Wasn’t it KINDA About STATES’ RIGHTS?!?!?!?!?!?!?!

Episode 8 of Checkmate, Lincolnites! Debunking the Lost Cause myth that the South seceded because of states' rights.
Support Atun-Shei Films on Patreon ► / atunsheifilms
Leave a Tip via Paypal ► www.paypal.me/atunsheifilms
Buy Merch ► teespring.com/stores/atun-she...
Official Website ► www.atunsheifilms.com/
Original Music by Dillon DeRosa ► dillonderosa.com/
~REFERENCES~
[1] South Carolina General Assembly. “Debates Which Arose in the House of Representatives of South Carolina on the Constitution Framed for the United States” (1831). Printed by A. E. Miller, Page 19-32
[2] Isaac Makos. “Shays’ Rebellion” (2021). American Battlefield Trust www.battlefields.org/learn/ar...
[3] “The Federalist Number 45, 26 January 1788.” Founders Online, National Archives founders.archives.gov/documen...
[4] “From James Madison to Alexander Hamilton, 20 July 1788.” Founders Online, National Archives founders.archives.gov/documen...
[5] Robert E. Bonner. Mastering America: Southern Slaveholders and the Crisis of American Nationhood (2009). Cambridge University Press, Page 41-55
[6] Robert Pierce Forbes. The Missouri Compromise and Its Aftermath: Slavery and the Meaning of America (2007). University of North Carolina Press, Page 38-58
[7] Kathleen Thompson. “When Did Slavery Really End in the North?” (2017). Civil Discourse: A Civil War Era Blog civildiscourse-historyblog.com...
[8] Bonner, Page 58-61
[9] “Amendments Proposed in Congress by Senator John J. Crittenden” (1860). Avalon Project, Lillian Goldman Law Library avalon.law.yale.edu/19th_cent...
[10] Wilson Lumpkin, Wymberley Jones De Renne. The Removal of the Cherokee Indians From Georgia, Volume I (1907). Dodd, Mead & Company, Page 45-47
[11] Harold D. Moser, David R. Hoth, & George H. Hoemann. The Papers of Andrew Jackson, Volume IV, 1816-1820 (1994). University of Tennessee Press, Page 95
[12] Joshua A. Lynn. Preserving the White Man’s Republic: Jacksonian Democracy, Race, and the Transformation of American Conservatism (2019). University of Virginia Press, Page 2-14
[13] “President Andrew Jackson’s Message to Congress on ‘Indian Removal’” (1830). National Archives www.archives.gov/milestone-do...
[14] Lynn, Page 26-27
[15] Gerhard Peters & John T. Woolley. “Andrew Jackson, Seventh Annual Message Online.” The American Presidency Project www.presidency.ucsb.edu/node/...
[16] Bonner, Page 223-228
[17] George Fitzhugh. “The Revolutions of 1776 and 1861 Contrasted” (1863). Southern Literary Messenger #37 [Nov-Dec 1863], Page 718-722
[18] Bonner, Page 264-269
[19] James Henley Thornwell. The Collected Writings of James Henley Thornwell (1871-73). Presbyterian Committee of Publication, Page 551

[@AtunSheiFilms]

Stick around for the credits.

[@shanesiddall69]

@Russian Waifu no

[@jtgd]

Oooh, you’re marvel?

[@jumpkickman1993]

When is the next Frozen 50s man

[@operleutnant7235]

@Russian Waifu nah

[@jtgd]

@Russian Waifu northern aggression of not surrendering a military fort and being attacked?

[@SirWeirdGuy]

Of all the people that own both a nazi uniform and a confederate uniform I trust you the most

[@williamnewman8293]

That is a group that I hope is very small yet is likely larger then I imagine.

[@WildLastFrontier]

@@williamnewman8293 and hopefully populated mostly by historians... but we know it's not entirely 👀

[@sidresponsible1190]

Of all the people who own either of those uniforms (except maybe civil war reenactors ) hes the only one i trust

[@bigbubbles55]

only other guy I trust with a nazi uniform is Jreg

[@sidresponsible1190]

@@bigbubbles55 who is jreg

[@ulischmidt03]

you know what’s better than states rights, human rights.

[@mrbroskiiguess8828]

Literally solved every US political debate

[@DerSchleier]

Know what is greater than human rights? VERITAS! The U.S. War of Rights (Secession?) WAS about Federal rights versus state rights (ref: taxation control and import/export control). The South's economy was the fourth largest (read "richest") on Earth surpassed only by the three colonial empires (England, Spain, France). The Federal government sought to cash in on those riches by further taxing the South

[@user-et7gc9bl8z]

Human rights to loot, burn, commit crime and then play victim, yes, thank you UNION

[@flgroyp8961]

boooo

[@sup8857]

Well, that depends.

[@milkinobama8160]

Fun fact. The Wii U lasted longer than the confederacy

[@iPig]

The Wii U will rise again!

[@Sketch_Hero]

Wii U? More like Wii W

[@mastercrafter2252]

Also the annoying orange lasted longer than the confederacy

[@ADMICKEY]

And fortnite

[@accusedtoppat]

And me

[@LukeDwornikComedy]

"a bunch of trouble making free loaders" "they were white" "Brave rebels!" 😂😂😂😂😂😂😂😂😂😂😂 That killed me

[@Al-Rudigor]

The tree of liberty must be watered with the blood of patriots. 😂😂😂

[@emv005]

me too

[@nathanpetrich7309]

comedy gold 10/10

[@ramenbomberdeluxe4958]

I almost wonder...if the george floyd protests were done majority by white people and they were protesting the death of an innocent white man, would people have demonized it as much?

[@clairekholin6935]

To me it is less comedy, and more frighteningly accurate.

[@TouThoj07]

"Sounds like a bunch of trouble making freeloaders looking for a handout" "They were white" "Brave rebels.." LOL that was great

[@DekoyDuck]

kzbin.infoUgkxObkNlr_5jctkblTI__lU3AZLOuVS_yDl A perfect summary of American history discourse.

[@bird-war]

Yep, racism for ya

[@nobody8328]

I cackled so loudly my partner came to check on me! I had to rewind because I'd missed some 5 minutes gasping for breath 😆😂😆🤣😆😅

[@cuetoaa7074]

That made laugh harder than I have laughed in weeks!! 🤣🤣

[@valakktoo4145]

4:45

[@2Trundle]

“Slavery is gay because it means owning another man” - Abraham Lincoln, 1862

[@vogelvogeltje]

Totally. No words put in his nice warm mouth at all…

[@Eli_Guy]

A simple spell but quite unbreakable

[@anonbefallen4807]

@@vogelvogeltje pretty sure that was meant to be a joke

[@planaritytheory]

@@anonbefallen4807 pretty sure Vogel made a joke as well...

[@planetaryevolution4853]

Based

[@AddieHughesVT]

To quote a funny brocolli man "state's rights to do what?"

[@tonyjoestar2632]

Get Douglas'd

[@AshanBhatoa]

​@@tonyjoestar2632*Cue a version of Dixie.

[@achair7265]

@@AshanBhatoa Union Dixie.

[@skravats]

DOOBUS

[@jeffreygao3956]

State’s rights to utilize slave labor for profit.

[@yourdaysarenumbered3012]

Learning about Confederate leaders’ plans for if they won was really fucking grim

[@thatguy3421]

I have the strangest feeling that it would like what Hitler planned for Eastern Europe

[@Dreigonix]

“The First American Slave Empire” is a phrase so nightmarish I’m legit surprised there aren’t any alt-history video games about a group of heroes rising up to overthrow such a society Wolfenstein-style.

[@AD-dg3zz]

The closest video game example I can think of to this hypothetical society is Colombia from Bioshock Infinite, but the racism and neo-slavery was only a background issue in that story. So somebody really needs to make this game!

[@user-Kn3GB4wgTp9MYGA]

Wait until you find out the union's plans if the confederacy was won over by the union's proposition of the Corwin amendment in 1861.

[@drakep.5857]

​@@AD-dg3zzbioshock infinite is the world's greatest example of "great idea bad execution" I think wolfenstein 2 the new colossus is the greatest story we've had taking on this idea in a game yet imo, however I do think there's a game about alt right takeover that's alot more realistic and impactful, albeit in a more serious and hopeless way, being the hotline miami series, but yeah I fully agree that would be awesome if done right and not offensively

[@cybercrash7]

This video is the perfect embodiment of: When you don’t know anything about the Civil War, you think it was all about slavery. When you start to study the Civil War, you learn about a complex myriad of issues like states’ rights, the preservation of the Southern economy, and a defense of a way of life. When you’ve dug deep into the study of the Civil War, you realize it was all about slavery.

[@aralornwolf3140]

So... the uninformed position was correct, lol.

[@Spongebrain97]

@@aralornwolf3140 there's just more nuance. Slavery was indeed the primary cause of the civil war and while there were other issues like tariffs, they are all still tied to slavery. Instead of different issues sitting together side by side in equal importance, it's more like slavery is the big bubble on top which trickles down to the smaller bubbles. However the uninformed position tries to water down slavery as the primary cause even though almost every hot button issue in the early to the mid 1800s was centered around slavery. 3/5 Compromise, Missouri Compromise, Compromise of 1850, Kansas Nebraska Act, Fugitive Slave Act, Dred Scott Case, Bleeding Kansas etc.

[@goldenageofdinosaurs7192]

Lol, well said, sir..

[@iamthewizardwhoknocks2845]

@@Spongebrain97 The reason the South left the union and the reason the north went to war with them are different. Leaving the union was not an act of aggression. It did not start the war.

