about the ability to do the same thing in boca. They could not.

[@fakename287]

@@snuffeldjuret why not?

[@snuffeldjuret]

@@fakename287 they are not allowed to flood the area with that amount of water, due to environmental reasons.

[@JRBendixen]

Crazy Elon idea. May work in theory and surely fail in practise. Why on earth would anyone rely on pumps for this.

[@SpaceAdvocate]

@@snuffeldjuretThey are allowed to release an undefined amount of fresh water. Though it can't be contaminated. They wouldn't be releasing amounts anywhere near what a single cloud can do.

[@trooper5157]

Great to see content related to space travel and rocketry. So much of the channel (we've followed since the early days) relates to civil engineering for municipalities - its good to see some other areas of interest, like this, covered. Keep it up!

[@stargazer7644]

I usually find in video ads to be obnoxious and they get skipped immediately. But I found your Nebula ad well done and worth watching.

[@StephenGillie]

"Exciting to watch" reminds of cars which are "exciting to drive" in that you don't know if you'll arrive at your destination.

[@TheVonMatrices]

It's worth pointing out that one of the speculated reasons that there were so many engine failures that ultimately doomed the launch was because of debris from the launchpad striking the engines. So even without considering government regulations or neighbors, there is a strong reason for the company to build a more durable launchpad to protect the rocket itself.

[@MonkeyJedi99]

I watch Scott Manley, and from him I have learned things like RUD (Rapid Unscheduled Disassembly) and "Engine-Rich Exhaust".

[@steveaustin2686]

Per Musk, the first three engines to fail before liftoff, were not from debris strikes.

[@MonkeyJedi99]

@@steveaustin2686 And he always tells the truth! Such a free-speech absolutist!

[@steveaustin2686]

@@MonkeyJedi99 If he is telling the truth, then the Raptor 2 engines need further development. Which matches what SpaceX has said that the Raptor 2 engines will be replaced by Raptor 3 engines.

[@paulmoir4452]

If you think about it, the mass and flow coming from the base of the rocket, which is what destroyed the pad, should also have kept the pad from flowing back up towards the rocket. 1.8e6N * 33 engine / 9m rocket_base_area = something like 145 PSI force from 21 tonnes per second. Are you really throwing chunks of concrete against that successfully? I know there are nuances but you have to overcome the big picture which says, at least to me, "firmly no".

[@CSIStarbase]

HI Grady! I've been waiting for this video to come out for a while now. I knew there was no way you weren't going to cover this lol. This was a fantastic review, although I was a bit surprised you didn't go deeper into the actual failure mechanics I considered reaching out to you as I was working on my deep dive investigation to see if you may want to partner on this topic, but I figured you may be a bit too busy.

[@gadgetmerc]

Agreed. Mostly about how things are normally done. Very light on any details about stage 0. I was excited and expecting to hear him talk about the 5 seconds of pain that the pad took and his explanation on what would have happened under the pad. Even a practical example of what all of that pressure would do.

[@AhmedHassan-yc5fb]

I have seen a video from NSF or you recently (can't remember which one). They talked about the old pad construction. They deduced that the pad failed/cracked at unsupported points. This let the gased flow under the pad and lift the concrete everywhere. It is likely that Grady does not follow the community as close as we do and so does not have much awareness of the data collected by the various enthusiasts like RGV. I would also like to hear speculation/analysis about the usefulness/longivity of the new pad construction. Love your videos. Would be very cool if you collaborated.

[@CSIStarbase]

@@gadgetmerc I was hoping he would maybe have watched my episode about this and found some holes in my logic or things that I didn’t consider. Not trying to self promote, but that was genuinely something I considered as I was investigating this topic. “I have to be extremely thorough with this or Grady will completely shred my explanation lol” I’m a bit sad that he didn’t

[@CSIStarbase]

The biggest issue here was the failure of the pile cap, not the Fondag layer on top. It didn’t vaporize, but instead the sand underneath the pile cap was compressed and caused it to bend and eventually snap. Loads were not properly transferred to the CFA piles, and instead the pile cap was transferring loads into the subsoil layer which has close to zero bearing capacity under liquefaction conditions.

[@AhmedHassan-yc5fb]

@@CSIStarbase yup, that's the video that I meant. Great video btw. A shame Grady did not delve that deep into the analysis.

[@kirkpuppy]

At 8:45 "I think that the results came as a surprise to no one..." Elon stated that they did not expect the pad to be destroyed and would not have launched if they did. Showing NASA built flame trenches, implying that this is a solved problem is misleading. The flame trench at 39a frequently needed repairs and was reconfigured many times. Spacex static fired Starship at about the same thrust of a Saturn 5 and the pad only had minor damage. As far as this not being mentioned in the environmental PEA, that's not surprising since it wasn't anticipated. At 10:54 "..not to mention the public safety aspects of the showering debris." The debris particles that fell on Port Isabel have been tested at UCF. They found that it did not contain elements of the concrete and Fondag, just sand. At 11:-00 "The FAA has effectively grounded Starship..." The FAA has not grounded Starship. The launch license was for one launch. The mishap investigation is standard procedure. I was expecting so kind of analysis of how the pad failed.

[@steveaustin2686]

The OLM is pretty far from the ground, so is effectively a 360 degree flame trench. What SpaceX did was launch before installing the water deluge as parts of it were already being delivered to the site, before the 'orbital' test launch. And that Musk wants to avoid a diverter if at all possible. The Starship FAA license is for 5 years (until Apr 2028) and not for one launch. What the FAA did was ground the spacecraft until the investigation into the mishap is complete, which is what the FAA always does for mishaps.

