SHOTGUNS: The Right Tool for the Wrong Player

  Рет қаралды 3,294,430

Arch

Arch

Күн бұрын

Пікірлер: 5 900
@Verbose_Mode
@Verbose_Mode Жыл бұрын
A huge thing for balancing shotguns is actually _the number of pellets._ More pellets makes it more consistent, with a missed pellet meaning less. Edit: Dividing the damage between pellets is more complicated than my initial two sentences implied. Lets say your shotgun deals 100 damage total. The spread is 1m at 50m range. If it only shoots 5 pellets at 20 damage each (buckshot), the odds of all the pellets hitting at longer ranges falls. Each one that DOES hit will chunk something, but it might be possible for every shot to cartoon-outline your target. This is _volatile_ damage, high highs and low lows. If it shoots, say, 20 pellets at 5 damage each (birdshot, basically), the spread is going to be more even. Yes, less will hit at longer ranges, but the odds of cartoon-outlining your target are WAY lower. You'll always get SOME consistent damage in. Where this gets really interesting is when damage reduction mechanics, specifically flat damage reduction, come in. Lets say the damage is reduced by only 2 points per instance of damage. Suddenly, the buckshot damage is much better, because it does 90 damage on a meatshot, while the birdshot is utterly shafted and only does 60. While realistic that birdshot is terrible to armor, this could cripple your game balance without special consideration. There are a lot of levers to adjust, number of pellets being one of them.
@McCaroni_Sup
@McCaroni_Sup Жыл бұрын
So, Birdshot?
@christiandelao2547
@christiandelao2547 Жыл бұрын
A lot of games actually don't give a head shot bonus to shotguns, and divide damage between the 8 pellets in a 12 Guage shell, making them less effective over distance as spread increases, what balances the shot gun is reload speed, taking much longer to reload less shots but with high damage
@IncredibleMD
@IncredibleMD Жыл бұрын
@@McCaroni_Sup Well, birdshot also has SMALLER pellets.
@C0MR4D3C0WB0Y
@C0MR4D3C0WB0Y Жыл бұрын
I remember when BF4 changed the shotguns, most of the shotguns where incredibly underpowered from the defensive spec reducing body damage. Most shotguns had around 8-10 pellets. DICE changed it to the semiautomatic shotguns had 14-16 pellets and pump guns had 16-20 pellets and it broke the damn game. Assault rifles suddenly where far less effective even in bigger maps due to the number of pellets the shotguns where throwing. They timed it down but those guns are still surprisingly effective at ranges most shotguns wouldn’t be effective. Also not to mention Insurgency Sandstorm…
@christiandelao2547
@christiandelao2547 Жыл бұрын
@C0MR4D3C0WB0Y typical shot gun has an effective range around 150 meters, with shot, and with slugs it's not much shorter then most rifles something like 300 meters
@RawBerserker
@RawBerserker Жыл бұрын
I think there is no more satisfying gun to use in a game than a well functioning shotgun. Even if it's not the "optimal" choice, I'd go for it every time.
@Numbskulli
@Numbskulli Жыл бұрын
Shotguns are my favorites as well. Sad that some games i play make them underpowered or they stop working as soon as the enemy is 2 feet away.
@randomplaceinruralamerica9618
@randomplaceinruralamerica9618 Жыл бұрын
Shotguns are really nice feeling but a revolver will always be my go to pick even if it usually doesn’t do enough damage to oneshot in the body and has a worse fire rate than most sidearms, pulling out a revolver and getting a headshot just feels so good.
@2BrosOfficialGaming
@2BrosOfficialGaming Жыл бұрын
same
@TheKirBoi
@TheKirBoi Жыл бұрын
If there's ONE gun you don't wanna mess up, it's the shotgun.
@imgonnacream
@imgonnacream Жыл бұрын
all of you cannot aim high sens + decent ish tracking means easy kills with no aim
@shanweeboy
@shanweeboy Жыл бұрын
The spas-12 was made to be a police shotgun. It had the pump mode on account of the non lethal loads not having enough chamber pressure to cycle the weapon in semi auto mode. They did the pump mode for those shells.
@jamesbailey6257
@jamesbailey6257 Жыл бұрын
Gonna be a pendant here because I feel like it's a time it actually really matters, not non lethal, less lethal, less lethal rounds still can and do kill people because it turns out firing ammunition at protestors isn't exactly safe
@whytho1690
@whytho1690 Жыл бұрын
Neat tidbit
@superpilotdude
@superpilotdude Жыл бұрын
clever girl
@mathewsvr5355
@mathewsvr5355 Жыл бұрын
This is true, but generally with how bulky the spring was even some standard loads wouldnt cycle all the way. But yes I 100% agree
@shanweeboy
@shanweeboy Жыл бұрын
@@mathewsvr5355 Yeah it was a chonk gun.
@thedomainofsealteamaqua
@thedomainofsealteamaqua 10 ай бұрын
the "shotgun" is basically the equalizer: even the newbie's can use it, and the pros fear it.
@tabula_rosa
@tabula_rosa Жыл бұрын
i replayed Doom 2 recently & realized part of the reason the shotty feels so good to use is that the damage falloff isn't artificial, it fires a bunch of pistol shots with the same damage & range as a pistol, and how much damage it does depends on how many of the pellets lands -- if you're close enough to cluster the enemy you do full damage, no matter how far they are means not only can you chunk single enemies but if ur firing into a crowd and each pellet hits someone ur still doing full damage, even if ur 40 feet away circlestrafing their fireballs
@ssjbread2803
@ssjbread2803 Жыл бұрын
Also, the original Doom shotgun lacks vertical pellet spread, which gives it a surprisingly REALLY strong medium range game and allows it to make do as an impromptu sniper rifle in a pinch, as you're pretty much guaranteed to get at least a couple of pellets on target at any given distance. The super shotgun lacks this boon, but makes up for it by both possessing more pellets AND dealing more damage per pellet, making it serviceable in medium range, ineffective at long range, and doing equivalent damage to the ROCKET LAUNCHER at point blank range. The shotgun is less a "shotgun" in the role it fills and more your workhorse rifle; the super shotgun fills the genuine "shotgun" role, and does a DAMN good job at it.
@hi-i-am-atan
@hi-i-am-atan Жыл бұрын
@@ssjbread2803 also, all the doom 1 hitscan weapons have the exact same spread, so even without the quirk of completely horizontal spread, the shotgun has completely average accuracy anyway. the pistol and chaingun still have the advantage at long range due to having perfect accuracy when tap-firing, but long range encounters are pretty rare in doom 1 furthermore, both shotguns benefit significantly from two quirks: each pellet is only traced after the prior one has already done its damage, and hitscans pass right through actors that aren't shootable - including monsters whose hp just hit 0. this is the reason you, unfortunately, can't ever gib so much as a zombieman with a shotgun shot, even with the ssg at point blank, but it also has the far more useful consequence of letting excess shells "penetrate" on lethal hits. this is a _major_ reason why the ssg is so excellent at crowd control, as the full 20 pellets can distribute themselves with extreme efficiency to wipe out groups of mooks instead of all getting caught on the unlucky mob in the front and center. just another trait that makes the shotguns such great workhorse guns!
@rafaelcastor2089
@rafaelcastor2089 Жыл бұрын
Not an FPS, but i love the shooty in Intravenous for pretty much the same reason. It has a lot of spread between each pellet, yes, but the fact that they actually behave like somewhat like pellets actually behave in real life means it does a fuckton of damage and you don't even need to really aim, just point it at the general direction of guy and, unless he is far away, he is gone. The stealth part of the game is cool, but clearing a whole ass mob within 5 second is priceless
@helloagain.andagain.andagain
@helloagain.andagain.andagain Жыл бұрын
try ultrakill
@aircraftcarrierwo-class
@aircraftcarrierwo-class Жыл бұрын
The Super Shotgun is so beefy because while it consumes 2 shells of ammo, it fires 3 shells of pellets (21 pellets vs 7 from the regular shotgun). The Shotgunner enemy fires the exact same pellet, but only 3 of them. Doom was rather clever in balancing its shotguns around the number of pellets, with all the pellets otherwise behaving the same.
@russellhassan7773
@russellhassan7773 Жыл бұрын
i love how shotguns function in high ttk shooters like team fortress and quake; when shotguns don't/can't easily one shot, they become a very skillful weapon since you need to hit all your pellets to maximize your damage output.