[@JohnSmith-pm3ew]

​@@iamthewizardwhoknocks2845 "No state shall enter into any treaty, alliance, or confederation." The South did this when it seceded and formed each individual government, and again when they formed the confederate states. That's a hostile act of aggression against the Constitution and since the states had ceased to enforce federal law, it couldn't be interpreted as anything other than an uprising

[@andrewboldt9021]

The Fugitive Slave Act was ironically against the state's rights of Northern states.

[@warlordofbritannia]

South during the 1850s: Yeah, federal power! Screw personal liberty laws! South after 1859: Boo! Hiss! Federal government is tyranny!

[@LadyTylerBioRodriguez]

Its almost like it doesn't matter so long as the south wins............

[@Jiji-the-cat5425]

The Lost Causers conveniently ignore that

[@listrospectorlusca522]

based

[@shawnschaitel838]

the fugitive slave acts were constitutionally mandated laws as Article IV, Section 2, Clause 3, requires a "person held to service or labor" (usually a slave, apprentice, or indentured servant) who flees to another state to be returned to their master in the state from which that person escaped. the full text is as follows No person held to service or labour in one state, under the laws thereof, escaping into another, shall, in consequence of any law or regulation therein, be discharged from such service or labor, but shall be delivered up on claim of the party to whom such service or labour may be due.

[@yehbuddy4251]

"Local conservatives minds blown as they realize don't tread on me and back the blue are radically different ideas" is the greatest thing I've ever seen

[@luisfilipe2023]

Ah yes if you oppose tyranny that means you support anarchy middle ground is a complete non concept for American leftists

[@nickelback3360]

Not punishing crimes isn’t freedom. So, only to a point. If anything, anarchist/community/volunteer police would be harsher. While not identical, my campus police at University of Chicago were “meaner” than Chicago PD. People who dislike back the blue all have twitter addictions anyway

[@Balrog-tf3bg]

“Don’t tread on me!! It’s MY RIGHT to lick the lovely leather boots of the fine police officers”

[@luisfilipe2023]

@@Balrog-tf3bg next time your house is being robbed call Batman jackass

[@memeboi6017]

Not really, “back the blue” is a reactionary slogan against the defunding that plagued many police departments due to the BLM inspired purging of police. Meanwhile “don’t tread on me” is about individual rights, and police do not fundamentally go against that.

[@elizabethbellecoeur5446]

"species of property" is the worst euphemism I have ever had the displeasure of hearing

[@Thomaas551]

When in the video was that?

[@dominicguye8058]

Somewhere in the first quarter of the video. I am only a third of the way through the video and I heard that part already.

[@mrblue1768]

Pretty funny out of context though

[@striker8961]

It’s like that iq score meme: Low: they were cartoonishly evil. Middle: it was a complicated political issue. High: they were super cartoonishly evil, like beyond belief, I have the letters to prove it

[@patrickcleburneuczjsxpmp9558]

So you think other Americans' evil is justification for trashing the constitution and the rule of law and denying them the right to self-government?

[@striker8961]

@@patrickcleburneuczjsxpmp9558 yes.

[@patrickcleburneuczjsxpmp9558]

@@striker8961 You sound like the people that defended slavery on the basis of blacks supposedly lacking the moral qualities for self-government.

[@striker8961]

@@patrickcleburneuczjsxpmp9558 what are you smoking and where can I go to avoid it at all costs

[@patrickcleburneuczjsxpmp9558]

@@striker8961 I'm not the one making excuses for denying other people the right to self-government. You and defenders of slavery have that very much in common.

[@christophercolasurdo919]

“Sounds like a bunch of trouble making freeloaders” “They were white” “Brave rebels!” Ok. That got me.

[@67pearse]

Individuals with penises and without melanin is high up there too lol

[@darkshadowrule2952]

Same, I actually laughed out loud at that

[@MeansOfProduction209]

Sorry I didnt mean to dislike this comment, I hit it by accident

[@Davidschannel76]

😂

[@darkshadowrule2952]

@Maximal yeah, I dont think you can even see it when someone dislikes your comment without that browser plugin, but I'm not sure if that still works

[@William-the-Guy]

I like the way Johnny Rebb is allowed to make some good points, such as calling BS on the way the north treated native americans. That is a totally fair point.

[@ManiacX1999]

Southerners were the *last folks* to be talking about treating the natives like 2nd-class citizens

[@William-the-Guy]

@@ManiacX1999 I think the point is that the northerners were not saints. I think maybe we'd be able to finally make peace if the northerners dropped their high and mighty attitude and admitted they committed a ton of atrocities too. I say this is a northerner.

[@cl34ve]

​@William-the-Guy Those damn northerners, unwilling to admit to their atrocities. They started the Civil War, too! Will their crimes NEVER end? Anyway I'm sure the United States treated their native population much better once the confederates were defeated and re-added to the union, and the south was able to campaign for the rights of native peoples. Wait, I'm getting some breaking ne- oh. Oh no.

[@Chris-qo4rt]

Absolutely but a lot of people use this as a justification for the wrongs the south did by going "well the north did this and that etc"

[@William-the-Guy]

@@Chris-qo4rt Again, true. But what I have said I think in every post here is that the best response to that is to say "YES, the north did those things, that does not somehow change the horrible things the south did." I think that denying the crimes of the north is what makes it so easy for others to deny the crimes of the south. Just admitting that prevents the conversation from becoming hypocritical.

[@connorthornberg]

There's only one way that this conversation needs to go: Conferederate: "The Civil War was about states' rights!" Yankee: "States' rights to do what?" Confederate: *angry face*

[@artloverivy]

😂

[@Rmunkay]

To secede

[@kauswekazilimani3736]

​@@Rmunkay Secede for what reason?

[@Rmunkay]

@Kauswe Kazilimani irrelevant. The reason for exercising a right doesn't change whether or not you have it. Otherwise it isn't a right, it's a privilege, bestowed upon you by the type of centralized government we already fought a revolution over. Slavery is terrible, doesn't change the right to secede.

[@thatoneguywiththevoice328]

​@@Rmunkay they wanted to secede EXPLICITLY to do slavery North Carolina (first to leave) left because they believed (wrongly) that Lincoln would take away slaves. Lincoln was elected under the abolishment of slavery in NEW states, but the states that had slavery were allowed to keep slavery

[@thejanitor3337]

"Sounds like a bunch of trouble-making freeloaders looking for a handout!" "They were white." "Brave rebels! The tree of liberty must be watered by the blood of patriots!" My fave line so far.

[@eazy8579]

Basically Conservative rhetoric on welfare

[@screamingphoenix8113]

​​@@kingofcards9516 Its really not. For example, l Conservatives thanked Trump for giving the mainly white farmers relief after his failed tariff war. Than when years later, Biden had a minor clause in the BBB plan, wherein black farmers would recieve relief, Conservatives threw a massive hissy fit.

[@dastemplar9681]

@@eazy8579 Lol is that what you taught yourself?

[@kayo5011]

@@kingofcards9516 cringe

[@matchesburn]

@@eazy8579 [He doesn't realize he's being just as cancerous as the caricature of Johnny Reb here] Points for unintentional irony, though, I guess.

[@MollymaukT]

The North didn’t always fight to end slavery. But the South always fought to keep it

[@joedatius]

pretty much the best way to put it. Neo-confederates will never understand that this isn't a game of who's side is better, even though the answer is very clear. its a case of a group of white supremacist traitors who were trying to make a autocracy based around how much they love having slaves.

[@theredpriest]

Yes. And why is that? Because their entire economy depended on it. Agriculture was the way of the South. That was its industry. The North had already shifted due to the Industrial Revolution. A big difference in the use/need for slaves.

[@joedatius]

@@theredpriest except they never needed slaves. countless economies including to this day are and is depended upon agriculture and there has never been a point where slavery was needed. the south and USA as a whole never needed slavery, they chose slavery due to greed AND most importantly white supremacy goals that where infused to keep those systems and to further white supremacism ideals. do you want to know what happened to agriculture after slavery? it didn't stop nor did the economies depending on it ever stop needed to be depended on it. your entire argument is flawed in every degree and you're for some reason trying to justify slavery which was never something that the south needed, it was propagated by large plantations who forced its states into war for the sake of greed. the money of which only kept southern states poor and all the wealth in the hands of pentation owners while even white small farmers suffered.

[@thunderbird1921]

@@joedatius That's the thing. Couldn't Irish and German immigrants (two biggest incoming groups at the time) picked the cotton and other stuff, along with US citizens? I've long seen slavery as the plantation owners not wanting to pay fair wages (just like the corporations who put their factories in the sweatshops of Communist China).

[@joedatius]

@@thunderbird1921 pretty much, not only this but slavery was only economically viable for the south because of laws set by southern politicians who were more often then not influenced by plantation owners or where from plantation families themselves. who knowingly created a situation where the South was forced into being a slave run economy due to plantation greed. its why so many of the souths generals and politicians where from plantation families

[@Nekrubbobby]

"But it's our heritage!" "The annoying orange lasted longer than the Confederacy. You really gonna celebrate something so week that the annoying orange out lived it?"

[@MrShipBuff]

"Well states rights...." "Get Douglas'd." **Union Dixie**

[@heyyou322]

Still find it funny how it literally goes Skimming over it: it was about racism Looking a bit into it: Oh the south’s economy would basically be destroyed overnight and they basically had to do somethi- *Reading more into it* : oh they actually could’ve… damn never mind it was about racism.

[@MalvinasMaricon]

Seeing the confederate's reaction of horror and awe at the awful sh!t being spewed by confederate political theorists is honestly kinda wonderful.

[@salusoutlook2266]

i wont even lie, as a former believer of the "lost cause" myth and having every single point i ever made refuted and proven wrong. ill give you the full satisfaction of knowing this series has changed my mind completely.