[@kirkpuppy]

@@steveaustin2686 No it was just for the first flight. www.faa.gov/about/office_org/headquarters_offices/ast/licenses_permits/media/VOL_23-129_SpaceX_Starship-Super_Heavy_License_and_Orders_2023-04-14.pdf Under item "4. Authorization:" it states "For the first flight only, unless this license is modified to remove this term."

[@BurhanHalilov]

Thanks!

[@ChristianHerget]

Danke!

[@heaslyben]

Calling a rocket launch "thunderous" may be an understatement, but it is definitely a thunderstatement!

[@aldenconsolver3428]

that hurts LOL

[@nvelsen1975]

Here's your coat, door's over there.

[@Boodlemania]

I see what you did there.

[@cy-one]

So how're the kids?

[@Niskirin]

Out. Now.

[@crowlsyong]

5:41 I feel like a good little engineer- that was the first thing I wondered when you mentioned they used the dredged material as fill.

[@kindlin]

I was wondering how much soil overburden they used to help the settlement, which they later remove for the final construction. I bet it was 10-20ft of additional soil above what they needed, just to load the soil for the construction weight.

[@scratchbuiltdozer]

I went down to the launch pad a month ago and gathered up a bunch of concrete chunks from the launch. Super cool stuff and place to visit.

[@CocoaBeachLiving]

I'd be interested in a follow-up analysis of this after IFT3👍

[@Grichecth]

Would love a follow up to this now that the water cooled plate has performed excellent during the latest launch.

[@shanebusch8102]

Grady I know you won’t say it but I will. You are just as good if not even better than those old discovery and science channel shows and you’re definitely a billion times better than the shows they air now.

[@JoeOvercoat]

His voice is even better!

[@brooksbryant2478]

I’ve been hoping you would make this video since we first saw the aftermath of the launch!

[@billykuan]

There is an old NASA documentary that is all about the development of the eventual Saturn 5 launch pad. I watched it about 5 years ago, there was good information on flame diverting and water suppression systems and the mistakes along the way. I am surprised SpaceX didn't come close to following the lessons learned.

[@boblordylordyhowie]

Probably because they think they are smarter than NASA engineers. How many times have you heard kids tell us we wouldn't understand, they forget, we wrote the book.

[@stickiedmin6508]

@@boblordylordyhowie Absolutely. Thinking about the insane amounts of money they must have burned through, relearning lessons, duplicating mistakes and rediscovering problems that NASA and/or Roscosmos figured out *_decades ago_* is chilling. Too arrogant to acknowledge what came before, or to build on top of someone else's foundations, and trying to reinvent the wheel.

[@jackboot3946]

I suspect there are some design engineers at SpaceX who are smugly saying "Told ya so".

[@TheDrunkenMug]

It is quite frankly not surprising *- at all*

[@bensemusx]

SpaceX’s pad was capable of withstanding the Saturn V. They did a 50% thrust test and the pad withstood it. 50% thrust of the SuperHeavy booster is equal to the full thrust of the Saturn V. Based on the damage done they believed the pad could handle one launch of the rocket. They ended up being wrong but it doesn’t matter as they had updates for the pad ready to go.

[@emrehaymana8306]

that shot of cape canevaral at 4:24 looks so nice! the sky, the rainbow and the giant rocket! absolute perfect :D

[@LT1SWAPCOM]

I've been waiting for this from you...

[@jwstocker1979]

Fondag is a really interesting product. My family owns a ready mix concrete company that services an aluminum smelting plant. Every so often the floors in the furnaces are replaced and they will use Bulk Fondag for the concrete. The laborers and finishers that are working it will sometimes have to vibrate around their feet when they want to move to a new work position.

[@UncleKennysPlace]

Certainly some info on the mode of failure would be nice.

[@Sonny_McMacsson]

Disintegration caused by high winds.

[@timwildauer5063]

@@Sonny_McMacsson Disintegration was expected, but that didn’t eat through many feet of concrete and rebar. The concrete actually snapped in half under the load, and that allowed the “high winds” to eat through the soft sand underneath. Disintegration would have been acceptable, and even expected, but snapping in half was unexpected and thus not included in the assessment.

[@moonasha]

@@timwildauer5063 that sounds about right. I seriously doubt spaceX would have gone ahead with the launch if they expected a catastrophic failure like this. Whatever they were expecting, it was probably much more tame

[@ericlotze7724]

@@timwildauer5063 doesn’t concrete have an expected maximum load…

[@noconsent]

So many engines failed it did not have the delta to make it to space nor orbit. They lost control of the biggest rocket ever launched, and it was trying to point back to earth. Thankfully it is just a giant metal tube with no real structural support, so even after the flight termination system failed, the rocket as able to fall apart in the air, instead of turning into a missile headed for Mexico/Texas. Or do you mean the mode of failure for the launch pad? That was caused by pointing rocket engines at concrete and just assuming nothing will go wrong. Like all companies that employ "move fast, break things, go bankrupt" culture.

[@thejll]

Digging in the sand near sea-side was an evocative image!

[@pavlovic317]

I have watched many videos about this launch yet I still learned several things from your video that no one else mentioned. Thank you for providing well researched content

[@timothydonlan9112]

Why does the whole SpaceX thing make me think of Salvage 1? Anyway, thank you Grady! Your channel is one of my favorite. You keep me hopeful there are more good engineers.

[@dsdsspp7130]

there is an important mistake at 0:50 the flight termination system was triggered but didn't succeed in terminating the flight. you can see clearly from the footage, the explosion started from the engines which means it wasn't caused by the FTS. you can also see in the footage that before the main explosion the FTS was triggered and caused a small explosion but didn't succeed in causing the whole rocket to explode.