@SyRose901
@SyRose901 Жыл бұрын
Those games lack the omega strong assault rifles; and machineguns deal as little as 5 damage per shot, and even the Lightning Gun deals 160 per second, with Quake having players be able to achieve as much as 400 effective health, the shotguns become very, very balanced as it is the only weapon that works perfectly at point blank range or close range. Quake's Lightning Gun or TF2 Minigun both shred opponents at this range, but they're hard to use compared to the shotgun. At farther range, rocket/grenade launchers do better. Railgun/Sniper Rifle is king at long range.
@pancakeperson8905
@pancakeperson8905 Жыл бұрын
@@poleve5409 The Sniper Rifle (TF2) is an infinite-range insta-kill weapon that has sparked numerous debates within the community for not belonging in the game.
@smokey3504
@smokey3504 Жыл бұрын
There are games with low TTK where hitting all your pellets with a shotgun is a skill barrier. I've been playing alot of COD WWII lately and the M30 Luftwaffe Drilling has such a tight spread and low base damage that it requires the player to aim with it accurately like a slug shotgun. In return it takes people down in one-shot at a range where other, easier shotguns can't even deal any damage
@DexieTheSheep
@DexieTheSheep Жыл бұрын
hell yeah, like the lever/tac in Fortnite
@colbyboucher6391
@colbyboucher6391 Жыл бұрын
Yeah, this guy's videos are all about a *very specific* sort of shooter and there's a reason this *very specific* sort of shooter didn't get popular for a while, it inherently introduces balance issues like this. Better yet, go the Halo route and make your OHK shotgun a pickup people fight over. Just acknowledge that it *is* insanely powerful.
@SaltSpirits
@SaltSpirits Жыл бұрын
Fun Shotgun Fact: While your average 12g shell will come in a variety of colours, from your standard red, to blue, green, and everything in between, they will *never* be yellow. This colour is reserved for 20 gauge shells and acts as a warning sign to help prevent one from loading the wrong shell into the wrong gun.
@cevatkokbudak6414
@cevatkokbudak6414 11 ай бұрын
Cool
@rebel6301
@rebel6301 11 ай бұрын
interesting, thank you for sharing
@cavemanthog
@cavemanthog 11 ай бұрын
There are also Bolt-Action Shotguns
@Boristhaspydr
@Boristhaspydr 11 ай бұрын
Do 16 gauge do that I purple too?
@gameingwiththewolf8440
@gameingwiththewolf8440 11 ай бұрын
Don't get me wrong I love the 20 gauge but the reason why 12 gauge is still used is because it was the one that least jammed the most newer models are more prone to jamming than the older ones
@GoobertNoobster
@GoobertNoobster 6 ай бұрын
Doom eternal: like it or not, you're playing with it, bucko
@Batchall_Accepted
@Batchall_Accepted 3 ай бұрын
"I'll have a pistol please" "A shotgun?" "No, a pistol... Pis-tol" "Shot-gun" "P-I-..." "S-H..."
@smolfishyboi7887
@smolfishyboi7887 2 ай бұрын
​@@Batchall_Accepted "P-I-..." "P-I-..." "...S-T..." "...S-T..." "...O-L" "...O-L" "PISTOL" "SHOTGUN"
@chowbox87
@chowbox87 Жыл бұрын
Battlefield 4 made an interesting solution, they had 2 zones where random pellets could land. Most would land in the center, say 5 of the 8 pellets. Then the other 3 are spread in an outer circle, so that when you’re in point blank range you’ll likely hit all or most of your shots but as you go out, you have to be more careful aiming, utilizing the consistency of the inner pellets to get headshots
@jodlaa5142
@jodlaa5142 Жыл бұрын
and in bf they have a lot longer range than something like cod if I'm not mistaken, I remember playing bf4 for the first time and seeing a normal buckshot shotgun kill pretty consistently in 1-2 shots from ranges which would be max range in cod, I think it was because in cod pretty much everything is hitscan and shotguns are coded in a way that after a certain distance the pelets just disappear, while in bf, where I think everything is a projectile, they get to travel longer and still do solid dmg at like medium range
@chowbox87
@chowbox87 Жыл бұрын
@@jodlaa5142 yeah definitely, plus you know a conquest flag can be the size of some cod maps so everything needs stretched out a bit
@Saurygiel
@Saurygiel Жыл бұрын
XDefiant uses the same exact technique. I found that out when using their firing range, which I thought was pretty smart.
@BenignStatue71
@BenignStatue71 Жыл бұрын
I believe Battlefield 4 uses a headshot multiplier of 1x; as in it doesn't deal any more damage to a target (except for Slugs). Shooting the Buck and Flechettes at players is best done to centre mass and nowhere else.
@BusinessWolf1
@BusinessWolf1 Жыл бұрын
You just described cone recoil, which every decent game uses. No shit.
@AxiamWolfe
@AxiamWolfe Жыл бұрын
The roster of shotguns in Titanfall/Apex Legends approaches the design in an interesting way. None of the shotguns have random spread, and you get to choose between: - Horizontal Spread of Mastiff - Star-shaped spread of Peacekeeper, with ability to ADS and compress the pellets into a single point - Funky 8 shaped spread for the Auto EVA-8 - 3 pellets for the Mozambique
@ajh3461
@ajh3461 Жыл бұрын
Similar thing with the Panic Attack in Team Fortress 2, although TF2 also has fixed spread in comp
@gentlefauna
@gentlefauna Жыл бұрын
Honestly peacekeeper was the gun i thought of when he was talking about the pump shotgun
@erinkarp
@erinkarp Жыл бұрын
mozambique here!
@bear3616
@bear3616 Жыл бұрын
The mastif was a very fun weapon. You often need to lead your shots quite a bit when going fast. And being good at it is amazing.
@flazerrazer2992
@flazerrazer2992 Жыл бұрын
the mozambique also has a choke like the peacekeeper just cant be toggled
@CaptainTechnicalityLP
@CaptainTechnicalityLP Жыл бұрын
Worth noting that TF2 has the fixed pellet patterns for shotguns. Normally this is enabled as a server option, which is usually used in competitive play, however, there is also a shotgun in the game called The Panic Attack that has the fixed spread pattern as a built in stat.
@notgray88
@notgray88 Жыл бұрын
panic attack is so underrated. it might not be the most powerful shotgun in the game, but it's really fun to use
@thedog5k
@thedog5k Жыл бұрын
@@notgray88 Uncle dane says its legit I feel like its legit. Idk, i think its legit :)
@Benneth12
@Benneth12 Жыл бұрын
gun
@IndonesianKomodo
@IndonesianKomodo Жыл бұрын
Yeah that luck cap thing he said is bassically CoDM sg ads BSA
@Dryfloorsign
@Dryfloorsign Жыл бұрын
the panic attack is probably the best shotgun only behind the family business, or maybe engineer shotguns
@Jhet
@Jhet 4 ай бұрын
Ahoy is now a genre. I love the quality of this channel and i don't think it's a knockoff. Let's just hope the other channels that try this style keeps up the quality.
@Trashedac
@Trashedac Жыл бұрын
The slug idea is pretty smart in my opinion it wouldn’t fit perfectly in every game but I still think it’s a good idea
@jtjoemamma
@jtjoemamma Жыл бұрын
They did it with the ksg in black ops 2 and others
@mrvandal131
@mrvandal131 Жыл бұрын
Yes, I liked the idea as well
@RiggedFem
@RiggedFem Жыл бұрын
Destiny 2 also has a system where the slug shotguns are completely separate from the other shotgun frames. God if he thinks nos shotguns in other games are diverse, wait until he discovers precision frame shotguns in D2
@The_Questionaut
@The_Questionaut Жыл бұрын
I prefer slugs, it makes the shotgun more fun.
@JustABaptistApoligist
@JustABaptistApoligist Жыл бұрын
@@RiggedFem or warframe’s many shotguns and custom guna
@p5ychojoe138
@p5ychojoe138 Жыл бұрын
I used to hunt with slugs growing up. Was pretty darn accurate with them, too. Always frustrated me when I knew they were in range but the game would say "no" even with slugs.
@xtvernon15
@xtvernon15 11 ай бұрын
Ksg In bo2 was I think the perfect representation of them wile staying “balanced”
@Grim_Erudite
@Grim_Erudite 11 ай бұрын
Indeed
@ryang2573
@ryang2573 11 ай бұрын
There are a lot of things, even in 'realistic' games, associated with guns that are either tweaked or omitted entirely for the sake of gameplay. What you said is just a subset of the larger problem of realistic firearms just being too lethal to be much fun in a video game. Even if someone is wearing body armor or is shot in a non-vital area, it really doesn't matter all that much what they're shot with: they're going to be hurting and, in some cases, probably severely injured as well. This is especially true for shotguns. If someone is shot by a garden variety 12 gauge loaded with 00 Buckshot, they're going down. Whether they get up again is a function of how good their body armor is, but - at a minimum - they are not going to be very combat effective for a while.