[@salusoutlook2266]

@clxxd999 you have no idea dude. I'm from Alabama so obviously I would have an extremely pro Confederate point of view. But I also like to admit when I'm wrong. I'm admittedly embarrassed about how wrong I was though lol

[@dusk2308]

oh wow you can't say that on twitter...wait? no you still can't there still gonna hate you, at this point twitter is worse the alabama. i mean i guess they didn't want an authtain slavery empire but something just as worst...communism.

[@pesco3773]

I'm so happy to read this. I wish everyone were as willing as you are to change your mind based on reasoned discussion and facts. Good on you. I hope you're able to take it to the next level and try to dispel other people of their false assumptions, as well. Safely. I know some people in the south can be very emotionally defensive about these topics.

[@ReaperCH90]

@@salusoutlook2266 i have the greatest respect for everybody who changes his or her opinion after being confronted with new facts that oppose the old opinion. Good on you!

[@reaperking2121]

@@salusoutlook2266 Its honestly not your fault. Its the central governments fault for failing at reconstruction. The south should not have been allowed to tie its culture back into the confederacy . Had reconstruction been handled better, or maybe just maybe the south had been given less leniency this bullshit could have been avoided.

[@tymacrae6052]

I honestly don’t understand how these people keep thinking the CSA was this paradise of individual freedom and small government when they had higher taxes and even more egregious conscription laws

[@jeffreygao3956]

“How is is we hear the loudest whelps of Liberty from the drivers of slaves?” -Anonymous Unionist.

[@originalindigodingo]

Because every single person who claims the CSA was a beacon of freedom is dumb enough to think they would have been a slaveowner, and not a serf. Same with libertarians who think they would be smart enough to succeed in an unregulated environment, and not die instantly from tainted food. Stupid people think they would be in charge because they mistake ego for qualification.

[@LewisB3217]

Revisionist history telling them their ancestors were doing the right thing, I guess that’s what happens when you go light on treason

[@abdulmasaiev9024]

Ah but you see, it was war and they were fighting a lopsided fight. Once peace came their rulers would have totally given up those powers, honest! ...well either that or they'd go "can't have shit be more perfectly unified than it all being directed by one will and sitting in one coffer: goods, money, people and all - therefore more authoritarian and even totalitarian = more perfect union, Just Like the Founders Actually Intended"

[@Sid_Garrett]

and you know, slavery

[@StormCrownSr]

"I'm sure they offered plenty of thoughts and prayers." Credit where credit is due, that was funny.

[@dominicguye8058]

It was very clever

[@Tiberius_Productions]

The fact that the Confederacy was never really going to be the “libertarian dream-state” Lost Causers pretend it was, but instead an authoritarian apartheid state (or worse yet a dictatorship) is so ironic it borders on comedic.

[@criSOME1]

Libertarians don’t see it that way. They see it sets a precedent for other states as well. Many northern states originally wanted to secede from government firstly. In fact the original abolitionists were the trend setters. You guys love to attack libertarians lol why loser?

[@danieldykstra3079]

The Confederacy was not a libertarian dream state, they still had an age of consent.

[@Alexlalpaca]

"Those [Virginians] who do remain have reverted to a primal state of nature" Oh no, they became Floridians.

[@420JackG]

Eh... the world would still probably be better off.

[@Contra_Mundum]

I feel fine

[@FMCH6444]

As a Floridian, I feel this. They made our wonderful state the laughing stock of sane people.

[@jtilton5]

@@FMCH6444 One guy uses an alligator to rob a 7-11, and suddenly you get a reputation.

[@timmccarthy872]

I was gonna upvote you but at present your comment has 703 upvotes (the area code for northern Virginia)

[@scarabairsoft221]

Remember that a few weeks before this came out, a “Southern Heritage” supporter refused to comment when asked three times if he supported slavery. For all the under-educated, misguided people, there’s a core of true racists and would-be slave owners.

[@donovanlocust1106]

The Republicans would repeal the 13th Amendment if they REALLY wanted to.

[@crotchman]

Someone in public office?

[@yannickgrignon2473]

That's absolutely batshit insane. Supporting slavery is beyond the Pale, EVEN among most racists.

[@twotone3471]

Most of the "Heritage, not hate" good ole boys think the "Rebel Flag" is a Confederate one.

[@CriticalCarolinian]

That clip was crazy, dude was given three opportunities to correctly answer the easiest yes or no question in existence and failed.

[@JoinThe_BingvinArmy]

“State’s rights to do what?” -Doobus Goobus

[@jeffreygao3956]

Use slave labor for profit….this is gonna suck.

[@mudeschuppentier6306]

As a modern white southerner, screw the confederacy. There were southerners that were against the confederacy. I don’t know much about them, but I know a few existed. Southern Hospitality should be for welcoming everyone.

[@HaloFTW55]

There were actually enough to form Union Army regiments that fought against the Confederate Army. The influence also extends into the US Navy with the most famous naval commander of that war being a Southerner by the name of David Farragut.

[@user-jq1mg2mz7o]

southern unionists were pretty cool, and if anything displayed the workingman 'rebel spirit' more than the wannabe aristocrats of the south. it's hard enough to take up arms for freedom against countrymen in another state, but doing so knowing your neighbours are arrayed against you and you fight anyway? based. they should be the ones with statues. if the neo confederates want their "we must remember history!" i say put up southern unionist and abolitionist statues. that's the legacy they should be proud of and claim

[@Waffenschmitt]

My GG grandpa fought in the 6th TN mounted infantry US during the civil war

[@dogukan127]

@@HaloFTW55afaik one of the really good generals of the union who did not make much name to himself because he destroyed his own diaries was also a southerner

[@brian8507]

Wow such a brave take 👏 👌

[@rich355]

Anyone notice how Johnny Reb's character has subtly been changing. Before he seemed completely opposed to the idea that slavery had anything to do with secession, but now he is suggesting that slavery had played a part, but some other matters may have also been involved. Not to mention in the earlier episodes, He would sleep, take fake phone calls, look around the room, or be really mad whenever Billy Yank made valid counter arguments to his points. However for the most, he is more respectful and seems interested or at least willing to hear what Billy Yank is saying.

[@dastemplar9681]

Well his character is the embodiment of the “Southern Cause” that many have fantasized about to this day. Not the reality of it. His initial take has always been focused on two points. 1) Slavery itself wasn’t the direct cause of the Civil War, and 2) That it was truly a war of Northern Aggression. He’s representing those who go about worshipping Confederate generals and trying to find any means to “justify” the Confederate cause even by the slightest. So when the reality is revealed to him, even he is taken back, because it hampers his romanticized view of the Confederate cause.

[@ErikVonStrix3]

he's also becoming open to accepting some things the confederacy has done and said as horrific (eg: when he heard George Fitzhugh's quote at 38:32. early Johnny would have just brushed that off.)

[@bulbakingdoot3514]

Interesting

[@aralornwolf3140]

Maybe Johnny Reb hates the oligarchy which caused the Succession?

[@androzani]

I loved that he's has definitely had more character to him. He still has his southern pride, but he doesn't seem to be very eager to fan wave the truth about the confederacy or attach that pride to them. He's growing as a character, and to be honest, it shows Atun-Shei is growing too, this is the same guy who brutishly murdered this rebel before, but is now more comfortable to talk some scene into him to a point were the rebel actually changes his mind. It's nice to watch these videos the most out of his series.

[@FritzMonorail]

I legitimately had to do a double take when I saw that there was a new checkmate Lincolnites because I almost couldn't believe it. The exact thought that went through my head was "YES YES YES YES YES YES"

[@111111310]

SAME

[@plaguechild24]

same

[@jasonritner9662]

*cues up Flight of the Valkyries*

[@johnfraire6931]

Ba daa da da *daaa* da,

[@jurtra9090]

IS THAT A M'FING JOJO REFERENCE?

[@HeavyTF2real]

As a leftist, you being asked if you were an anarcho-syndicalist was fucking hilarious to me. People forget what is and isn’t jargon outside of leftist circles

[@AshanBhatoa]

An easy gateway into alienating folks from leftism, also.

[@tellanov]

ikr I wasn't really paying attention at the start and then out of nowhere I hear a term that I know has nothing to do with the video

[@ModernEphemera]

They definitely got it from the peasant in Monty Python’s Holy Grail

[@caidenbird1085]

As a former believer in the lost cause, this show has played a huge role in helping me progress my historical and political conceptions. Lots of respect for Andy and the work he does to eradicate old myths. Been watching for five years now! Thanks for everything, man👍🇺🇸

[@billybattyboyjunior69]

"and I must ask are you an anarcho-syndkialist" is the best line since "and I say that as a Latino"

[@Alte.Kameraden]

made me smile and cringe. Anarcho-Syndicalism is like one of the dumbest branches of Socialism. Because it's a contradiction. I doubt a Lost Causer would even know what it is. 😆

[@TheEvilMiasma]

I’m not sure how someone makes the connection between supporting federal power and the exact opposite.

[@szymonsokolinski9907]

@@Alte.Kameraden No it’s not. You may disagree with it, in fact, I do, but there is no contradiction between opposing the state and various forms of authority and believing that capitalism should be destroyed by a series of strikes and other actions organised by militant labour unions

[@QuadZillaGodZillasbrother]

@@Alte.Kameraden All types of socialism kind of suck

[@appleman6290]

@@QuadZillaGodZillasbrother based

[@DaraelDraconis]

It's no wonder Jonny Reb didn't remember Episode 1 at first. After all, he wasn't there. That was some other Confederate officer, who you shot dead.

[@jeffreygao3956]

I'm still not sure if it was right to murder that Confederate officer. Just because someone's nasty doesn't mean they deserve to die!

[@YokaiX]

Indeed. That was Stonewall Dixie, not Johnny Reb.