[@randomperson1731]

I think the leading theory is that the FTS depressurized the vehicle to the point that it structurally failed, leading to it exploding.

[@kindlin]

@@randomperson1731 Also once it started getting into the very thin, but more than a vacuum, atmosphere.

[@BrandonBigB956]

I wonder how many of those engines that failed to ignite or failed early did so due to damage done to them by the launch pad blowing apart.

[@roberthaston459]

As it was explained to me on a tour (I also flew over the pads often). The flame trench originally didn't have a water deluge and it shot fire brick far away. In May 2008 (STS 124) 3,500 19 pound fire bricks from the wall were shot out at up to 680 mph, 1,800 feet away.

[@Lemonickous]

Awesome video man

[@Verrisin]

You have not mentioned the most interesting part. - They said the problem is because the *soil* below the concrete slab compressed, and thus the concrete _snapped_ and flames got through it. It would have been much less violent, if the concrete ablated as it was supposed to. - I was hoping for analysis of that.

[@Verrisin]

Many of your videos are highly technical and informative, yet this felt like _no more_ than what any media outlet reported on.

[@mikeg0802]

Thank you Grady for another awesome video!

[@pz7510]

thanks for this, I thought the design of the pad and all the collateral damage caused by the debris being scattered was the more interesting part of the event

[@ITSupport-fj6pf]

Now after 2nd launch, without this damage, i really wish a follow-up video explaining how the stage 0 is intact with newly designed water system

[@weekiely1233]

Granted that plate was already going to be used for flight 2. It wasn’t an afterthought

[@laserfloyd]

I hadn't been following Starship much the past few months due to work and life and such. When I watched the launch my first thought was "Uh, where's the flame diverter? Water deluge??" Yeah, no one is surprised that happened. I am still skeptical about a large steel plate firing water directly up at the bottom of the 33 Raptor engines. It should be exciting to watch either way but I'm not sold on it working. ;)

[@dsdy1205]

10:13 It is worth mentioning that the assessment DOES include the case of the entire rocket detonating on the pad, which is going to be significantly more severe in terms of debris and blast damage, and for which the exclusion ranges, etc are already budgeted accordingly. It may be the case that both or either parties felt this was sufficiently broad to cover for lower energy events, which this event undoubtedly was.

[@MurderWho]

On the other hand, entire detonation should be very rare, at least something they want to avoid for their own concerns. But the demolition of the launchpad will happen on every rocket launch of this scale, even fully successful ones.

[@dsdy1205]

@chickiew3039 not really an issue, since this launch license was for one test. Undoubtedly futther licensing will probably require they don't shower Boca Chica with sand every launch

[@anthonypelchat]

@@MurderWho The demolition of the launchpad was not planned nor was it expected to happen. It was planned to be heavily damaged, but not demolished like it was. And they have already moved past that with greater reinforcement, steel plates, and a better water deluge system. So the pad demolition should be extremely rare as well. Hopefully it won't ever happen again.

[@baystated]

Every time Grady said "launchpad", my brain finished with "McQuack".

[@YourArmsGone]

One of my biggest concerns with the Starship pad is how close the fuel farm is. We saw several tanks damaged by the last launch which could easily have resulted in an explosion and even more damage. So far I haven't see SpaceX address this issue.

[@snuffeldjuret]

there is not much fuel left in them when it is all in the rocket.

[@robijenik9872]

So wise! That’s why we should accept that fuel tanks getting sprayed with concrete chunks is an acceptable downside :)

[@snuffeldjuret]

@@robijenik9872 it is not a planned feature

[@nightonfir3]

The tanks are mostly empty after launch and the fuel is methane which is not particularly explosive.

[@xovvo3950]

And they won't, until that design loses them money (like in a launch-site disaster).

[@lasinthas4152]

And this is the first I’m learning of the water deluge system. I love this channel!!!

[@MathiasSchmidt-w8o]

12:01 "They’re betting it will pay off to develop fast instead of ." - (my underline) - In the middle of a wet lands preserve and not far from residential structures.

[@Archangelm127]

*SO* many Kerbal Space Program flashbacks...

[@dichebach]

The wildlife around Boca Chica are not quite so chipper I think.

[@planetsec9]

I think the hurricane that hit 2 days later was a bigger deal for them

[@dsdsspp7130]

@@planetsec9 not really, the chemical damage caused by toxic concrete dust is a bigger deal, not just for the wild life, but also for the people in the area. your organs and other animals' organs have evolved to deal with sand, not concrete.

[@filip9564]

Who cares? Like really who even cares? Its a small part of some very common animals and plants, it dosent matter if it gets destroyes.

[@AnvilDragon]

Concrete can handle pressure, special concretes handle high thermal loads, but concrete is a poor choice against sound energy. Reflecting world record sound energy back at your rocket with a flat plate should have "ACME" printed on it somewhere. The rocket plume helps and both the water mass and steam will help more, but it seems foolish to not deflect a large portion of that energy away from the rocket. It would seem unlikely that they will launch without damaging engines and equipment until they do. As noted even with the SLS launch system, flat surfaces reflect sound and that reflected sound will destroy things it is focused on. This system too has some work required to prevent sound damage.

[@braddie77]

Steam = Cushion of air buffer?

[@AnvilDragon]

@@braddie77 not the best wording but both the liquid and gas water mass. Think of it as making the local air harder to shake.

[@braddie77]

@@AnvilDragon i'd had a few beers when I asked, so my vocabulary was limited, but wanted to ask if there would be a reduction in sound pressure due to the intense heat forcing the surrounding air, heat and sound toward cooler air when water is converted to steam?