@cdogdeluxe6037
@cdogdeluxe6037 11 ай бұрын
Only more realistic games that have very fast times to kill can properly represent shotguns without breaking the game.
@sosig6445
@sosig6445 11 ай бұрын
@@ryang2573 So a realistic game would kill you in 1 hit if you have no armor and stun you if you have armor
@Fluffypancakes-o7q
@Fluffypancakes-o7q Жыл бұрын
Shotguns in games: confetti Cannon Shotguns IRL: *Non-scoped crit-boosted sniper rifles* Edit: thanks for likes, and "Tonk Fortress 2" will be released soon! ^_^
@bradley4465
@bradley4465 Жыл бұрын
body armor eradicates shotguns. also sustained fire sucks ass.
@BierBart12
@BierBart12 Жыл бұрын
​@@bradley4465 body armor turns shotguns into extreme stun guns, unless one pellet hits your head
@donny8652
@donny8652 Жыл бұрын
​@@bradley4465those guys are wearing body armor! Loads homemade white phosphorus shell
@tabnk2
@tabnk2 Жыл бұрын
@@bradley4465 the slug in question:
@TechnicalOveride
@TechnicalOveride Жыл бұрын
nothin like people who don't have combat training debating on how good a shotgun is in combat not saying i know what i talk about either, i just think you're all wrong
@MrNobody-zx4jz
@MrNobody-zx4jz 11 ай бұрын
Very beautiful and professional made! Congrats! I want more content like this, you really have imagination and know how to express yourself, wish the best.
@Zorro9129
@Zorro9129 Жыл бұрын
Shotguns with realistic range are balanced in games with realistic ranges, because you still have a disadvantage at longer ranges in exchange for an advantage at shorter ranges. Combine this with buckshot having much less effectiveness against good body armor, and it becomes a very balanced weapon.
@ADMICKEY
@ADMICKEY Жыл бұрын
Cough phantom forces cough
@zyad48
@zyad48 Жыл бұрын
Yeah Insurgency Sandstorm kind of gets this, that said a lot of that game _is_ with indoor objectives and such, so shotguns kinda end up being extremely effective overall, even if the .50 cals can basically one-shot you through several walls and LMGs are insane on the bipod.
@Nurse_Xochitl
@Nurse_Xochitl Жыл бұрын
As I always say, realism balances itself out. But dumb fucks want shotguns and snipers/DMR nerfed to oblivion, while they want SMGs and ARs buffed.
@tylerjohnson7204
@tylerjohnson7204 Жыл бұрын
Hell Let Loose is a very good example of this. You can easily kill within 70 or so meters but beyond that you need a few shots unless a pellet hits a head.
@eon2330
@eon2330 Жыл бұрын
Yes and no. Sadly most games don't even balance shottys in those games. Fact is shotguns are THE BEST handheld anti-human non-explosive weapon at 200m or closer. Its like a grenade you instantly detonate facing someone. Especially the full auto ones. The problem all game developers have is balancing automatic shotguns vs the semi autos vs smgs. Shotguns ironically should have longer range than most SmGs and overall faster firerate and projectiles IRL. Handguns are pointless. Smgs are sidearms not main weapons. This is the problem with balancing. Lmgs, Ars and shottys are the 3 main weapons. Snipers/dmrs are just higher caliber or more accurate AR(should just be a mod or attachment). So they use similar ammo and should have the same damage but more range or pen. Games don't EVER get that right. Even tarkov messes that up and doesn't have any semi-full auto higher caliber weapons. Like a scar or battle rifle. Fact is. Weapons like the aa12 should be THE only viable close range weapon. The 7.62 ir 5.56 weapons the only viable mid range, and the snipers the only viable long range. Mid range being 200m+ Long range being 450m+ Most games don't have any reason for you to fight at 400+m. Thats the problem. So everything gets claustrophobic. Smgs are sidearms for spec ops missions. They are the "don't shoot the airlock accidentally and over pen" weapons. Don't kill the hostage etc.
@mcsmileycorp
@mcsmileycorp Жыл бұрын
While not realistic I always liked how the titanfall games and apex handle it's shotguns, each gun having fixed and interesting spread patterns useful for different scenarios and rewards high skill players by giving them optimal points to aim for on opponents.
@reiarukaza7490
@reiarukaza7490 Жыл бұрын
the fact that they flip the problem at its head by making the pellets only spread within the reticle blows my mind, as it really becomes a high skill floor weapon that really rewards accuracy with high dmg output, not to mention in combination with the fast paced gameplay
@bear3616
@bear3616 Жыл бұрын
They were extreme fun. Sadly I haven’t been able to play it for a while. I’m on X-Box.
@zyad48
@zyad48 Жыл бұрын
well, titanfall 1 at least Sadly the Eva-8 Auto in Titanfall 2 is a complete luck-based disaster after the nerfs :( I very clearly recall this because it pissed me off to no end, I played after the nerfs, amped the Eva (amping weapons reduces the number of shots required to kill by one, and for shotguns reduces the number of pellets needed for a one-shot by one) which would mean I only need to hit _3_ out of the 8 pellets it fires to get a kill flew directly into a guy and pull the trigger at point blank range, only to die right after and see on the killcam that he had only been hit by _one pellet_ The Eva in Apex does definitely have something going on that makes its spread more consistent though, but that speaks more to Respawn realizing how bad they screwed up a lot of the balance and gun designs in Titanfall 2 than anything else lol. (The R-201 in Titanfall 2 is an incredibly high recoil, low damage """rifle""" that only works because of the insane aim assist controllers give it, meanwhile the R-301 in Apex is a lovely smooth and very accurate proper rifle and even has a sort of recoil pattern to it as well, compared to the random mess of vertical and horizontal recoil in Titanfall 2)
@Bone220
@Bone220 Жыл бұрын
Titanfall 2 is just honestly the Superior game in my opinion. It's underrated and sadly abandoned but Titanfall 2 was such a fun game, amazing campaign and a multiplayer that's genuinely replayable.
@JohnSmith-kt3yy
@JohnSmith-kt3yy Жыл бұрын
Wait is that why the shotguns in apex feel like shit?
@samuelantoniocastillomeza5034
@samuelantoniocastillomeza5034 Жыл бұрын
As a former owner of a Mossberg 500, I'm already loving this! Pump action shotguns are so satisfactory.
@wr3nche5
@wr3nche5 Жыл бұрын
i own a mossberg 88 (a cheaper version of a 500 that still functions just as well) and i can confirm this
@Abel-Alvarez
@Abel-Alvarez Жыл бұрын
Mossberg 590 shockwave here🔥 They're so cool. My next plan is to go for an Ithaca model 37 and a Winchester lever action. 🤘😮‍💨
@floofyboi7546
@floofyboi7546 Жыл бұрын
@@Abel-Alvarez I recently purchased my first firearm, 590’s are amazing. Im just sad most indoor ranges don’t allow shotguns
@Abel-Alvarez
@Abel-Alvarez Жыл бұрын
@@floofyboi7546 would it be because of those that use birdshot/buckshot would bounce around the walls creating a safety hazard? Or something else entirely different?
@floofyboi7546
@floofyboi7546 Жыл бұрын
@@Abel-Alvarez I have no clue, I just tried all my local indoor ranges and they told me no shotguns
@somo4227
@somo4227 6 ай бұрын
no gun will ever feel as good as the shotgun in tf2 universally used and reliable while not overshadowing other weapons,i especially love using it on soldier beacuse people expect me to bring out the shovel when they get close
@autismusmaximus4933
@autismusmaximus4933 Жыл бұрын
The Shotgun in Insurgency Sandstorm is quite a tale in itself It is pretty much the most realistic representation of a shotgun in a video game. You WILL get domed by a shotgunner from 50 Meter away. In this game, the primary upsides are that Shotgun is cheap, meaning you can run it alongside a lot of other equipment, and that it is light, since it is basically just a pipe that shoots bucks, and you run with only a little ammo to slow you down. Its spread is so tight that you still need to properly aim this gun even at the closest ranges, and the fact that it one hit kills everything is overshadowed by the fact that pretty much every weapon does so. It's main downsides are that it fires very slow, only a sixteenth of the M4 (detremental when every shot is lethal) and that it has a rather long profile (The shorter the profile of a gun, the closer you can stand at a wall etc. the physical length of a gun is a stat in this game, meaning it is a bad weapon to peek corners or breach doors), which is bad, since the only class with access to the shotgun is the breacher. I think this is a very interesting take on balance for the shotgun
@Appletank8
@Appletank8 Жыл бұрын
yeah, when every weapon is lethal, shotguns don't stand out as much, which kinda holds true for sniper rifles. But when you scale things down to take at least 2 or 4 "shots" to kill in a best case scenario, you need to consider what kind of damage spread you want for all the different types of weapons.