[@Vextonomy]

@@YokaiXlmao

[@Vextonomy]

He died to a gunshot wound too

[@user-jl7kx7rj9h]

Lt. Summ G. other

[@42andblue5]

I absolutely adore the genuine concern in Reb's voice when he asked if Billy was an anarcho-syndicalist

[@squidythe3rd927]

You see, he loves the CSA, but not THAT CSA.

[@pivomanslovensko]

​@@squidythe3rd927kaiserreich reference!

[@Ma_Zhongying]

@@pivomanslovenskoHe just like me fr fr

[@pivomanslovensko]

@@Ma_Zhongying Combined Syndicates of America patriots rise up

[@HortonSalm]

2:55 "Liberty loving Southerners" Johnny, you own people.

[@iammrbeat]

What an honor to be a part of this masterpiece, and I always wanted to be journalist (since that's what my major was in college).

[@CTyankee]

Awesome cameo!

[@danielthevito9008]

Mr Breast!!

[@LadyTylerBioRodriguez]

You sold it like a champ. I wouldn't have been abled to keep my composure.

[@Gia1911Logous]

You guys should do more collabs You two are really unbiased in your videos and very very informative Keep up the good work guys As a non-American I enjoy learning about your history and politics

[@CTyankee]

@@Gia1911Logous I agree!

[@solomontheadventurer6709]

It’s crazy how people will still argue for the “states rights” and “Lost Cause” theory after hearing how *their* politicians actually wanted the Government of the Confederacy to have MORE power over southern states.

[@samuelskinner7704]

Because it was about the North having power over the South. It turns out the Southern objection is 'we don't want to be under the thumb of people who hate us and want us dead'.

[@chile_en_nogada2090]

Who cares

[@samuelskinner7704]

@@chile_en_nogada2090 Because we might get round 2 soon enough.

[@solomontheadventurer6709]

@@chile_en_nogada2090 …you clearly do…you cared enough to comment about how much no-one cares…which doesn’t make much sense. Also, clearly 51 people care? Do you not see the likes? Your the type of person to look at a famous artist you hate and say “who even likes them” because your too hard headed to even understand that people could like something different than you.

[@diehard2705]

@@samuelskinner7704 you’ll get whipped again

[@JoeJohnston-taskboy]

know what’s sad? this is a far more civil political discussion than what happens on the Internet and in person.

[@Moonlitwatersofaqua]

Well it is scripted.

[@fulcrum2951]

Are the comments he used as arguments scripted tho?​@@Moonlitwatersofaqua

[@heyyou322]

@@fulcrum2951no what he means is that if someone already has an ideal about something then it’s next to impossible to change that ideal. If hypothetically a small set of people actually believe that the moon was made of cheese, even if you literally flew them to the moon and showed that it was a rock they would say otherwise

[@gupgaming2367]

It never ceases to amaze me how people can look back at all this information and still believe that the slavers were right and that african americans were not human.

[@heyyou322]

Simple. They just… don’t look at that stuff… and oh man it’s like it never happened

[@helarki4309]

"A states rights to own slaves!" He did it! He said the thing!

[@waltonsmith7210]

He said the quiet part out loud.

[@JeanLucCaptain]

its nOT A ABOUR PROPERTY, ITS OUR WAY OF LIFE!!!!

[@helarki4309]

Your property consisting of?

[@MechWarrior894]

I would have made Johnny Rebel say it. “A state’s right to do what?”

[@MyPhobo]

He said the thing we are all thinking when we roll our eyes when people say the other thing!!

[@snoopsauce6294]

Holy shit dude, the confederacy was actually insane. But it really isn't that farfetched for a country explicitly created to preserve to the point of war, would have a tendency towards total governmental control. It really seems like a natural progression.

[@hmt4173]

The video also makes it clear that the federal government was complicit in the fight to preserve slavery. Excellent video, very radical stuff.

[@warlordofbritannia]

It also makes sense as to why Southerners could more or less be re-assumed into the United States’ political fabric-the only real difference between the Confederacy and the antebellum federal government (as Southerners saw it) was an even bigger and explicit purpose on preserving and expanding the institution of slavery. Once slavery was dead, they could more or less return to using the federal government to secure their own interests-see the compromise of 1876, among a whole slew of other actions…

[@MadnerKami]

@@warlordofbritannia Yup. Ultimately it wasn't about slavery, but plain and cold economic interests. Looks familiar, doesn't it? It's almost as if they could move right on on as if nothing had happened...

[@warlordofbritannia]

@@MadnerKami I can’t tell if this comment is supposed to be ironic or not

[@T.GLongstaff]

@@warlordofbritannia me neither

[@tonyjoestar2632]

I like that Johnny Reb acknowledges that slavery is terrible, he just wants us to understand that his cause was about more than the horrible practice of slavery. I mean it wasn't but

[@dominicguye8058]

Well that's the position of modern Lost Cause advocates

[@vehx9316]

​@@dominicguye8058 Their position changes according to the time, 40 years ago you did still hear about the "happy slave" bullshite.

[@tonyjoestar2632]

​@@dominicguye8058if only most lost causes were as polite as Johnny

[@hatihrovitnisson6269]

Remember always hit the traitor losers with "State's right to do what"

[@alexandarvoncarsteinzarovi3723]

The state rights, own, sell, abuse and educate the black Africans as obligatory laborers for life on the counts of being born black! - its a joke

[@MinorityRespecter88]

Secede

[@KorenJoy]

​@@MinorityRespecter88secede... for what?

[@MinorityRespecter88]

@@KorenJoy independence

[@scotthuffman3462]

@@MinorityRespecter88 What was the first thing they were gunna do with that independence? Oh right the leader of the confederacy literally said they were gunna use it for slavery

[@squably]

"I must ask, are you an anarcho-syndicalist?" Dear god Kaiserreich and its consequences have been a disaster for the human race

[@crusader2112]

Anarcho-Syndicalists were a thing in the late 19th Century and I think the just before and during the Spanish Civil War.

[@Reagan1984]

@@crusader2112 Yes, but very few people in the 21st century knew what the ideology was until the recent exposure by the Kaisereich mod. Same with Huey Long.

[@crusader2112]

@@Reagan1984 I know, for me I found out about Huey Long from Emperor Tigerstar’s on him.

[@kazmark_gl8652]

It's a real ideology we swear. I genuinely feel bad for the Anarcho-Synicalists who'd identified with the ideology before Kaiserreich became more mainstream in this specific internet neiche, all tens of them.

[@originalindigodingo]

The eff is Kaierreich?

[@wyatt8274]

I like that Johnny Reb has gotten much more chill over the years, solid character development.

[@weldonwin]

That and being shot dead in the first episode

[@heribertosarmiento1265]

It was thanks to VVitch hunter general slapping the Nazi out of him

[@meepnax]

@@weldonwin In the first episode, he said he owned slaves during the war. By this episode he claims he "would've been an abolitionist". Clearly the shooting knocked the slaveholderness out of him

[@kylegonewild]

@@meepnax "Getting shot has a high chance of changing your outlook on life." -Ancient United States proverb.

[@Gantradies]

the exorcism probably helped a fair bit, as has all the alcohol, i suspect...

[@user-uu6gn2fo4r]

I was watching The Birth of a Nation for school on 1.5 speed on KZbin because I really can't handle that shit on normal speed and I forogt to turn it back to normal and your Confederate character just started spitting random excuses at me at lightning speed and I'm so sleep deprived I thought I was gonna cry man. Great video.

[@leoxgamer1342]

I think human rights is a bigger issue than states rights

[@QuantemDeconstructor]

congratulations, you're on the winning side of this issue

[@user-rg7uz8of9r]

rhymes with "bigger rights"

[@doctahjonez]

@@QuantemDeconstructor As they should be.

[@achair7265]

You can replace states rights with federal rights it will still make sense.

[@adrienlastname4663]

How did no one notice that literally everything Jackson said sounded like a villain speech.

[@onbearfeet]

It even sounded like Atun-Shei was doing a bit of a Charlton Heston impression. Heston played Jackson in "The Buccaneer" in the 50s, and the portrayal was influential for a while. Layering on any audience memories of Heston's own politics (for reference, look up his history with the NRA) makes for a solid villain performance.

[@autobotstarscream765]

Hot on the heels of the success of the hit musical Hamilton, behold the Jackson musical! kzbin.info/www/bejne/bYOXlnyIj7SForc

[@tymera]

STRAIGHT UP AND THIS DUDE IS JUST ON YOUR MONEY. MY GODDAMN MONEY

[@Blacksmith__]

I think Confederate dreams of empire, autocracy, theocracy, etc. deserve their own video! Really interesting subject

[@Turnil321]

see alternate history channel. They have a video about that.

[@Davidschannel76]

We need to revisit the Spanish American war and the colonization of the US territories primarily by southern politicians. Many who served in the CSA, or had a parent or grandparent who did. Put a racist in charge of people of color outside the continental US. Let’s see what happens!

[@plasmicats2000]

@@Davidschannel76 Death

[@helwrecht1637]

I support this whole heartedly.

[@colinfinkel7587]

Earthquakes though . . .

[@paulmryglod4802]

It was absolutely about states rights. Their right to use people as farm equipment.

[@patrickcleburneuczjsxpmp9558]

As if Republicans led the North to war to deny the slave states that right??? Nice myth if you want to try to justify denying self-determination to other people.

[@garlonschuman1014]

@@patrickcleburneuczjsxpmp9558you must be an idiot to even bring up self-determination in this context, the slaves had no such right, it was deprived them by the southern state governments with the aid of their citizens

[@patrickcleburneuczjsxpmp9558]

@@garlonschuman1014 And neither did slaves (and lots of other Americans) in 1776? What's your point?