[@AnvilDragon]

@@braddie77 Not quite, but changes in density and viscosity tend to act a bit like layers with a portion of the sound reflecting and interfearing with the main pressure waves. Density and viscosity does vary with air temperature but adding steam, water droplets, and streams of water are much larger changes. Once bouncing off that steel plate the sound will have to reflect back through the exhaust to the rocket. If they record the combustion pressure near the injectors though a decent spectrum they could filter out and "hear" the flat surface. They could play back both the change in pitch and decay of that reflected sound as it lifts (Just not the sound levels).

[@doobiedoo5450]

Thanks for the video. Really like most of the content. The music at the end might be enough to make me avoid it because of the music. I like to watch these types of videos when im falling asleep and the music might wake me up.

[@notabene9630]

love your videos and thank you for mixing the music in this one !

[@GeofreySanders]

"Rapid development cycles" means "don't ask for permission".

[@jaelwyn]

And if you want to succeed at having _more_ rapid development cycles, you need to slow down enough that "having to ask for forgiveness" isn't a problem. Because you aren't going to get it.

[@jdotoz]

Which is all well and good until you come to a place where you really ought to have asked permission.

[@filip9564]

​@@jdotozthey asked permission...

[@jdotoz]

@@filip9564 Great. The point stands.

[@captiannemo1587]

Another thing to consider is the Pad39 diverter was designed with bigger rockets in mind…

[@rh906]

Almost like people figured this problem already and someone was just cheap...

[@crackedemerald4930]

Bigger than starship? Isn't it like the biggest rocket?

[@jamesm6830]

@@crackedemerald4930 Pad 39 was designed for the Saturn 5 rocket in the 1960s - not Starship. OP was probably saying how this was a solved problem 60 years ago.

[@christianweagle6253]

NASA had plans for a follow-on rocket even bigger than the Saturn V.

[@steveaustin2686]

@@jamesm6830 Reportedly the LC-39 pads were designed for rockets roughly twice the size of the Saturn-V. So for a rocket roughly the size of Starship.

[@TwitchyMofo]

Was hoping for a deeper dive on the failure mode. SpaceX thinks the sand compressed and cracked the concrete. Do you agree with that? Is there a potential way to do this without water? Just seems there's a lot more to be said on this topic.

[@beamed5382]

The current steel plate will use water. And yeah, this video was just absolutely useless.

[@SuperCuriousFox]

​@@beamed5382 Well, perhaps it's useful to people who have never heard about launchpad construction. I don't really get the timing of releasing this video now though. It would have made more sense to do so like a month ago, or wait longer until there is actual info from the FAA about environmental impacts.

[@Czeckie]

this video is uncharacteristically shallow for this channel

[@filip9564]

This video seemed extreamly rushed. He just jumped on the "elon bad" train and put together a half assed video and hoped most people would agree because elon is unpopular

[@IAlwaysWantedToTryThat]

The crawlerway wasn't built using the stones from the site itself though, they used river rock from the Tennessee River since it has almost no flint in it so when the rocks are crushed by loads they don't pose any additional fire risk to loads with chemical fuel onboard like SRBs.

[@rednammoc]

You're talking about the crawlerway surface, whereas there's also everything else below grade to consider.

[@johann-space]

Yes! Been waiting for this video!! So interesting.

[@DavidHRyall]

Good summary, but would have been worth mentioning that the engines blasted the pad longer than expected due to engine outage. And also the sand underneath collapsed under the pressure impact, causing the concrete to fracture Would have also been worth discussing their solutions for reinforcing the substructure (not just the installation of the water deluge) so that the concrete can't fracture under pressure again

[@markrichardson2508]

Dam I thought you might’ve talked more about the science behind how it was probably the foundation that really failed and that the concrete they used probably would have survived a lot better if the slab didn’t crack.

[@Real28]

The fact that Starship cartwheeled in the atmosphere, still under power, multiple times without breaking apart is as insane ad what it did to Stage 0.

[@vylbird8014]

Except that should have triggered the flight termination system. It failed at failing.

[@redditreviews9698]

@@vylbird8014 it did trigger it just failed. You can see it in the live stream

[@vylbird8014]

@@redditreviews9698 That isn't any better.

[@redditreviews9698]

@@vylbird8014 no not really but it did trigger.

[@boldCactuslad]

Isn't the popular contention that the flight termination system failed entirely and the later detonation was purely coincidental?

[@c4feg4r44]

are you planning to take a look at the ocean gate titan sinking once more information comes out?

[@MD.ImNoScientician]

Great Reporting once again Grady 👍

[@TrystyKat]

Move fast and break things is fine when there are no externalities, but when you're launching rockets on this scale, there are a _lot_ of externalities

[@JasonOvalles]

Yeah, Grady says "we get to follow along" but it feels more like "we have to live with the consequences of their mistakes."

[@Exarian]

"move fast and break things" "yeah for instance, my fist is about to move fast and break your face if you set my back yard on fire again."

[@jackieknits61]

The externalities were not well addressed by NASA, and they actually gave it a moments thought. SpaceX only thought about externalities as something to make sure it won't slow them down or cost SpaceX. Not a good business model. Billionaires get all the glory and profits, taxpayers pay the bill. Its not that interesting.

[@thursdaythought7201]

"move fast and break things" isn't meant to be taken literally haha

[@andrewahern3730]

@@thursdaythought7201it absolutely is. It’s jackasses applying software development logic to everything

[@pierredelecto7069]

Will be neat to see how the next pad works out. Fun watching rocket launches!