@ownedpilot4324
@ownedpilot4324 Жыл бұрын
Haha, that is why I like Insurgency so much. “F*ck balance, make everything op.”
@hoonterofhoonters6588
@hoonterofhoonters6588 Жыл бұрын
If you start with the premise that people usually die if you shoot them, the balance issues around shotguns disappear.
@leifwulffstephan3725
@leifwulffstephan3725 Жыл бұрын
@@ownedpilot4324 realistic
@autismusmaximus4933
@autismusmaximus4933 Жыл бұрын
@@leifwulffstephan3725 Guns are pretty Over Powered in real life, though.
@FormerlyOrca
@FormerlyOrca Жыл бұрын
I'm surprised no one has mentioned the guns from Titanfall 2 in these comments, not only are they great examples of weapons balanced with unique playstyles in mind they're also not afraid to leave the realm of reality for the sake of fun/balance. The Mastiff shotgun in that game even changes it's wide line spread spread to a consistent circle when ADSing just like in your vid!
@Jetiko27
@Jetiko27 Жыл бұрын
Love the Mastiff, but could never get into the EVA8.
@gokufromfortnite5600
@gokufromfortnite5600 Жыл бұрын
@@Jetiko27 Eva 8 shreds
@endurgai
@endurgai Жыл бұрын
cold war
@Sillypenguinfake
@Sillypenguinfake Жыл бұрын
​@@Jetiko27I had the opposite situation where I couldn't get into the mastiff but loved the EVA8
@damiankrause6622
@damiankrause6622 Жыл бұрын
"balanced" *spitfire LMG would like to join the chat*
@angel89775
@angel89775 Жыл бұрын
I feel like both shotguns and snipers were introduced as a way to teach fundamental lessons. shotguns were designed to teach players to treat every corner like theres a bad guy around it, and snipers were made to teach how to respect a sightline, as well as both of them forcing a player to learn how to solve a problem in another way, rather than just running at it. with the oneshot mechanic weighing on a player's mind, it will subconsciously make them play safer, and smarter.
@Vv_JASPER_vV
@Vv_JASPER_vV 11 ай бұрын
Players not being able to run at the problem, being forced to think--not very popular with gamers these days...
@lawjef
@lawjef 11 ай бұрын
What fundamental lessons are taught by using a riot shield? It’s a trick question, riot shields are a waste of everyone’s time.
@ahmettmi7432
@ahmettmi7432 11 ай бұрын
@lawjef flanking, the most important tactic of warfare
@ZestyAlone
@ZestyAlone 11 ай бұрын
Nah they just asked what guns they could add in and came up with shotguns and sniper don't think there was ever a masterplan involved
@MGSLurmey
@MGSLurmey 11 ай бұрын
@@ahmettmi7432 Precisely this. Flanking, and by extension, teamwork. You can't outflank a good shield player by yourself as they can just turn to keep facing you. Your buddy, on the other hand, presents a real issue for the shield player as they can't defend two directions at once.
@19-phamtrungquan
@19-phamtrungquan 7 ай бұрын
As a wrong player, I can confirm this is true
@LiberatedSpirit1
@LiberatedSpirit1 7 ай бұрын
lol
@someguy3763
@someguy3763 Жыл бұрын
I love how Ultrakill “solved” the issue of balancing shotguns at longer ranges by letting you punch a single bullet from the spread to essentially create a highly explosive missile that always lands wherever your cursor is.
@jetnyan2348
@jetnyan2348 Жыл бұрын
i love how that was originally a bug but hakita decided "its a feature now and it also gives you tons of style so bye hard damage"
@helloagain.andagain.andagain
@helloagain.andagain.andagain Жыл бұрын
Machine, I am not going to sugarcoat it 2 + M1 + F.
@juanmanuelfariasmarroncell2514
@juanmanuelfariasmarroncell2514 Жыл бұрын
Bro, that's like having a problem like... a table that has a slightly shorter leg. And solve it fucking mining 2 kilometers down and then installing a spaceship propulsor in the short leg, but leave it with just enough power to not fly out of the atmosphere, but only to lift it the 3 millimeters the leg is off.
@Jazz-dh2ds
@Jazz-dh2ds Жыл бұрын
@@juanmanuelfariasmarroncell2514 Gotta rewrite that, that was a tough read but I get you. Could've made a better metaphor but whateves
@patrickfrost9405
@patrickfrost9405 Жыл бұрын
@@juanmanuelfariasmarroncell2514 It's like having your son die but you're a scientist and you download his soul into a tomagachi and give the tomagachi to his brother.
@ahoy1014
@ahoy1014 Жыл бұрын
Another solution to the pellet spread without making it non-random is how Fatshark did in in Darktide: shotguns have a Minimum Pellet Count, which means that if a shotgun is fired, if fewer pellet than the MPC value connect, the damage inflicted on the enemy is increased to match the MPC. The MPC subsequently increases in value when aimed down sights.
@ayaderg
@ayaderg Жыл бұрын
another good way is to put them on a bell curve instead of being evenly distributed, and you could also do several layers where several pellets are guaranteed to be within that range, that way you always know vaguely where you will hit, but the farther out you go, the less leeway you have with it
@migueeeelet
@migueeeelet Жыл бұрын
@@ayaderg Yeah but the issue turns into how you code that. Someone talked about a game where 5 out of 8 pellets shoot in a tight ring while the remaining 3 shoot in a wider ring, that'd be a good approach
@Krystalchan2009
@Krystalchan2009 Жыл бұрын
3:40 Gun Nerd time; the Spas 12 is made for BOTH semi auto and pump action operation. And this is why various games tend to pick one or the other. This is because the semi-auto fire mode is made for traditional rounds, such as pellets and slugs. While on the otherside, the pump action is for low pressure shells or specialty shells such as the flash shells, beanbags and even dragons breath.
@tranngockha6562
@tranngockha6562 Жыл бұрын
That is so cool to know. Thanks mate.
@PhoniexStudio
@PhoniexStudio Жыл бұрын
And in games, usually speaking, the semi auto version deals less damage (balanced by faster fire rate) and the pump action version deals more damage (balanced by slower fire rate)
@ssjbread2803
@ssjbread2803 Жыл бұрын
​@@PhoniexStudio and then there's half life...who mistakes the magazine tube as an extra barrel
@stoneraptor6219
@stoneraptor6219 Жыл бұрын
I finally get to understand it
@notNajimi
@notNajimi 7 ай бұрын
@@ssjbread2803at least the tube is actually there irl, the mp7’s “grenade launcher” second barrel is just some shit they made up. The mp7 from that game is such an abomination 😭
@EsmerayFrost
@EsmerayFrost 10 ай бұрын
that launch at 11:30 was glorious - full backflip and everything
@MGMac_
@MGMac_ Жыл бұрын
I don't even play shooters and I like watching these videos
@Adster2008
@Adster2008 Жыл бұрын
Same bro same
@coreydorce8246
@coreydorce8246 Жыл бұрын
I play shooters and I like watching these videos
@Bean_guy2
@Bean_guy2 Жыл бұрын
@@coreydorce8246 ok
@cruze_the
@cruze_the Жыл бұрын
Yeah man I play brawlhalla
@iamishin7675
@iamishin7675 Жыл бұрын
You can't have a 1-shot for the shotgun rely on headshots, because you are only realistically going to get that "1 or 2 pellet headshot hit" at medium range. A shotgun at point-blank range should be able to one-shot to the body, but under this scenario this would never be the case. It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots, which would throw off the close-medium-longe range curve.
@Kwotzi
@Kwotzi Жыл бұрын
This is exactly what I was thinking. For the shotgun to do enough damage for 1-2 pellets to headshot, the damage would also be high enough for it to still one shot body shot anyways since the body is a bigger target and more pellets are likely to hit it. Making the shotgun effectively one shot at anything but long-range still.