[@dinamosflams]

it was about states rights and 'free' people! (wink)

[@jdotoz]

Hey, that's not fair. They used them as farm animals.

[@nicolemarieanneeickhoff2522]

the "thoughts and prayers" comments from the Southern guy is so great. such a dig, and so well placed.

[@LadyTylerBioRodriguez]

Wow, the political makeup of the Confederacy was an absolute cluster fucking mess in ways I didn't even know. I knew it was top heavy class wise but the fact it was verging on autocratic monarchy is absolute madness. Great video, PS Johnny Reb is going through a beautiful arc and I wish him well.

[@jtgd]

@Russian Waifu bad bot!

[@LordCantinflas]

@Russian Waifu bot go away OK, it's gone now.

[@rothnirtull4254]

I think the bots gone, but another dub for the boys

[@daleludtke7803]

I have always found it pretty humorous that the South was pretty much the closest we ever had to a legitimized aristocracy.

[@LadyTylerBioRodriguez]

@@daleludtke7803 Yeah that needs to be mentioned a lot more. The Confederate States of America had little usage for democracy.

[@alexross1816]

I find it interesting how so many Southerners I know lionize Andrew Jackson, even though his entire legacy is strengthening the power of the Executive Branch, and how he was arguably one of the most Authoritarian Presidents we've ever had.

[@Mr.wednesdayallfather]

Man I don't know if you know this but Andrew Jackson had a bullet near his heart from when he was young and full of piss and vinegar and more than likely some of that old Tennessee goofy juice

[@Justanotherconsumer]

As the show discusses, the “libertarianism” of the South is often quite selective. Authoritarianism is fine as long as it does the right things.

[@thesenuts603]

besides Joe biden

[@quronmccovery881]

@@thesenuts603 Nice reach! Try again, you might get to the stars.

[@enigmabureau]

@@quronmccovery881 man’s gone way past the stars with that one

[@catcatcatcatcatcatcatcatcatca]

This is an incredible piece of cinema. The socratic dialogue flows so smoothly it’s easy to watch. The humour is great, and both characters are enjoyable despite one being a southern apologist and the other delivering very long and detailed historical commentary. Neither of those are what I would describe as pleasing character traits. And the last scene was the true icing on the cake. The camerawork, lighting and sound design build such an atmosphere it made the absurd concept feel real and serious. Both roles were acted well, even if I can’t comment on the accents. The dialogue managed to communicate the batshit insane narrative perfectly smoothly.

[@Godzeller3143]

“A states right to what?” By far and away the best response to the claim.

[@patrickcleburneuczjsxpmp9558]

Self-govern.

[@lich109]

​@@patrickcleburneuczjsxpmp9558 They could already self-govern, with one notable exception, care to guess what it was? Also, funny how you claim it was to self-govern when the Confederate constitution would remove that ability for other states, proving it was never about self-government.

[@patrickcleburneuczjsxpmp9558]

@@lich109 > They could already self-govern, with one notable exception, care to guess what it was? Tariffs? There certainly weren't any limitations on their self-government with regards to slavery. > it was to self-govern when the Confederate constitution would remove that ability for other states Or so the stupid propaganda sources from which you've learned your revisionist foolishness from say.

[@lich109]

@@patrickcleburneuczjsxpmp9558 They were terrified that there would be limitations in regards to slavery and stated so. As far as your "propaganda" claim goes, I didn't see any secondary sources telling me that, I read the Confederate constitution. You should do the same because it demolishes your claim.

[@patrickcleburneuczjsxpmp9558]

@@lich109 > They were terrified that there would be limitations in regards to slavery and stated so. Or so the stupid propaganda sources from which you've learned your revisionist foolishness from say. > I didn't see any secondary sources telling me that, I read the Confederate constitution It must have been the constitution for the Swiss Confederation then, because the constitution of the CSA says no such thing.

[@benjamins.10]

The alcohol choices are VERY purposeful. Billy was drinking Apothic Inferno during the Sherman episode. This episode Billy is drinking Sam Adams while he talks at great length about the Revolution. Johnny is drinking The Boot as Billy lays out how the Confederacy was an authoritarian state. Nice little detail, Andy. I see you, 😂

[@KuLaydMahn]

I can't believe he shook up and spilled all that beer everywhere!

[@DrSanity7777777]

“I fear’d [sic] being guilty of Injustice to the Brute Creation, if I represented Drunkenness as a beastly Vice, since, ’tis well-known, that the Brutes are in general a very sober sort of People.” - Benjamin Franklin

[@iangrau-fay3604]

I saw that too.

[@captainahab1533]

This episode is the embodiment of what this channel has become to me and probably many other viewers. I came watching some Checkmate Licolnites, but it's the super creative and unique stuff I stayed for. There's no other channel that combines educational elements with s-tier entertainment, in such an amazing way.

[@AtunSheiFilms]

Yay! Very kind, thank you!

[@warlordofbritannia]

@@AtunSheiFilms That end credits scene in particular was… *chef’s kiss*

[@NothingYouHaventReadBefore]

@@AtunSheiFilms For real though. It's an embodiment of genuine passion, and it's amazing to see your work grow! ❤

[@yg6484]

I completely agree.

[@ThePoolshark86]

Perfect comment

[@Echo1Vyr]

Dude the comedy alone is gold, but having the editing, production AND history down perfectly? It's so good.

[@Commander_Appo]

“State’s rights to what”

[@patrickcleburneuczjsxpmp9558]

To independence and self-government. What else?

[@thevenator3955]

(minus all of those people we won’t give independence to of course)

[@patrickcleburneuczjsxpmp9558]

@@thevenator3955 Same as in 1776.

[@crabman2073]

@@patrickcleburneuczjsxpmp9558 Than win like America next time

[@patrickcleburneuczjsxpmp9558]

​@@crabman2073 Do you justify slavery the same way: then don't let someone else enslave you next time?

[@SenhoritaF.]

As a Brazilian I didn't think the confederate escapades to Brazil would make it into the series but it did in the most iconic way possible. The whole story city of Americana, in the State of São Paulo, is something straight out of a fever dream. There's a joke among Brazilians that in every American movie the villain wants to retire/hide in Brazil but with the whole Nazi thing afterwards, it has a bit of truth to it lol

[@Fab-n-dabKev]

I had no idea they did that. South America's like a racist haven or something. But I suppose the progressive ideologies were slow to reach the southern most countries.

[@SenhoritaF.]

@@Fab-n-dabKev Thankfully, it didn't work as well as they liked. But concerning ideologies, it's more complex than ''tricking down'' from the North. Brazil, for example, was never strictly opposed to miscegenation (unlike the US) until the 20th century when the elites adopted eugenics from Europe (which doesn't mean there wasn't other forms of racism though). Britain indeed lobbied Brazil to end the slave trade, but not out of some kind of progressive principle (at least not totally), but because they wanted a bigger consumer market to export industrialized goods to Brazil (enslaved people don't buy products), while at the same time, sabotaging quite literally any Brazilian attempt of national industrialization.

[@Fab-n-dabKev]

@@SenhoritaF. yeah I was just making a broad assumption. There's been so many regime changes with different backers throughout modern SA history that the problems and their sources are too numerous to list in a YT comment

[@SenhoritaF.]

@@Fab-n-dabKev Yep! Unfortunately, you're totally right :/

[@coala2001]

Yo, Americana é literalmente uma colônia confederada e eles fazem a Festa Confederada todo ano kkkkkkkkkkk

[@misedout12]

Currently in VA and I can confirm that the state has reverted into a Mad Max-esque post-apocalyptic landscape... with great internet access. So not all bad 😁

[@Rob0Penguin]

I'm sadden NOVA was wiped out, they were a good tax base. I'm confused on how Charlottesville survived though.

[@melxdiq_mxth8993]

@@Rob0Penguin I had moved right before NOVA was tanked, i still have family and friends that live there obviously, but it always feels so different and weird going back, like ten years have passed instead of like 2, and somehow i've tripped into an alternate virginia

[@iamnadexey]

I feel like most of non-city VA has kinda been frozen in time since the 90s. The most that's changed in my area is... well... the internet access. Never liked the city or lived close to any, but boy do I get jealous of it sometimes.

[@alicia1463]

When I lived in southwest VA, it seemed like a mix of traditional rural southerners and old hippies. Lots of yarn/quilting shops. The college town that I was living in had changed since the 90s, but the rest of it? Probably not.

[@robbieclark7828]

The phrase “tyranticle overreaching federal gobment” rings through my head on a daily basis, but I can never remember which of these its from

[@levig6238]

I’m a huge states rights/minarchist fan that went to college in TN. It was tough down there arguing with folks who I agreed with on their opinion toward modern times, but had to bash them over their stupid support of “The war of northern aggression”. I tended to play with my food while arguing allowing them to build their irrefutable cases. Then simply showed them the confederate equivalents to the Declaration. Nearly every state that seceded named slavery specifically as a motivating factor and most often as the primary. Tough for them to argue intention against the very leaders of the South.

[@Timoshemperoni]

I agree that slavery is an unforgivable sin but i am sympathetic to the idea of secession. I believe in referendums. Nothing is more democratic. I understand that may weaken the union but I support Scottish independence so it would be hypocritical of me to criticise people wanting to rule themselves. I just wish they weren't so prone to conspiracy theories, racist thoughts and bible bashing.

[@patrickcleburneuczjsxpmp9558]

"Nearly every state that seceded named slavery specifically" Not a single state "named slavery... as motivating factor..." What kind of nonsense propaganda are you spinning?