[@Old_Ladies]

I am betting that it will fail as well.

[@designtechdk]

Fun watching Elon Musk destroying nature.

[@Naturallystated]

Instead of dented towers, expect them to be shredded this time!

[@dualtronix4438]

@@Old_Ladies I'm betting on supersonic metal shrapnel flying everywhere

[@lordhoden]

@@designtechdk it is

[@zoltankurti]

Actually the damage to the pad was surprising. The half thrust static fire left next to no damage on the concrete. The static fire earlier that did damage the concrete was even less powerful than half thrust, but it was done before the FONDAG concrete was used. The last static fire of the booster mentioned in the video used the upgraded concrete and caused minimal damage.

[@zam6877]

I am grateful for your more sober approach Rockets and space exploration in general can stir up a lot of emotions

[@bryandensley6220]

Love this, would love to see more space related engineering videos from you

[@bc-guy852]

Grady you've got an amazing channel - congratulations. You're one of the few creators who has NOT put your hard-earned KZbin plaques for subscriber achievement in the background of your video. Why? I think you SHOULD brag about your achievements - we all love you - and that bookshelf is just ASKING for some company! Put up your plaques Grady!

[@scottbrower9052]

What did they think was gonna happen?

[@zyeborm]

Ablation and spalling like had happened in their sub scale testing. I think they may well have gotten away with it had all the engines lit. The takeoff was much much slower without the 3 that failed at the moment of ignition. The other two that failed a bit later made it worse. But if they had them all out would have well cleared the tower by the time the debris started flying out in the attempt they had.

[@BradleyG01]

one small correction, when Elon said it went about as expected, he meant the rocket launch itself, not the launch pad. He stated on twitter that they did not anticipate the severity of the destruction of the launch pad.

[@KevinBalch-dt8ot]

I seen studies of the depth of jet impingement into pools of water (it’s apparently of interest in steel production) and if they extrapolate to the scale of a Starship launch, the rocket exhaust should penetrate a depth of about 2 meters. It looks like the penetration depth is a function of the exhaust velocity to a power between 1-2. All the artists conceptions of how the inverted shower head should work only show a thin film of water which I think would get blown away. Further, if the exhaust is able to convert the water under the plate to steam, it will provide significant resistance to sustaining the water flow and possible water-hammer effects. Each Raptor rocket engine puts out a power output equivalent to the thermal power of over two large nuclear reactors. And there are 33 engines powering the first stage.

[@nerezza5505]

From my understanding its less a thin film and a constant wall of water being sprayed out with enough pressure to counteract the rocket exhaust. Theyve already tested this small scale kzbin.info/www/bejne/pJCvZGCPmpJ2sJI

[@ianjanusz4109]

Omg this is amazing. Please more space content!!!

[@Stealth86651]

Yes, clearly, unless the pads goal was to destroy things and burn money. You can say you did it to "learn" all you want, but no one wants to deal with this cleanup and rebuilding something you didn't have to destroy.

[@beamed5382]

The rebuid is close to being finished and I don't think Elon is crying about 100k worth of concrete.

[@reverse_engineered]

@@beamed5382 It's definitely not only $100k worth of damage. Hell, a couple of guys just figuring out what all got damaged will cost more than $100k. Not to mention that Elon might only be thinking about how much his launchpad cost, but the rest of us have to think about everything else he destroyed in the area, and how much worse it could have been. Elon only thinks about his billions of dollars, but there are also billions of us out here who have to live with the consequences of his brash decisions.

[@barefootalien]

What I think... is that the creators of Nebula are so focused on their negative experiences with the algorithm, that they don't realize that for _viewers,_ the algorithm can be extremely helpful and positive as well! Sure, there are some downsides to it, especially when it caters too much to advertisers and serves as silent censorship... but it also connects us to new creators and new videos, learns what we enjoy watching and lets us discover more in similar spaces, and makes it easy to fall down fun (and lucrative) rabbit-holes. Most of all, whenever I'm on Nebula (I have had a subscription since basically the moment it launched, because I was already watching most of the co-founders' channels), I _really_ miss the _engagement_ KZbin offers, with comments to interact with both the creator and other members of the community. I love the _idea_ of Nebula, but it has a long way to go to be the "best possible viewing experience". I'm sure it competes very favorably with basic, free KZbin, with $2.50 a month to get rid of ads... but I have a family KZbin Premium account that works out to only about $3.60 a month for each member of my household, which _also_ gets rid of all ads, both pre-roll and interruptive, and those annoying pop-up ads, _and_ gives me the community engagement and the help of the algorithm to boot. As a newish member of the Nebula team, maybe you can help nudge them in the direction of at least seeking some form of parity with KZbin's polish as a platform. I'd love to be able to just watch my favorite creators on Nebula, but it's just too clunky to be enjoyable, and I don't feel like the creators understand that, or acknowledge it, let alone plan to improve it. To be clear, the _content_ isn't the problem. It's the interface. I'll stay subscribed, because I _do_ want to support you guys, but for now, at least, I'm almost always going to actually watch your videos on KZbin, even if I have to wait, even if I have to listen to sponsorship ad reads, and even if I miss out on "bonus content". That's just how I feel.

[@alexb2997]

☝ I'm in a similar position with Nebula - very happy to support the creators and the enterprise, but I almost always prefer watching on YT for the same reasons you give. +1

[@TimBryan]

This makes a lot of sense to me. While I'm inclined to subscribe to Nebular because I have a great respect for the creators involved with it, YT just has a lot that I really like.The comments are probably one of my favorite, and there's simply way more people who would comment on a YT video than on a Nebula video. I pay for KZbin Premium, and my least favorite thing about the offline videos is that they don't include the comments.