@CoralCopperHead
@CoralCopperHead Жыл бұрын
"It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots..." That's pretty much how it works in Payday 2. The game doesn't divide the damage total across all pellets, instead a hit is a hit that deals full damage, regardless of whether it was just one pellet or a full meatshot -- however, the game uses the headshot multiplier, again, even if only a single pellet hits the enemy's head. Actually had a newer player ask what shotgun I was using back when I first picked it up (the trusty Loco, for the record), they were surprised I was using it effectively to fight across the street. Not from sidewalk to sidewalk, either, I was fighting from the china shop in Four Stores and shooting down enemies in the tech store on the other side of the road. Spitting distance for a real shotgun, sure, but fukken video games. (I still remember my utter disbelief when my roommate and I confirmed, in splitscreen, that the pellets from CoD's shotguns _literally disappear after seven meters._ To this day, I'm annoyed that it didn't piss me off, but I was just too stunned to believe what we'd proven.)
@daegan_ftw
@daegan_ftw Жыл бұрын
@@Kwotzi Give headshot damage multiplier a drop-off curve over distance; you need all the pellets to hit to get a headshot kill from long range (basically impossible) or only two thirds at medium range and 1/3 at close range and body shot one hit kills at point blank.
@Imaperson1020
@Imaperson1020 Жыл бұрын
@daegan_ftw That increases frustration as it's extremely easy to one shot, which comes around to the issue at the start. If you only need 1 pellet to one shot, then you can one ahit by aiming at the upper torso or neck, so you at least need some kind of skill to get consistent close range one taps.
@keyboardstalker4784
@keyboardstalker4784 Жыл бұрын
@@CoralCopperHead Is it really true COD's shotguns literally don't do damage past 7 meters? Which COD did you test it in?
@dominik9506
@dominik9506 Жыл бұрын
It's just nice to see that some content creators really care about quality. Continue with these masterpieces
@Rubblemover
@Rubblemover 11 ай бұрын
Omg I loved that little smile your avatar did during the intro sequence. That's how you know quality video editing right there
@Rubblemover
@Rubblemover 11 ай бұрын
Also really good flow of a script! I love finding video documentaries like this where I won't even be too interested in the topic, but just the character of content created is so amazing!
@catcatcatcatcatcatcatcatcatca
@catcatcatcatcatcatcatcatcatca Жыл бұрын
Team Fortress 2 managed to have extremely well balanced shotguns by simply not having an assault rifle. Not having any such hitscan weapon that excels at mid range and high base-hp compared to damage on midrange meant that shotguns had a very comfortable spot to fill. I wish more games just didn’t have assault rifles. It’s a perfectly valid choice and naturally opens up a lot of ways to build dynamics and counterplay.
@evilded2
@evilded2 Жыл бұрын
Yes.
@ssjbread2803
@ssjbread2803 Жыл бұрын
I completely agree, but at the same time given how many FPS games are Generic Military Shooter #361927917™, that's kind of an issue. Granted, if your game isn't a military shooter, this isn't a problem, but even if it is, there's still a weapon you can remove to give shotguns a comfortable niche - the SMG. In real life, they have an equivalent effective range, and in shooters they're constantly stepping on one another's toes as the designated CQC weapons. This can allow shotguns to fill that close-to-medium niche that, in other games, get dominated by the SMG, and it means that having a one-shot kill at point-blank is no longer top priority. Instead, their capabilities at range can actually be expanded upon a bit, with a two shot kill at close ranges and a 3 shot kill or so at medium ranges seeming pretty fair to me. In addition, if you plan on using multiple shotguns, you could have this trait taken by semiauto shotguns, while keeping the "traditional point blank OTK" role of the pump shotgun. Slugs could be balanced by having better shot accuracy, damage, and range, but being overall a fair bit slower and with a LOT more recoil, which would not only keep balance but also reflect real life.
@aSmallGreenDot
@aSmallGreenDot Жыл бұрын
I'm probably biased as a tf2 player but I find sniper rifles way more frustrating to play against than shotguns
@happyjohn354
@happyjohn354 Жыл бұрын
@@ssjbread2803 Evil with military shooters shotguns are fine if you give them realistic range and spread. You can absolutely wreck people shit at 60 meters with 00 buck. One of the only games I know that does this well are Insurgency Sandstorm and Enlisted.
@plantain.1739
@plantain.1739 Жыл бұрын
@@happyjohn354 I've always found it weird how many games market themselves as realistic, and yet have basically the TF2 shotgun with hyper realistic smgs. I guess most gun companies only really give a shit about service rifles, and demand they get special treatment.
@zeropoint5794
@zeropoint5794 Жыл бұрын
A pro tip to normalize stickgun's damage output at medium range: The Normal Distribution! Instead of dropping pellets at random inside a circle, use the bell curve to guide your randomness, now you get more pellets in the middle and less on edges, both making the damage more consistent and rewarding the player more for pointing the stickgun directly at the target
@jamesphillips2285
@jamesphillips2285 Жыл бұрын
Normal distribution can still be random. You are referring to the shape of the probability distribution.
@zeropoint5794
@zeropoint5794 Жыл бұрын
@@jamesphillips2285 yea thats why i mentioned using the bell curve to guide randomness. It's still random and can lead to major flukes, but overall it's going to be way more reliable
@spacecatsftw
@spacecatsftw Жыл бұрын
@@zeropoint5794also make sure at least one pellet always lands in the center of the crosshair!
@StarComet7
@StarComet7 Жыл бұрын
Pattern and some randomness is better imo
@HazardThe2st
@HazardThe2st Жыл бұрын
I still think its just best to have the pellets fire in a set circle pattern as it has no randomness, unless you count the spread changing size depending on whether youre crouching, prone, standing, moving, etcetera
@jgjg5182
@jgjg5182 Жыл бұрын
At 4:00 you show a simple animation of a Spas-12 and it is incorrect. The animation shows a direct blowback operation, whereas the Spas-12 is short stroke gas operated, which means when a shell is fired it vents some of the expanding gas from the barrel into a piston, which then pushes the bolt backwards, cycling the action. It is an important distinction
@ayaderg
@ayaderg Жыл бұрын
important for real life, but not for video games, where the only defining factor is what values the developer uses to program them
@leifwulffstephan3725
@leifwulffstephan3725 Жыл бұрын
Nerd Jk I also love firearms
@Two-BallTyrone
@Two-BallTyrone Жыл бұрын
sounds like a whole lotta hoopla
@SlerpyDerrpyBlue
@SlerpyDerrpyBlue Жыл бұрын
Thanks Einstein. Relax it was a joke.
@Reactivity760
@Reactivity760 Жыл бұрын
This sh-t sounds so good
@stillton1
@stillton1 10 ай бұрын
This is purely a shower thought but: One part of shotguns that I feel a lot of games get wrong is they include both the bloom, or simulated handling, and spread of the bullets together. I believe a more realistic approach is to separate them into two different circular fields. The outer is supposed to simulate the handling of the weapon by the main character and the inner is the spread of the shells. The inner circle is required to be fully inside the outer circle and the pellets can only be inside the inner circle. The outer circle would tighten or simply disappear when aiming down the sights meaning ADS is most likely needed to even hit opponents at medium to long ranges. For different types of shells and barrel modifications the inner circle will be our variable. While using slugs, the inner circle would be incredibly tight, allowing for greater prowess at longer ranges at the trade-off of being a huge gamble while hip-firing at anything but almost point-blank. Chokes and other barrel mods will change the inner circle based on the mod. A duckbill mod will change the circle to ellipse or a line with the orientation of the mod changing how pellets will fire. A choke will simply tighten the inner circle and a sawing off the barrel will increase the size of the inner circle. For stock and grips the outer circle will be our variable. These would mostly be the same with shotguns being able to take one of each kind. Shotguns with grips and stocks would have better simulated handling and usually lower recoil at the trade-off of being less effective in close-quarters combat, but not by much. Modded shotguns would generally be better for long-range combat and less effective in close quarters combat, rewarding accuracy. The biggest problem I can see with this is the deviation from the nature of shotguns as the close-range weapons that suffers at long ranges, but I believe that some games would benefit from having a more realistic system in place, especially games that try already to appeal to that hyper-realistic gun feel.
@naominekomimi
@naominekomimi Жыл бұрын
I feel like limited versatility isn't necessarily a bad thing. It changes the way you play and makes the game feel very different, having to build around mobility and learn the areas of the map with ranges that favor you vs areas where you'll be outranged consistently.