[@patrickcleburneuczjsxpmp9558]

@@Timoshemperoni You might appreciate this quote from a northern abolitionist on the eve of the war, particularly with regards to the question of "weakening the union": “It is constantly said, particularly by speakers in Congress, that if our government cannot prevent a State from seceding at will, it is no government at all. But it is forgotten, that the true glory of our government-the queen beauty of our system is, that it ceases with the will of the people. Its true strength lies not in navies and battalions, but in the affections of the people. Numbers in our midst -editors and members of Congress, are vainly boasting that we propose to show the world that we have a government that is strong enough to meet the exigency and to suppress rebellion. But they fail entirely to apprehend and appreciate the true theory of the American system. Their is the old European, and not the American, idea of government... “The true strength of a free government-and they are the strongest of all, is in the devoted attachment of its citizen sovereigns. Let this be forfeited, and the government falls. “A government which is strong by the exercise of military power over its own citizens, is not a free government, but a despotism. “Instead of the peaceful separation of these States being a disgrace to our government in the eyes of the world, it will constitute in all coming time its truest glory, and will demonstrate the infinite superiority of the voluntary system of self-government over the despotic usurpations of the past.”

[@Timoshemperoni]

@@patrickcleburneuczjsxpmp9558 Very interesting. Obviously if the civil war could have been prevented that would of been preferable, but without Yankee intervention how could the plantation owners ever be convinced to free the slaves? If they were an independent country then they wouldn't have a government to compensate slave owners for emancipation like the UK did and Washington offered the South. The money was far too convincing for the planter class to even consider emancipation. I believe the South still would of fought even if they were offered independence for emancipation and a ban on slavery. But that's a hypothetical. Abraham Lincoln was rather unpopular in his first couple years of office so the confederates probably shouldn't of attacked fort Sumter and instead used diplomacy and compromised with the North. Probably would of gained the support of France and the UK if they focused their politics more on secession than slavery and that would of weakened the North's case for invasion.

[@patrickcleburneuczjsxpmp9558]

@@Timoshemperoni "but without Yankee intervention how could the plantation owners ever be convinced to free the slaves?" Without the southern states seceding and claiming their right to independence how could plantation owners have been convinced to free the slaves? You might as well credit the South's secession as the North's response to secession with the results of the conflict, results that were neither intended nor foreseen by either side. Lincoln, after all, denied the right of the southern states to secede saying, "I have no purpose, directly or indirectly, to interfere with the institution of slavery in the States where it exists. I believe I have no lawful right to do so, and I have no inclination to do so." And also: "...a proposed amendment to the Constitution... has passed Congress, to the effect that the Federal Government shall never interfere with the domestic institutions of the States, including that of persons held to service. ...holding such a provision to now be implied constitutional law, I have no objection to its being made express and irrevocable." The abolition of slavery did come about as a consequence of the war, much like the practical end of monarchy in Europe came about as a consequence of WWI, or like the way the establishment of the nation state of Israel came about as a consequence of WWII... but although wars frequently have unintended consequences, it would be absurd to try to justify wars (or principles for waging future wars) on the basis of wars' unintended consequences. But to the question of how abolition might have come about apart from the war, first, as I've already suggested, there was nothing that the North was doing while the slave states were part of the Union to bring about the end of slavery that it couldn't have continued doing after secession. The seceding states' leading grievance with the northern states was that the northern states weren't honoring their obligation under the US constitution to deliver up fugitive slaves. If the Republican-led North had actually wanted to help free slaves rather than just exploiting anti-Southern feelings to get the more agricultural Midwest from siding politically with the South, it could have allowed the southern states to secede and without any legal impediments offered full refuge to any slaves escaping to the North. As one border state congressman argued in 1842, "...the dissolution of the Union [would be] the dissolution of slavery... Just as soon as Mason and Dixon's line and the Ohio river become the boundary between independent nations, slavery ceases in all the border states. How could we retain our slaves, when they, in one hour, one day, or a week at the furthest, could pass the boundary? Sooner or later, this process would extend itself farther and farther south, rendering slave labor so precarious and uncertain that it could not be depended upon; and consequently a slave would become almost worthless; and thus the institution itself would gradually, but certainly, perish... Slavery in the States would fall with the Union." And an independent South would have been able to consider abolition in a way that wasn't practically possible so long as it was associated with things like abolitionist terrorism (at the extreme besides other violence and attempts to incite violence.) And the violent criminal wing of the abolitionist movement was feeding heavily off of the political tension. "Bleeding Kansas," as the 1850's violence in Kansas was called, was certainly related to slavery but was ultimately all about political control of the Kansas government. Take away the sectional politics, and you open the door to normal political debate and progress. What are the prospects, for example, of the Ukrainian government passing legislation to protect the rights of Russian-speaking Ukrainian citizens in the middle of the current war? But if it were possible to take away the war and the tension with Russia there would be little or no incentive for Ukrainians to be concerned about ethnic Russians in Ukraine. As President Buchanan (the president before Lincoln) said, "Before [the abolitionists] commenced this agitation" -- by 1859 a large segment of the North, including governors of northern states, had even supported a murderous terrorist attack against random Southerners, not even slaveholders, just random Southerners, the first murder victim of which was even a free black Southern; if you were a Southerner at that time in favor of abolition can you imagine advocating for a cause closely tied to murdering your random neighbors? -- "a very large and growing party existed in several of the slave states in favor of the gradual abolition of slavery; and now not a voice is heard there in support of such a measure. The abolitionists have postponed the emancipation of the slaves in three or four states for at least half a century."

[@thexalon]

A bit about the "tree-hugging Quakers" line: There's an argument to be made that American abolitionism started with 1 person, a fellow named John Woolman, who spent a lot of his life (in the early 1700's) traipsing around the Quaker communities of New England convincing them to stop trading in and owning slaves. His diary is very influential among Quakers today. Woolman's home is now a retreat center, in Deerfield MA.

[@fuzzyhair321]

Jeez that man had a mission and saw it through. That's amazing actually

[@thexalon]

@@fuzzyhair321 I find it a truly inspiring story, the power of 1 person with an important idea and the courage and spare time to do something with it.

[@Jiji-the-cat5425]

Damn. I live about 20-30 minutes from Deerfield, and I didn't even know this. That is so cool. He's a very inspiring person for sure.

[@1000g2g3g4g800999]

I think attributing the movement's origins to one person is a bit of a mistake.

[@ImYouriEntertainment]

I recently got my hands on a copy of Woolman’s journal and I’ve been eager to start reading it. He sounds like an extremely humane person.

[@wildfire9280]

“When you’re accustomed to privilege, equality feels like oppression.” Someone should tell George Troup that.

[@Blox117]

someone should tell all women that

[@scatered1]

When you start hearing people use the word "Equity" throw those people off a bridge, into a river and run far away.

[@jacquelinedavis9948]

​@@Blox117 Someone should tell Twitter that.

[@wildfire9280]

@@Blox117 whatever you’re smoking, I want in

[@brano13177]

@@Blox117 Imagine thinking that it's the women that were the ones with "privilege" while also trying to curtail womens rights. Seems that thou dost engage in projection

[@samuelbarber6177]

I admire how confident Johnny Reb is at the beginning of all these. He always gets beat by the almighty FACTS AND LOGIC but he’s also very sure of himself

[@markbujdos584]

Because it never occur to him that the whole debate is rigged.

[@nanni-buyerofcopper]

​@@markbujdos584how?

[@ALJ9000]

An example of the Dunning Kruger effect played to full force

[@AyenLogic]

​@@markbujdos584don't you hate it when facts get in the way of your backwards ass rhetoric?

[@MakoProfessionalJerk]

In these kinds of talking head videos, the "heel" is always cocksure and silly while the "face" is calm and well-spoken. What gets lost in these arguments is the nature of manufacturing and the soft power therein

[@clrlmiller]

Absultely a war about states rights, provided those states were Southern states and not a free state. The South wanted slaves as forever property no matter the state where the slave might go. This was the whole point to the Dredd Scott decision by the supreme court. A southerner could not only venture to ANY northern state and keep his slave as property. But also compel the northern authorities to assist in retrieving said property and punishing northern folk who did not comply with returning slaves. But the North could not question any claim of property(slaves) within the South. IE, The South could not only keep their slaves, but the North has to help keep slaves as slaves without investigating free africans of the north kidnapped to the South. They wanted southern states rights trumping northern states rights, at will.

[@patrickcleburneuczjsxpmp9558]

> They wanted southern states rights trumping northern states rights, at will. At will??? How about according to the deal the states made in re-establishing the union under the constitution? Even Lincoln said in 1861, "It is scarcely questioned that this provision [the constitution's fugitive slave clause] was intended by those who made it for the reclaiming of what we call fugitive slaves; and the intention of the lawgiver is the law. All members of Congress swear their support to the whole Constitution--to this provision as much as to any other. To the proposition, then, that slaves whose cases come within the terms of this clause "shall be delivered up" their oaths are unanimous."

[@achair7265]

I think it's why the confederacy constitutionally prohibited abolition to the point where all the confederate states would have to ban it for slavery to be effectively illegal. They recreated the fugitive slave act.

[@beefcakepantiehoes]

Imagine that, confederate rebels being fascist authoritarians all along. Really unexpected 😂

[@SaraphDarklaw]

Who woulda thunk.

[@ShakeNB1ake]

No the south was a libertarians dream! Slaves were happy in bondage! /s

[@DrTssha]

I didn't see it coming, but I'm not exactly shocked at the revelation. Who knew those who advanced notions of southern nobility were in favour of authoritarianism the whole time? I mean, it's right there in the words southern nobility! Kinda obvious in hindsight...

[@MohamedRamadan-qi4hl]

You don't even have a definition of facisism. It means to you dictatorship and authoritarian. Stop projecting that ill defined term were it doesn't belong

[@Grizabeebles]

It's almost like believing that one group of people is innately superior to another is bad for society.