[@annoloki]

Absolutely agree, both on the algorithm - a very useful tool for those who know how to use it - and on the lack of comments with Nebula. It feels like a very lonely site, with no sign of anybody else watching the same thing. I bet comments would be pretty good too, being a paid site, you'd get a lot less of the riff-raff and trolling you can get on YT. I barely use Nebula TBH unless I'm reminded of it or remember to go watch it for the full version etc. I mean, totally missing out on such a meta experience as this, commenting on the commenting of not commenting on the same videos in the place where you can't comment from the place where you can haha

[@heidi5942]

As a subscriber to Nebula and YT premium, you have touched on what I've been thinking. I want to use Nebula but the lack of interaction is what keeps me coming back to YT.

[@economicprisoner]

@@annoloki Elon's $8 Blue checks prove that paying money does not get rid of the riff-raff.

[@screetchycello]

If you've never been to a rocket launch, you totally should. You can literally feel the sound / pressure wave from launch from several miles away. It's amazing.

[@stepheneyles2198]

Nice suggestion, but probably not a practical option for (maybe) 95% of the world's population!

[@jaelwyn]

I got to attend the launch of STS-134 (a bucket list item for me since I was a kid), and it truly gives one perspective on the literal meaning of "awesome", as in "awe-inspiring". Or to steal some lines from Rush's 'Countdown": "A thunderous roar shakes the air, like the whole world exploding […] It tears away with a mighty roar, the air is shaft by that awesome sound."

[@kindlin]

@@stepheneyles2198 Vacations are not an option for 95% of the worlds population? I think that might be a bit of an exaggeration.

[@Tishers]

Since Starship is (in theory) supposed to take off from Mars and return to Earth on some future missions they would need to develop a launchpad structure on Mars that can tolerate some lesser degree of abuse (lesser, because the gravity is lower on Mars so a takeoff thrust might not need to be as great?). What if the pad was constructed out of several meters of ice that was reinforced with carbon fiber or high strength polymer rope? Sure, it would erode and vaporize and eat a hole through the ice but maybe that would increase the thrust from the expanding water in to steam below the ship. It might require some re-design of the base of the rocket to take that reflected blast upwards and not destroy something vital. Ice could even be used on Earth as something cheap and rebuildable. It might even be possible to take off cryogenic cooling from the oxidizer to drop the ice temperature very low (-50 to -100 C if it was covered with a thin insulating layer of foam.)

[@ShawFujikawa]

Much lesser, Starship will be capable of taking off under its own power on Mars without needing the booster stage. A basic concrete launchpad will be plenty sufficient for that. Go look up Martian concrete, that is the most likely building material they will use.

[@BoB-Dobbs_leaning-left]

"Was Starship’s Stage Zero a Bad Pad?" Well, I wouldn't want to live there.

[@kokobeans3339]

I have a chunk of a security camera from the destruction of the launchpad

[@veramae4098]

I've been a sci fi fan for as long as I can remember, and I'm 70. None of those early writers gave any thought to the launch pads. Oh, E.E. Smith wrote about the spherical ships being so heavy they'd sink 1/3 deep into the ground, and the land was scorched. That was about it. Over the years I've been sort of compiling a list of what sci fi missed. Completely missed computers until they were already being developed, for example. None wrote about problems adjusting to zero gravity or reduced gravity, again, until that was already discovered. On the other hand, it's interesting to see what they "forecast", metaphorically. Heinlein's been pretty much on track in his "future history". We haven't settled other planets or discovered a faster than light ship, but we've sent robots almost everywhere and the JWSpaceTelescope is showing us the universe. (He wrote almost all his stories with the same background.) It's been compiled -- and guess what? Near the end there's a pandemic, and then: the first human civilization. Gives me hope.

[@kenbrown2808]

interesting thing to study. it would be interesting to see a full overview. (not being 70, I have a few obligations that keep me from doing such a thing myself, right now. and if the past is any indication I won't when I'm over 70, as well.)

[@KnugLidi]

Heinlein had Point to Point suborbital flights, space elevators, faster than light travel, and had dozens of off-world colonies in 'Friday'. Not to mention super human geneticaly engineered people. He was a sci-fi writer after all. His 'Future history' collection of loosely interconnected short stories was one way forward. Given current progress here in the early 21st century, I don't have a doubt that we will have one or more permanent settlements on Mars by the end of the 21st, let alone by the 23rd (the end of the 'future history' timeline) but I am quite certain that humanity will never leave this solar system. Our genetic material may leave and maybe we'll create some kind of generational ship with frozen embryos, but that would be far after the 23rd century. 30,000 years just to clear the Oort cloud at the speed of Voyager 1 ? I can't even imagine the amount of energy needed to accelerate a several thousand ton ship to those speeds.

[@seneca983]

One thing scifi missed is the internet and how we use it.

[@theendisoverdue]

You sound awful to talk to about sci-fi

[@zyeborm]

There's still essentially zero research that has been done on long term partial gravity. One Japanese study that last time I looked hasn't had the results published. All these plans for Mars colonies and we have not even got a mouse model for gestation.

[@crp5591]

There's a huge difference between "pushing limits" and outright engineering and environmental negligence.

[@Toefoo100]

Well SpaceX doesn't have the federal government to declare an wetland federal property like they did with the cape

[@Carewolf]

Yeah, if it was "performing as expected" as the notorious liar said, they are as a minimum guilty of intentional criminal neglect. If they are just not doing their job, it might just be accidental criminal neglect.