@sourlab
@sourlab Жыл бұрын
I love how their used in re games specifically re8 and re4 they feel like a power weapon when im feeling claustrophobic scared put that thing out and BAM it always looks and works amazing
@grzegorzbrzeczyszczykiewic563
@grzegorzbrzeczyszczykiewic563 7 ай бұрын
Also, low versatility means that mastering it can be more satisfying, seeing as, in order for the weapon to be viable, the one who has to become highly adaptable and responsive is you. This ideally means the shotgun would have a rock bottom skill floor (shoot at the dude at close range and you're officially 1/0) and a sky high skill ceiling (you can never rely that your gun will get you out of a sticky situation, so every situation is higher stakes than usual).
@BlazeMakesGames
@BlazeMakesGames Жыл бұрын
The fixed spread idea is really interesting and could also be used for some very subtle ways to balance the weapon at longer ranges. For example if you made the spread a circle pattern, you could balance the exact range of the weapon by the size of that circle compared to the angular size of a target's head. In theory up to a certain range, a good enough player could have all of the pellets hit the target's head, so that even if the gun could normally max out at 50 damage, it would still kill in one shot because every pellet would get doubled from the headshot damage. But then if you were shooting at someone farther away, even if the damage wasn't reduced any more, it would be impossible to fit all of the pellets inside the target's head, and thus be impossible to get a one-shot kill. And of course at even further ranges it would be impossible to fit all the pellets even just on the target's body as a whole. Thus, this could be a way to balance the weapon without needing to reduce its damage completely at long ranges, because the fixed-spread would make it impossible to hit with all of the pellets anyways. You could even theoretically take into account the maximum amount of pellets you could fit into a headshot or bodyshot at different ranges to fine tune the details. On top of that, that could introduce good side effect where the shotgun becomes good at fighting multiple enemies at long range, even if it's not good at fighting a single enemy. Because if say the sum total of all pellets still does 50 damage at long range, even if it's impossible to hit a single target with all the pellets, if you're fighting a group of enemies in say a more team-focused environment, you could more reliably distribute that damage over the group, which could either help soften them up for an ally to finish them off, or at least make it easier to fight them when they get closer, since you could probably shave off that 10 damage you need to one-shot them with short range bodyshots.
@doomspud6302
@doomspud6302 Жыл бұрын
I've played a couple games that do that, and it usually works well. The most recent one was Aliens: Fireteam Elite. All the shotguns in it fire a pattern that looks random, but is actually always the exact same. Which is nice, because it makes them more predictable when surrounded by Xenomorphs. The other is Borderlands 2. Several of the unique shotguns have special spread patterns. Like a pirate shotgun that makes a skull and crossbones. I haven't played any PVP games that do this, though.
@armadis4168
@armadis4168 Жыл бұрын
​@@doomspud6302 competitive tf2 has fixed spread
@jblazerndrowzy
@jblazerndrowzy Жыл бұрын
⁠​⁠​⁠​⁠​⁠@@doomspud6302 There are many pvp games, especially recent ones, that have fixed spread like TF2, Fortnite, Apex, etc.
@lunasagaming5801
@lunasagaming5801 Жыл бұрын
@@doomspud6302 The Panic Attack in tf2 has a wide rectangular spread.
@PrimordialNightmare
@PrimordialNightmare Жыл бұрын
Vermintide 2 and Remnant from the ashes are two games I've played that have crossbows that can shoot multiple bolts at once, though usually in a fixed horizontal line spread pattern, which made them interesting to use and pretty much turned them to low range high damage or mid range anti group weapons. I found them to be fun.
@j.r.mocksly5996
@j.r.mocksly5996 Жыл бұрын
I like the solution in the insurgency series and other more realistic shooters: make every gun lethal. When every gun performs at least somewhat realistically, the shotgun becomes more of a style choice that rewards players with good aim since it just isn't as good as a full auto gun. As in insurgency, sure your rifle might take 2, 3 at most shots to kill, but failing to get a kill on a shotgun shot is sure to lose you the fight. The shotguns just feel very satisfying and have a lot of punch behind them and can perform at range, but any full auto gun is just easier to use. It flips the normal shotgun dynamic on its head
@Nurse_Xochitl
@Nurse_Xochitl Жыл бұрын
Realism balances itself out. Players need to stop being stupid and running around like headless chickens. If they did that, then they might find tactical shooters (not CSGO, not R6S - those are arcade shooters) and milsims fun. Besides that, they get to learn how shit works IRL to an extent, which can be valuable knowledge when SHTF.
@packwolf445
@packwolf445 Жыл бұрын
​@@Nurse_Xochitlusually the people who complain in insurgency when they face a shotgun are the guys not bothering to throw a nade on OBJ and get a buckshot tearing their arm off
@Nurse_Xochitl
@Nurse_Xochitl Жыл бұрын
@@packwolf445 true
@yuvalgabay1023
@yuvalgabay1023 Жыл бұрын
​@@Nurse_Xochitlor like in many insurgency maps..every camps . camping is the bane of every sims .
@Nurse_Xochitl
@Nurse_Xochitl Жыл бұрын
@@yuvalgabay1023 lol cry about it xD
@sethplayzminecraft2671
@sethplayzminecraft2671 2 ай бұрын
11:50 "Turn them opaque" he says as they become transparent. Amazing video by the way, great job!
@Barumar
@Barumar Жыл бұрын
The level of detail and analysis provided is truly impressive. I really appreciate how the video dives into the mechanics and characteristics of shotguns, giving viewers a deeper understanding of their effectiveness in gameplay. The visuals and explanations are clear and engaging, making it easy to follow along and learn. Thank you for creating such an informative and enjoyable video!
@OfficialArch
@OfficialArch Жыл бұрын
My pleasure :)
@Mahashma
@Mahashma Жыл бұрын
I think Tarkov has done it best so far. Shell selection is everything. 8mm express buckshot can slap you sideways from 20m but only if it hits somewhere unprotected, while AP-20 can punch through Class 4 body armor at 50m. You can spam a Saiga-12 as fast as you can mag change. And each pellet is modeled individually.
@lolobuf
@lolobuf Жыл бұрын
Looks at how rust has done it wayyy better
@mafiapenguin9878
@mafiapenguin9878 Жыл бұрын
​@@lolobufkys
@GatorDontPlayNoShit69
@GatorDontPlayNoShit69 Жыл бұрын
@@lolobufno. Just. No.
@ruipereira4134
@ruipereira4134 Жыл бұрын
What about into the radius
@lolobuf
@lolobuf Жыл бұрын
@@ruipereira4134 50m with slug is easy kill but you can do 1/4 damage at 200m when you shoot buck i dont know
@pirateFinn
@pirateFinn Жыл бұрын
I think the most interesting "balancing" I've seen recently for shotguns is Ready or Not, because levels of body armour penetration, lethality and whether you even want the spread or you may accidentally shoot a hostage matters. Along with the fact that if you miss, the time spent firing the next may be what spells your doom while being shot. Very interesting game.
@xostler
@xostler Жыл бұрын
I was in here to talk about shot ballistics and chokes but I just realized it was talking about gaming lol Does RoN have semi auto shotguns?
@pirateFinn
@pirateFinn Жыл бұрын
@@xostler It has the M4 Benelli as a semi auto option!
@cameronsloss3829
@cameronsloss3829 Жыл бұрын
RoN definitely high lights disadvantages of pumps but not highlight why people choose to use the two in a tactical setting. With semi auto’s you are restricted to loads you are able to use while a pump action will feed and cycle anything. I had to tinker and work in my gas system so I can use game loads on my 11-87 police which was designed for 2 3/4 heavy loads like slugs and 00buck.
@aloedg3191
@aloedg3191 Жыл бұрын
Haha Doom
@skyninja979
@skyninja979 7 ай бұрын
I don't usually care when it comes to "first impressions" with KZbin videos, as my "first impression" with this video, was that you were trying to be another "Ahoy". But I was pleasantly surprised to see so much depth in the gaming side of things, rather than the actual history side. And your art/content style is very satisfying to look at! Glad I came across this video! I will definitely be binging more of your stuff!
@OzixiThrill
@OzixiThrill Жыл бұрын
There is one value that's worth considering in basically ALL balance topics - Obtainability. In games like CS, weapons are lost between matches and you only carry them through the rounds if you don't die. And each weapon costs a different amount. This means that they have some leeway at making weapons less balanced, as the fundamental gameplay loop makes getting a stronger weapon more of a gamble than simply just an upgrade.
@MightyGachiman
@MightyGachiman 11 ай бұрын
Also you dying with a shotgun hurts less because the enemy can only loot that weapon instead of an awp or an assault rifle.
@TheFirstCurse1
@TheFirstCurse1 8 ай бұрын
That's something that's very specific and niche for shooter games, especially multiplayer ones. In most shooters you can choose whatever you want in your loadout and you have it the whole game.