[@thesneakymemedealer5071]

i like how people argue that the confederacy was about states rights inspite of the fact that it's very own constitution forbid states from banning slavery and also had no way to allow states to ceased from it.

[@nicholasgonyea3833]

Agreed, or how Longstreet himself stated the rebellion was about slavery and nothing else.

[@bellacose3837]

Or how they trampled on the North's rights when it came to fugitive slave laws

[@pyromania1018]

@@nicholasgonyea3833 He freely admitted that after the war. Then again, he might not have had the LC not made him a scapegoat for all of Lee's mistakes.

[@anoon-]

Good ol west Virginia didn't give a shit.

[@forickgrimaldus8301]

Palpatine: Ironic

[@Jrome719]

Just discovering this channel. Good stuff! I love the neutrality and objectivity, especially as a Black pastor, theologian, and church historian. As we would say in our neck of the woods, you call a “spade a spade.”

[@cromtuiseagain]

The one lore bit about these two that I like is despite the impassioned debates that they still call each other good friends out loud

[@GoErikTheRed]

Is no one else gonna mention the cinematography of the end credits scene? Everything from the lighting to the choice of closeups to the acting was superb. When the guy sat up at the end I had actual chills. A+, I’m stoked to see what this means for 50’s man

[@justinlindfors8512]

I noticed the chess board

[@jacklennon1035]

he's a legitimately trained filmaker

[@bonniea8189]

@@justinlindfors8512 Apparently I need to re-watch it now

[@GrayCatbird1]

I’m a big fan of how these two are progressively becoming more brotherly to each other and Johnny Reb in particular becoming a lot more receptive and listening in good faith. Truly a more perfect union :)

[@kattastic9999]

Eventually they'll fuse together and become a sad man with regrets but hope for the future

[@thesurvivalist1996]

If only klaus could do the same...

[@cristoaldantes3222]

The man would be the United States back in one piece.

[@kattastic9999]

@@cristoaldantes3222 Like I said, a sad man with regrets.

[@devinsnightmare1506]

"both sides"

[@tonyjoestar2632]

I've watched this several times, but I just now caught that as Billy mentions the confeds becoming a global slave empire, Klaus's theme starts playing

[@OGRamrod]

What I love here is you genuinely see Johnny Reb wrestling at times with the awful truth that so thoroughly undermines his entire identity. Reminds me of a 15 year-old me. It wasn't a fun experience, but I'm better for it - and still a patriot of these United States.

[@patrickcleburneuczjsxpmp9558]

Patriots don't defend the destruction of America's founding principles: "But remember, that when South Carolina falls, she falls not alone. The suicidal hand which strikes down the sovereignty of the people of South Carolina, demolishes that of Massachusetts with it, and the whole fabric of American Liberty falls by the same stroke. Then not one star escapes from the galaxy of free sovereignties, but all are blotted out by this sweeping stroke of despotic usurpation. We are no longer a voluntary confederation of sovereign States, but each and all of us conquered provinces of a centralized and consolidated despotism. We of the North may be voluntary in this subjection, like the more degraded of slaves-yea, we may be the unnatural agents of it; but it is subjection still."

[@KrasMazovHatesYourGuts]

@@patrickcleburneuczjsxpmp9558 You have far too much faith in the founders and their 'vision' when said 'vision' was an imperfect and out-dated one.

[@patrickcleburneuczjsxpmp9558]

@@KrasMazovHatesYourGuts There's nothing imperfect or outdated about America's basic founding principle of government deriving its just powers from the consent of the governed. What's unjust and outdated is the Old World idea that rulers in some place have a permanent right to rule over the people of all the territories they currently or previously controlled like some divine right of kings except without God and without a monarchy.

[@Zomgnomnom1]

​@@patrickcleburneuczjsxpmp9558Why do the rights of the south trump the rights of those in the north? Choosing to leave has ramifications on those who don't, how do you determine the value of those 2 freedoms?

[@patrickcleburneuczjsxpmp9558]

@@Zomgnomnom1 Why do the rights of Americans trump the rights of the English? Choosing to leave has ramifications on those who don't, how do you determine the value of those 2 freedoms?

[@HelloFutureMe]

Just wanted to say I immensely enjoy your sense of humour and dedication to correcting historical narratives that so often go unchallenged.

[@bar0nv0nstrubel57]

You know a videos good when you see some of your other favorite KZbinrs in the comments

[@blacklighthologram5339]

Yeah this is definitely the kind of video I'd find you commenting on.

[@happygilmore1844]

love how he brings to light both perspectives from either side of the debate...clearly defined that it was the cause of spread of slavery that mainly brought about the civil war, that it was incumbent upon Lincoln to solve a national moral crisis....you know, REAL problems to worry about , not the nonsense concocted today by immoral people who have nothing better to do with their mundane existence

[@osurpless]

A lot often do. Especially why the “white race” was created in the first place after the start of the Columbian Exchange…

[@Titan-zn3fs]

Yes it's sad that the historical narrative that the civil war was fought over state's right's....."to own slaves" has been "accidentally forgotten". It's a good thing the attempt to change the FACT of the actual narrative will not change just because cowards want a made up excuse to "justify" their belief in a lie.

[@antaganon1179]

"Are you an anarcho-syndicalist?" Made me laugh way too much.

[@elitefencer777]

As an anarcho-syndicalist, me too! (Well, belong to a group of 'em, anyway)

[@Unidentified_Entity6]

mf played too much Kaiserreich

[@luisfilipe2023]

@@elitefencer777 I hope you’re joking 😂

[@antiantiderivative]

@@luisfilipe2023 Far better than being a confederate simp.

[@filiperosa7496]

Anarcho syndicalism is a ideology so valid as anarchism, a niche ideology who don't do anything

[@monkmchorning]

Slavery was protected by the constitution in states where it already existed. Had the South not seceded they could have held onto it longer. The conflict was about extending slavery into the western territories and enforcing the property rights of owners over the individual rights of slaves in jurisdictions that did not sanction slavery.

[@patrickcleburneuczjsxpmp9558]

> The conflict was about extending slavery into the western territorie The war certainly wasn't fought over any rights in the western territories. The seceding states forfeited all their constitutional rights (including all their rights in the territories) and fought for their independence, and independence and self-government is precisely what the Union fought against.

[@monkmchorning]

@@patrickcleburneuczjsxpmp9558 the southern plantation system needed territory for expansion. Had secession succeeded, the two nations would have competed for the west. Was secession constitutional? I guess with enough violence anything is constitutional.

[@LoneBlackBear]

I as a native, appreciated it when, "Im sure they offered up many thoughts and prayers."....

[@armphidiic2609]

I laughed out loud at several points but most at: "I would have been an abolitionist back then." "Shut up."

[@waroftherebellion.]

My grandfather told my mother he would have been a nice slave master to his slaves. So that type of rhetoric makes sense.

[@catnerdadrian7601]

@@waroftherebellion. pretty sure a "nice slave master" wouldn't be a slave master. Cuz it's kinda hard to be nice while denying people their rights

[@elmascapo6588]

@@catnerdadrian7601 well, for one you could not whip (that's how you write it, right?) them nor burn their backs with hot irok to mark them as your property, in the same way that you would a cow

[@waroftherebellion.]

@@catnerdadrian7601 No one said he was smart and I don't talk to him.

[@Qba86]

@@catnerdadrian7601 Perhaps someone who was given a slave as a gift from a family member, waited for a while, so as not to offend said family member, and then freed the slave would qualify as "nice". Grant was that kind of guy. Hard to think of any other example of a "nice slave master" that wouldn't be an oxymoron.

[@gamesandstuff7966]

Absolutely insane to me that this series managed to find its way to the one guy who both believes the Lost Cause myth and also knows enough about the left to know what an Anarcho Syndicalist is

[@nemoy7267]

As someone who's a hair's breadth away from being an Anarcho-Syndicalist, I can't describe the immense confusion and joy that moment gave me.

[@connorcharette7132]

He could just play Kaiserreich.

[@jerkjerkington3874]

That's not that surprising. I've met plenty of people who swap sides between far left and far right. Usually they're just out-of-touch goofballs who don't know anything about the real world, so they adopt extreme positions that seem like they make sense in theory. Left and right are just the flavor du jour for them.

[@disappointedmess209]

@@connorcharette7132 a hoi4 player being a lost causer seem more likely

[@Frostyman452]

@@disappointedmess209 As a guy who plays HOI4 most players are wehraboos or tankies, wouldn’t surprise me if there are lost causers who play the game. Mostly because you can declare the Confederate States of America if you turn Fascist as the US.

[@itschudobs]

Yesterday, for a final assignment in my pop culture class, we were to discuss a piece of pop culture that had negative outcomes or stereotypes connected to a certain group or people. I did my paper on 1939's Gone With The Wind, about how left-over Lost Cause myths infected the production of (almost all Civil War-era media of the times but especially) the movie and the horrifically inaccurate depictions of slavery and slave-holders. I cited this video while talking about this racist and incorrect post-war history in a section talking about how we could more accurately view the history that the piece of pop culture content was depicting. Never in a thousand years could I have predicted I would have enjoyed watching any kind of Civil War media (outside of Ken Burns when I'm bored watching PBS) but you have made this topic endlessly fascinating and I love your content!! Thanks for what you do and for the (albeit strange) contribution to my paper 😂

[@ramblingsofadash5159]

I grew up in MS my entire life. Late middle and early high school I really came to understand state rights vs federal government. I realized that in some states states rights will create a better life for it's citizens while living in MS I was forever thankful for the Federal Government keeping a rope off my neck and being allowed to be educated while being gay. My class mates and even teacher were extremely hateful to LGBTS with some calling for their deaths and when asked why they didn't do it they replied "Id go to jail for it". If MS was able to choice it's laws with no interfence from the US government then LGBT would be illegal and I could be killed just cause I loved someone of my same sex. It opened my eyes so much on why a strong central government is needed to protect those who's state refuse to or even want to hurt them.