[@gnualmafuerte]

But there is not a huge difference between spreading FUD about Starship and being an ecoterrorist, a disgusting commie, enemy of the future of the human race.

[@marksadler4457]

Another excellent video - thanks, neighbor.

[@thomasott5899]

The water deluge provides sonic suppression which mitigates damage to the rocket and nearby structures. The test stand at NASA MSFC uses huge pumps for a water deluge, but I was told when they tested a Saturn V first stage that windows were damaged for miles around. The horizontal test stands for the Space Shuttle solid rocket booster didn’t use any suppression and a test firing would scour the ground probably a half mile away.

[@Rangerstorz]

Hey Grady, what are your thoughts on the feasability of that ''upside showerhead'' SpaceX plans to use to cool the rocket flame and prevent future disasters..? The water deluge system you talked about at Pad 39A/B uses roughly 1.7 million liters of water in little over 30 seconds and is gravity fed/operated. It is my understanding and opinion that SpaceX's system can never match the deluge systems of NASA despite having a bigger rocket.

[@snuffeldjuret]

they would not be allowed to spew out that much water at boca chica.

[@oohhboy-funhouse]

100% going to fail. When it happens again, I hope they get evicted and fined. They broke enough laws already.

[@DavidHRyall]

@@oohhboy-funhouse cry harder

[@beamed5382]

​@@oohhboy-funhousecry

[@rawhide_kobayashi]

@@oohhboy-funhouse the government has a vested interest in the success of starship, beyond using it as a lander for the artemis program lunacy to think that they would do anything of the sort

[@MWPdx]

SpaceX: psh, yeah we knew that would happen. EPA: Did you? SpaceX: Um....

[@blackoak4978]

The thing with the damage is that people have been calling out SpaceX about this since they first started building. Even the EM drones would comment on it, though they would finish with "but I'm sure they know what they're doing

[@snuffeldjuret]

"em drones" no need to devalue yourself with such language of course they know what they are doing, more than you and me.

[@Treviisolion]

@@snuffeldjuretSo they lied to regulators then, after they had already gotten in trouble with playing fast and loose with regulations? That’s not a good look for SpaceX.

[@TheGreatAtario]

@@snuffeldjuret So you're saying they intended to pepper the whole area with rocks?

[@snuffeldjuret]

@@TheGreatAtario why do you ask?

[@fakename287]

@@snuffeldjuret nice job avoiding the question lmao You say they know what they're doing, so did they purposefully shower the entire area with concrete debris and deliberately keep it out of their environmental report? If so, then why waste time and money on doing that and then having to redesign their launch pad?

[@i_Kruti]

seeing ROCKET stuffs on PRACTICAL ENGINEERING is 🤩🤩🤩🤩🤩..........!!!!!!

[@user-p-v]

That t-shirt is so back to 70 s, I was born then and as a very young boy I remember those stripes and colors.

[@kynetx]

So, the advantage of commercial spaceflight is that they ask for forgiveness instead of permission? Not sure what to think of that.

[@denysvlasenko1865]

I know what to think about it. I'm fuming every time I remember that Shuttle was (by accident) perfectly designed to keep spaceflight stagnating for TWO GENERATIONS. We lost 50 years!!! We could have rockets similar to Falcon-9 in 1980...

[@snuffeldjuret]

its the same in governmental.

[@Dysiode]

@@denysvlasenko1865 Show me how we could have fixed Hubble with anything from SpaceX and I'll agree

[@SpaceAdvocate]

They asked permission, and got permission.

[@jttech44]

Simple, it's gonna make space relatively cheap to access which will benefit the human race in ways that we likely can't even comprehend yet. Government failed to deliver on their promises of the space age, so the best thing they can do at this point is to get out of the way of people trying to realize those promises without them.

[@benhockley]

The concrete under the pad had been expected to ablate as it had during the static fires and in flame trenches, not disintegrate like it did. SpaceX had also been conducting tests at their MacGregor facility by firing raptors at concrete blocks, presumably to measure ablation and fragmentation. While plenty of people have be treating the outcome as obvious, their theory as to why it disintegrated didn't match the actual reasons - which has been given by SpaceX as to do with the ground underneath the concrete. The FAA should certainly issue updated requirements to ensure it doesn't happen again, but as with other issues like the FTS not working as expected, SpaceX is already working on it, such as adding a heap of new deep foundations under the pad.

[@masbestiaquetu]

Okay, elonstan

[@benhockley]

@@masbestiaquetu come on, at least have an argument. It's not like I had to dig for any of this, so if you think it's incorrect at least present a counter argument as to why.

[@masbestiaquetu]

@@benhockley you didn’t dig anything but starship sure dug a huge hole

[@benhockley]

@@masbestiaquetu I did look it up if that's what you mean, it's a generally accepted colloquialism. Though for your second point, I see you're also interested in facts. Did you know that the SpaceX CRS-7 mission failed when it exploded mid flight, and there were a lot of questions raised about the reliability of the Falcon 9 at the time? There was also the time that falcon 9 exploded during a static fire test. And F9R did a flip and blew up. And several failed falcon 9 landing attempts. Basically my point is I don't have a clue what your point actually is. It's like asking "Who launches a rocket in a protected wetlands", where the answer is "Everyone".