@CoralCopperHead
@CoralCopperHead 8 ай бұрын
I'll take your Obtainability and Gambling balance factor, then attach "Map Knowledge" and "In-Map Weapon Spawns" to introduce you to what the Arena Shooter used to be. UDM2 MAP01; the BFG is _right there_ in the pavilion, and the button to lower the lift is easy to access -- but the lift takes long enough to rise that you're a sitting duck in the most wide-open part of the map while going for it. I've picked off people going after the BFG in that map with a freakin' pistol.
@CoralCopperHead
@CoralCopperHead 8 ай бұрын
@@TheFirstCurse1 "In most (bad) shooters" I fixed it for you.
@yapflipthegrunt4687
@yapflipthegrunt4687 8 ай бұрын
@@CoralCopperHead based arena shooter enjoyer
@frederikvoigt132
@frederikvoigt132 Жыл бұрын
It would be extremely cool to see a game where the guns are based on your balancing ideas
@somedudethatripsplanetinha4221
@somedudethatripsplanetinha4221 Жыл бұрын
The double barrel would be something in of itself
@BustyCatbot
@BustyCatbot Жыл бұрын
Wouldn't be surprised if smaller game devs are taking notes, I know I am
@acake6654
@acake6654 Жыл бұрын
i hope the game devs looking for advice actually consider if it fits their game before accepting it, cause this video is full of holes
@BustyCatbot
@BustyCatbot Жыл бұрын
@@acake6654 Literally the end of the video said this advice doesn't fit in every game, and it's a given that you should consider if it fits, no shit. The only thing full of holes is your understanding of the video.
@acake6654
@acake6654 Жыл бұрын
​@@BustyCatbot so let me get this straight, he keeps talking about shotguns like its the generalized term with most FPS games out there, but how many even have the highest headshot damage out of all weapons? what about the differences between random bullet spread and fixed spread? what about the games where increasing accuracy or using ADS somehow tightens the spread but for others its a fixed point? why do we have an entire stick section dedicated to explaining how shotguns arent realistic like its rocket science and we forget that videogames are unrealistic..? im sure you wont arrive in the hospital in time if you get shot in the thigh with a rifle. i dont like his video format, as in these, he simply regards a version of a weapon category's balance based on many, many games that couldnt possibly represent any of them.
@generalpacman6414
@generalpacman6414 Жыл бұрын
19:48 in Killing Floor 2 the boomstick has an alt fire that fire both barrels bound to middle mouse, so you still have the option to fire one at a time and aim down the sights.
@TheGreatJon
@TheGreatJon 7 ай бұрын
This is a really great breakdown for balance, well thought out mate!
@nikosgalaxygames553
@nikosgalaxygames553 Жыл бұрын
Warthog auto shotgun from Deep rock galactic is a good example of realistic shotguns in video game, it can hit enemies for good damage at long range but can one shot certain enemies at close and very deadly to most high health enemies, it shoots shells with a good number of pellets to follow which can be upgraded to have more pellets. Overall a good designed shotgun which pumps those bugs full of lead.
@randomcatdude
@randomcatdude Жыл бұрын
Magnetic Pellet Alignment overclock my beloved
@giantslayer9335
@giantslayer9335 Жыл бұрын
ROCK AND STONE
@HypotheticalBreaking
@HypotheticalBreaking Жыл бұрын
Rock..... and.....STOOOOOONE
@lambchaikies
@lambchaikies Жыл бұрын
Deep Rock Galactics weapons are increadibly well-designed (except for the Subata...) and one thing I'd add here is the Scout's Jury-Rigged Boomstick has an additional role for its shotgun: close range AoE. In addition to having a hitscan bullet spread, it also has a small, invisible, rectangular AoE muzzle-flash that deals 20 explosive damage (just enough to kill swarmers and the jellyfish, or push over a kill threshold on a slasher). It's a clever little addition that does a lot of work, and makes it subtly even more effective at close-range.
@Alex_Vir
@Alex_Vir Жыл бұрын
​@@lambchaikies In which ways is the subata not well designed? Just out of curiousity, I have no clue.
@_mazarico_
@_mazarico_ Жыл бұрын
FEAR's shotgun was legendary! Its only weakness was against armored Replica soldiers past medium range but even then, it still had a fairly accurate pellet spread for a video game shotgun. And within that limited range, it tore enemies and the combat areas to shreds. I never replace it once I pick one up whenever I replay the campaign.
@XenoSpyro
@XenoSpyro Жыл бұрын
Even against armored enemies the VK12 is still good. That's just how bad the AR and SMG were. The 3-burst rifle was really good but there's crap for ammo, and the nailgun overshadows all of them anyway.
@heideknight9122
@heideknight9122 Жыл бұрын
Same
@hiiambarney4489
@hiiambarney4489 Жыл бұрын
Can't quite remember. Have some fond memories playing Fears multiplayer back in the day though.
@EJB9
@EJB9 Жыл бұрын
I think the way the AA12 was done in spec ops: the line was good. It was an end-game weapon only dropped by elite enemies, and it does all those nice things shotguns are good for, but was also properly balanced similarly to an assault rifle, and its super satisfying to use.
@CJmtb91
@CJmtb91 Жыл бұрын
Also one of the best representations of what an AA-12/USAS-12 is actually capable of was the pre-nerf explosive rounds in Battlefield 3, the thing made you a walking assault platform.
@dustronyt4565
@dustronyt4565 Жыл бұрын
I found it ironic that, if you put some time in training, the pump action shotguns are the fastest ones. Depicting this in games isn't viable of course, but it's an interesting thing You could do 3 or even more shots per second with a pump action, which isn't possible even for a fastest semi-automatics. Full auto shotguns actually the slowest ones once you put time in training Ye, I'm aware how much of "if you train enough" here, but it's really interesting fact
@LeoJohnGalt
@LeoJohnGalt Жыл бұрын
@@CJmtb91 My god, core memory unlocked. I'll never forget 64-man Metro pre-nerf. The entire match was nothing but smoke and explosions and even death couldn't give you a break from it. I still remember a medic train reviving me like five times in a row in one of the hallways all the while both teams were using the explosive slugs.
@LeoJohnGalt
@LeoJohnGalt Жыл бұрын
@@dustronyt4565 From what I can tell, those slamfire shotties actually can unload faster than an AA-12.
@JK4600Ace_of_Spades
@JK4600Ace_of_Spades Жыл бұрын
​@@dustronyt4565the saiga 12k could maybe keep up
@blitz7488
@blitz7488 8 ай бұрын
I always think of a ww2 trench gun, the backboard blaster type. I love the traditional boomstick that spits a wall of bullets to really reaffirm your personal space.
@BunkeredGaming
@BunkeredGaming Жыл бұрын
Really glad that the stick gun is balanced around the AR, it would be super overpowered otherwise.
@maybebirb
@maybebirb Жыл бұрын
-Appears on KZbin -Makes the greatest videos on balancing guns in FPS games ever seen with professional quality implying he's been doing this for years -Refuses to elaborate -Vanishes for 2 months I do love Arch
@ashentwo6608
@ashentwo6608 Жыл бұрын
I love these kinds of youtubers
@Frostgiantbutsmall
@Frostgiantbutsmall Жыл бұрын
​@@ashentwo6608 No drama, no bullshit, no screaming, minimal "nostalgia", just solid, focused presentations. Wish they were more common.
@AlairrJC
@AlairrJC Жыл бұрын
@@Frostgiantbutsmall I AGREE
@andrewvirtue5048
@andrewvirtue5048 Жыл бұрын
Well he's got my vote now. Subscribbled!
@sushiiixo
@sushiiixo 11 ай бұрын
​@@FrostgiantbutsmallSomething so nice about watching these videos. Just sid down with a meal and relax. ♡ Best kind of content on KZbin.
@UncleRJ
@UncleRJ Жыл бұрын
The most mind-blowing thing about this video is not once it's shown the DOOM's Super Shotgun, which is arguably the most iconic shotgun in video games.
@CoralCopperHead
@CoralCopperHead Жыл бұрын
This entire channel seems to use the standard modern military shooter as the baseline for balancing, which the SSG absolutely shreds. There's a reason we call it "SSG _jousting"_ -- because it's less like a shotgun and more like a *_lance._*
@dannybrine8718
@dannybrine8718 Жыл бұрын
The Super Shotgun isn't a gun. It is just pure weaponized "Fuck you"
@DinnerForkTongue
@DinnerForkTongue Жыл бұрын
@@CoralCopperHead Including the range! Some reach, but not a lot.