[@matthewchapman6305]

That’s true WHEN the feds are on your side. Ironically, you don’t hear far right conservatives or Lost Causers champion state/city rights with cities and states that refused to enact EXTREMELY illiberal and oppressive federal laws, like the Fugitive Slave Law mentioned in this video.

[@amongsttheruins4490]

🎻

[@Zebraman220]

I’m sure people hate you and all that but your not getting killed for being gay

[@ramblingsofadash5159]

@@Zebraman220 en.wikipedia.org/wiki/History_of_violence_against_LGBT_people_in_the_United_States?wprov=sfla1

[@xgcsurreal2608]

@@Zebraman220 Alan Turing a brillant mind who is widely considered the father of Computer science and who broke the Enigma Code saving British and American sailors from German U-Boats in WW2 was gay. Do you know what they did to this brillant man and hero after the war? He was arrested, chemically castrated, almost thrown in prison, and ultimately driven to suicide.

[@noisyrhysling]

I don't know which is more impressive... The fact that he was able to find all those recordings of so many old speeches or that the current President of the United States was willing to be on his show!

[@rockicwifffyre]

Ikr!!!!!! I am very surprised he found a LIVING BREATHING confederate and yabkee who wants to be in his show!!!

[@TheDenimdoug]

The closing authoritarian quotes provided me with a profound sense of dread. Well done as always sir, you have both educated and entertained. While I hope this is not the end of the series, you will certainly be going out on a high note if it is.

[@petermartinez4399]

To my knowledge there will be 2 more episodes

[@historiansayori2089]

Yeah, half of that shit sounded like something that the Dominion of Draka would say en.m.wikipedia.org/wiki/The_Domination

[@gratuitouslurking8610]

Referencing Palpatine was a great primer for the batshittery to come, yes.

[@fumarc4501]

I was also terrified.

[@daehr9399]

I remember as a child growing up in Iowa finding so many small Civil War cemeteries scattered everywhere. Small, sunken, tombstones marking a young man's death every few feet. It always brought me great sadness, seeing the dates line up with major battles...very sad.

[@meanmutton]

The weird retconning that the Civil War was about "States Rights" when the Confederacy has all the same state's rights as the US except one: states were prohibited from banning slavery.

[@onemanarmy2electricboogalo687]

In before the corwin amendment

[@patrickcleburneuczjsxpmp9558]

> states were prohibited from banning slavery. That may be a nice myth if you're looking for excuses for rejecting the consent of the governed as the basis of just government, but it's a complete lie: the Confederate constitution did no such thing. Do you have any arguments that aren't based on clearly disprovable lies?

[@coolguy8829]

Is it just me or does Johnny Rebel get smarter each episode?

[@ladnie9454]

My guess is that the series is going to end with him deciding that Billy Yank is correct.

[@kfizz21]

@@ladnie9454 to be fair, this is likely the end of the series, and he kind of did.

[@historymarshal2704]

@@kfizz21 No. Atun-Shei said there will be ten episodes total. This is eight. We are definitly building up to the series finale, but are not there yet.

[@_somerandomguyontheinternet_]

I’m honestly glad that he was presented as being kinda horrified by the revelations as the sanitized revisionist history is peeled back to reveal the truth.

[@akramgimmini8165]

*Impossible*

[@impcec6734]

I really love these videos! To think: a man cloned himself, raised the clone to believe he was a soldier in the confederate army, and taught him to only speak in KZbin comments! All to make these lovely videos for us! That’s commitment. Edit: I was very high when I wrote this comment

[@tbotalpha8133]

I want some of whatever you had, please.

[@devindalton4688]

Strain, please

[@ablunt-headedtreesnake6094]

The edit really makes this comment

[@OpalBLeigh]

Is that what all the lost causes are? Just like, one clone with lots of alts? That actually makes me feel better lol

[@hand13932]

dude this is so me when I smoke a weed and there’s purple dragons bro

[@KouenTenshi]

I was terrified to hear there's a separate timeline where the south agreed with some constitution to avoid war and preserve slavery indefinitely. But they were too greedy to take it.

[@patrickcleburneuczjsxpmp9558]

The South never proposed or agreed to any such thing, but the North offered.

[@TheDarthbinky]

Sort of. The Crittenden Compromise was proposed by John Crittenden, a Constitutional Unionist (basically conservative former Whigs who refused to join Dems or GOP) from Kentucky. It was a Constitutional amendment that would've reinstated the Missouri Compromise while also making it illegal for Congress to otherwise pass any laws restricting slavery in any way. The South generally wanted to pass it but the North, particularly Lincoln and the GOP, refused to consider it, on the grounds that they opposed expansion of slavery into new territories (there was still hope that the US could annex Mexico and/or Cuba). Edit: and yeah, there's the Corwin Amendment, but the video covers that. Corwin was a Republican from Ohio, and his amendment simply made it illegal to interfere with slavery within states - thereby excluding newly acquired territories. And the South opposed that because they wanted to be able to expand slavery into new territories. A handful of northern states plus Maryland (technically a slave state) ratified it when the war started and effectively killed it.

[@patrickcleburneuczjsxpmp9558]

@@TheDarthbinky "The South generally wanted to pass it" Not true. "The South generally" had already seceded and basically didn't really express any interest in or concern with whether the Union wanted to pass it or not. The future Confederate states that hadn't yet seceded weren't opposed to it but didn't really care about it either and weren't appeased by the offer. "a Constitutional amendment that would've reinstated the Missouri Compromise" Not true either. It didn't require or involve any compromise from slaveholders. It reinforced constitutional protections of slaveholders' interests and that was all. It was entirely a concession to slaveholders. "but the North, particularly Lincoln and the GOP, refused to consider it" Wrong again. Congress passed it with the necessary 2/3 vote through both chambers even without support of the representatives of the southern states that had already seceded and withdrawn their representatives. And it went to the states for ratification with Lincoln effectively endorsing it.

[@matheusarruda6462]

As a Brazilian I am always amazed to see a reference to the Confederate runaways in southern Brazil. One of many dark marks in our history and also one of its most unknown.

[@rogerkeleshian2215]

I am also Brazilian, I hope he covers our history sometime hopefully my ancestor Floriano Pexioto the Iron Marshall.

[@matheusarruda6462]

@@rogerkeleshian2215 I'd like that as well. Peixoto was a monster, but an interesting monster.

[@renatopba]

I love this webseries and was glad and surprised Campinas and São Paulo being mentioned. Confederates who fled to Brasil founded Americana City at that State, the richer in our country.

[@renatopba]

@Kraus von Grat Emperor Dom Pedro did gave shelter for those fled confederates. He was also an admirer of Lincoln and went to the US duriing Grant's presidency.

[@alnu8355]

Oh I heard of those guys. "Confederados". After the war, Confederates were invited to build and create farms in Brazil. Problem was the climate and ecology in Brazil was not suited to grow their crops. Anyway a lot of their descendants now get together once per year dressed as Confederate officers with antebellum era music, dancing, and food.

[@trumpeterjen]

Can't really fault Johnny Reb for barely remembering the events of episode 1. Billy Yank did shoot and kill him at the end, after all.

[@hithedragon7842]

Maybe it really was some other confederate officer

[@ntpgmr]

@@hithedragon7842 Nah, same person. However, in the lore, the maker of Atun-Shei films is the one who shoots him in the first video, while Billy Yank shows up next episode.

[@TheChronicHistorian4real4real]

´´States rights to do what?´´

[@austinweaver5649]

This whole series really proves the adage that it's much easier to make a false claim than it is to disprove it.

[@danaroth598]

Speaking of the Fugitive Slave Law(s) and also a small nullification crisis: one of my favorite, sadly obscure pieces of Wisconsin history is a case called Ableman v. Booth, which stemmed from an incident where a mob of abolitionists broke an escaped slave out of jail and sprinted him to Canada. The feds wanted to punish one of the abolitionists, and Wisconsin's Supreme Court essentially told the federal government to suck it, the abolitionist could be released. (And also that Wisconsin held the Fugitive Slave Law unconstitutional and refused to enforce it.) SCOTUS told them 'you can't do that' in the Ableman case ... and Wisconsin responded by refusing to file the decision when it reached them. We still haven't!

[@TheStapleGunKid]

Oh that's just one of many conflicts over slavery that happened in the 1850s before the Civil War. Have you heard of the Christiana riot in Pennsylvania.

[@patrickcleburneuczjsxpmp9558]

It's completely twisting the historical definition of "nullification" to apply the word to attempts to nullify provisions of the constitution itself as opposed to nullifying acts of the federal government that lack constitutional authority.

[@Justanotherconsumer]

@@patrickcleburneuczjsxpmp9558 it’s not really that different. As far as the state is concerned, in both cases, they are refusing to obey what they see as a federal overreach. The tariffs of classic nullification were explicitly involving foreign trade - the exclusive domain of the federal government. They were far more legitimate as an act of federal authority than the fugitive slave acts anyway.

[@setlerking]

Gigachad Wisconsin

[@willw5868]

Based Wisconsin moment

[@coffeemaiden7915]

Wow it’s been 3 years already? so… if there’s another installment of the series in the next year, that means Checkmate Lincolnites would have lasted more than the confederacy?

[@robertaylor9218]

I love the opening vibes of “cool, we both agree my side was in the wrong morally and had an objectively evil motive. So I win.”

[@misterbennnn]

"Mel Gibson arrested again for drunk driving, surprises officers with anti-racist tirade" good god lmao