[@mouser58907]

Well, this was a bit disappointing. It seems like only a sentence or two in the whole video actually discuss the engineering of launch pad. It also feels like the video just cuts off without any real conclusion. Maybe this is a case of Betteridge's law. 10:08 / 10:30 - The PEA very extensively mentions the potential for debris through normal operations, anomalies, and even launch pad anomalies and sets the requirements for what must be done for each of them. I'm not sure how you could have missed that. The word debris is used 106 times in the PEA. 11:00 - Previously to the PEA there were multiple fires in the state park caused by static fires that were determined to actually be beneficial to the area. Because of this the mitigated FONSI didn't require any significant actions to prevent these from occurring. This one however was so small it did not spread. I'm not sure why it's noteworthy. I also think it should have been mentioned that this pad was only supposed to last one launch. It wasn't a CYA excuse by SpaceX, but the parts for the upgraded pad were already on site and being installed well before launch.

[@brussels13207]

Love these videos, regardless of subject. Please keep them coming, and I hope you earn good money for doing them.

[@mattmatt516]

I was waiting for your video on this from just moments after I watched the launch! I'd love more videos covering things like this, related to Space!

[@catcatcatcatcatcatcatcatcatca]

Funny how space-x seemingly went from reusable first stages to disposable launch-pads. I’m not sure if their commitment to re-discovering stuff NASA and apparently their own engineers knew beforehand is aligned with the idea of rapid development cycles. I respect your commitment to value-neutral, informative coverage. But to me it seems like the company was pursuing very thin savings in costs to engineer their own solution, discovered said solution to be insufficient under half the projected strain, but chose to not correct the clear issue before the launch. It seems like a very reckless decision made solely to meet a deadline, with full understanding that something “unexpected” will definitely happen. It’s hard to see their insurance company or the FAA using such novel definition for the word “unexpected”. I also can think only one person walking to the NASA launch site, pointing at a hugely complex set of equipment and saying “I bet those are entirely unnecessary, let’s build a lean, clean-sheet design”, and not being politely told to shut up, and entirely dismissed by the leading engineers working on the project. And that guy does not hold an engineering license, despite often implying or acting as if they did. This is not a website, you can’t just disable the “unnecessary microservices” and expect no consequences aside from self-inflicted financial losses. Someone could have died.

[@beamed5382]

The approach was due to time, not cost. With this kind of approach, SpaceX achieved, in many ways, more than NASA did in 17 years, 45 years counting engine development. That said, the problem wasn't the design approach itself, but the extreme mis-calculations/reading of the sand layers under the pad itself, leading to compression. A problem that will no longer be a problem with the new steel-plate, still not using a diverter or reuglar deluge.

[@Lashb1ade]

The question they were trying to ask was: "can you design a simpler launch pad for Mars/the Moon, - where there is no nice deluge system?"

[@f14uubercat]

Starbase is not a rocket launch site. It's a massive open air RnD Test Site. Space-X wanted to see if they could go really cheap, turns out that it's not as easy as thought. Still a successful test and there was useful data gathered from the test. Hell, I think even NASA was shocked by what they saw and are looking over the data because they didn't expect the concrete to fail as it did. But yeah, this is again a test site, if things fail here, then that's fine. All they really did was lose some time and money, but nothing irreplaceable.

[@davida3283]

@@beamed5382 by your logic no one learns from previous inventors, spacex doesn't need to re-do NASA's work they could simply learn from previous atempts eg: build a flame diverter which has worked for half a century without selfdestroying, it is not only the launchpad , is highly probable that chunks of concrete and pressure reflected back to cause damage to the rocket itself, all this was foreseen and obvious, but instead Musk decided to burn all that money a destroy the facility, the rocket and the enviroment for miles outside the complex which he doesn't care and obviously you don't either

[@noconsent]

@@beamed5382 NASA made it to orbit with it's large rockets. SpaceX has not. And it is completely predictable that this is the results. SpaceX has done nothing with this launch but contaminate protected wildlands SpaceX agreed not to contaminate.

[@M21assult]

I drove my semi onto the pad a few days ago delivering supplies to rebuild

[@pierredelecto7069]

Yup. They will be ready to launch again soon supposedly. Are they bringing in that steel plate?

[@littlehills]

and you still couldnt provide any useful information in this comment nice.

[@M21assult]

@@littlehills interaction to help his algorithm, not to feed your mind.

[@littlehills]

@@M21assult algorithm for a video that offered little in what could be done differently or condemn the poor planing and endangerment of stuff and life. shore. claiming u drive on the pad and didnt even offer a simple the holes not there no more sounds like ur comment baiting for internet points. anyway algorithm algorithm

[@zyeborm]

​@@littlehillswhat specifically was the danger to life? Were people inside the exclusion zone? Was there projectiles with lethal kinetic energy outside the zone?

[@alafrosty]

You completely missed the part about steam pressure below the pad, blowing up the pad! SpaceX, nor anyone, can get enough of a deluge system in place to mitigate the heat pumped into proximal ground water to prevent a repeat explosion. But the next time will feature metal shrapnel instead of "just" concrete. If the FAA allows a repeat, it's going to be ugly. Nobody should trust SpaceX's analysis on this, especially after, as you point out, SpaceX environmental risk assessment said nothing about the risk of a massive pad explosion, then Musk saying they knew it was a possibility. The move fast and break stuff approach does not work for space operations that move quickly through public spaces.

[@morganjohansen5097]

I’m so happy to see this on my feed!

[@johncampbell7433]

thank you for doing this topic!

[@steveschweitzer4181]

Yes yes sacrifice safety for speed… classic big business talking point.

[@zyeborm]

Who was injured here?

[@Toefoo100]

​@@zyeborma rock hit a beetle! Are you that heartless? We need to take down all of SpaceX to protect those beetles!

[@ultra-nationalistodst8085]

@@zyeborm Someone’s bound to if they keep this up

[@snuffeldjuret]

@@ultra-nationalistodst8085 many have died, but not working for SpaceX.