@sportyeight7769
@sportyeight7769 Жыл бұрын
This video is majoritarily influence by COD/R6 kind of gameplays. It fails to explore the shotgun in other types of games. For exemple: DOOM with the most iconic shotgun, hunt showdown who i think as the best balance between shotguns and other weapons or even TF2 with innovative designs on shotguns.
@DIEGOLOKO82
@DIEGOLOKO82 Жыл бұрын
to be fair, when talking about Balanced weapons, DOOM is not a good example
@famulanrevengeance3044
@famulanrevengeance3044 7 ай бұрын
Shotgun complaining will never be valid in games with snipers that one shot a close range. They dominate every game, every range, every situation. Especially bodyshot 1 shot snipers. They ruin the flow of the maps, make people hide and camp. It's insane how this one class of weapons truly destroys games but for some reason people are deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in much danger if you play at range or play cover.
@neerGdyahS
@neerGdyahS 6 ай бұрын
"They dominate every range, every situation" "deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in danger." Okay, go try that and let me know how it works out.
@famulanrevengeance3044
@famulanrevengeance3044 6 ай бұрын
@@neerGdyahS Lol I have and it's boring as hell. CoD, Battlefield, CS, Valorant, whatever. Most unskilled, cowardly playstyle there is, not fun for the enemy to deal with and requires the least amount of aim, recoil control and crosshair placement
@reelgesh51
@reelgesh51 5 ай бұрын
That's what I loved about siege No matter the gun - no matter the range (except buckshot shotguns) You could always 1 shot headshot anyone with the skill
@famulanrevengeance3044
@famulanrevengeance3044 5 ай бұрын
@@reelgesh51 I don't find instant kills all that entertaining, but atleast in Siege snipers aren't that dominant
@ender_z4nd3r83
@ender_z4nd3r83 4 ай бұрын
that's why everyone uses sniper... oh right, people use AR SMGS and LMGs much more than snipers, how is that?
@Dni-smm-old
@Dni-smm-old Жыл бұрын
your videos are so good. you just popped out of nowhere and released 5 high quality videos after only a year of content on another channel. i can't imagine how amazing your videos will be in 2025.
@Dni-smm-old
@Dni-smm-old Жыл бұрын
I noticed a typo but i recently found out that editing a comment removed a heart so i'm leaving it in
@jodlaa5142
@jodlaa5142 Жыл бұрын
yeah this guy reminds me of Ahoy/XboxAhoy who does like in depth videos of some iconic weapons from through history and their role in games, but on this channel it's a bit more oriented on the developer/balance side, which is also pretty interesting to watch and learn of that mindset when it comes to these classic weapon types we're all used to using in most fps games. I wonder @Arch, do you watch @Ahoy and was he an inspiration to you towards these videos? Also, it would be pretty cool to see a potential collab with you two some day.
@OfficialArch
@OfficialArch Жыл бұрын
BIG shout out to Chris Doerksen for the intro and outro songs! How'd you like them?
@sloubie
@sloubie Жыл бұрын
Færst
@toaststealer7040
@toaststealer7040 Жыл бұрын
Can't comment why?
@toaststealer7040
@toaststealer7040 Жыл бұрын
I LOVE ARCHHHH
@CoderDev6545
@CoderDev6545 Жыл бұрын
this video is pretty good ngl
@Backfisch5927
@Backfisch5927 Жыл бұрын
Have a good holiday, and thanks for these amazing videos.
@yazoink6690
@yazoink6690 Жыл бұрын
I like the way Darktide does shotguns. The high reload time makes up for the huge burst damage you can do. Plus, the spreads are actually realistic (ish)
@Scroolewse
@Scroolewse Жыл бұрын
There's no point in talking about a single player game's shotgun in a video about shotguns in multiplayer. They are completely different beasts. Imagine getting a true-to-Doom Super Shotgun in CoD lmao
@yazoink6690
@yazoink6690 Жыл бұрын
@@Scroolewse ... Darktide IS multiplayer, just like Tarkov. Both are fine with giving their shotguns the range they deserve.
@Scroolewse
@Scroolewse Жыл бұрын
@@yazoink6690 ok I should have said PvE is different from PvP but I figured you would get my point.. also not really sure what you're bringing up Tarkov for, I never said anything about it.
@kubaGR8
@kubaGR8 Жыл бұрын
Darktide also does minimum pellet counts. If you fire 14 pellets with a Ripper Gun (which has a minimum pellet count of 7), then even if only a single pellet tags an enemy, it will count as 7 pellets hitting instead.
@quickdraw6893
@quickdraw6893 Жыл бұрын
Except the shotguns don't actually do all that much damage in that game lol. The slug rounds you can manually load do, but their output as a whole is pretty crap compared to a lot of other guns, even in the burst department.
@RGIlerio
@RGIlerio Ай бұрын
A bit late to the conversation, I know, but I just wanted to bring up the fact that shotguns have way more balancing factors than other weapons in games. A few examples include, ammo and pellets per shot. With an assault rifle or SMG, the number of bullets you can have loaded doesn't matter too much, because missing one shot doesn't matter when you fire so many shots at such a rapid pace, but on shotguns, every shot matters. Missing one shot with a shotgun is the difference between life and death, and if you do come out alive, you spend more time vulnerable because you (typically) have to reload each individual shot. This is also why shotguns and snipers are compared so much, because missing a shot has a much higher impact than it does with any other weapon. Pellets on the other hand are usually a unique stat to shotguns, where instead of firing on bullet that deals all the damage, they fire multiple pellets that the damage is spread between. A rifle that does 30 damage per shot is just that, no more explaining needed, but a shotgun that does 30 damage per shot needs more explaining. That could mean 3 pellets that deal 10 damage each, or 10 pellets that deal 3 damage each. Another thing is that shotguns are typically a gimmick weapon, having some additional factor to encourage the player to pick it, typically knockback, whether it be on the enemy, or on the player to use as a pseudo double jump.
@Desi-qw9fc
@Desi-qw9fc 11 ай бұрын
I've always wanted to make a roguelike FPS that revolves entirely around one shotgun, and the point of it is to get better at cycling the gun (like Receiver 2 with a shotgun mod), at modifying it with weights and chokes and stuff, and at mixed-loading different kinds of shells for different situations (like H3VR where you can load different shells in any order).
@denekhesab.2527
@denekhesab.2527 10 ай бұрын
maybe you should check out shotgun king
@brodiscool2752
@brodiscool2752 9 ай бұрын
I don't think shotgun king is an FPS, and no its not close enough to an FPS either.@@denekhesab.2527
@taffyadam6031
@taffyadam6031 7 ай бұрын
Mothergunship does something like this
@MorganGraziano
@MorganGraziano 6 ай бұрын
make please, please make!!! c:
@zerrierslizer1
@zerrierslizer1 6 ай бұрын
i'll support you with Audio Design if you wanna go for it. i have equipment to Record, Edit and fine tune all Audio for whatever is needed.
@doughboywhine
@doughboywhine Жыл бұрын
I think part of the reason the Mossberg is so iconic also stems from the fact that most pump actions are fairly similar, and have not changed much since being designed over a century ago
@AeroQC
@AeroQC Жыл бұрын
15:40 Fixed pellet pattern is specifically why I loved the Blockhead shotgun in Borderlands 2, would be cool if some games opted in to this mechanic more often.
@kindabober
@kindabober Жыл бұрын
Well, Apex is still there, all the shotgun patterns are fixed to some extent (except Mosambique without ADSing)
@screamingcactus1753
@screamingcactus1753 Жыл бұрын
Most popular community servers in Team Fortress 2 use fixed weapon spread, and even if you're not playing on those, the panic attack, a shotgun alt that any class that has the stock shotgun can use, also has a fixed firing pattern
@TheReZisTLust
@TheReZisTLust Жыл бұрын
*laughs while catchin a ride on The Wave of flesh and blood*
@SusSpooder
@SusSpooder 11 ай бұрын
Most shotguns (if not all) do this in Mass Effect to great effect.
@7tales311
@7tales311 11 ай бұрын
@@screamingcactus1753 yeah, it seriously makes shotguns have a different but surprisingly nicer feel. Sure you dont get random lucky meatshots, but when you get used to a fixed pattern shotgun it feels fair.
@choty7066
@choty7066 10 ай бұрын
You almost perfectly describe the model 1887 from The Finals here. It cannot one shot, no headshot bonus, has tight spread and is good up to mid range, spread pattern is always exact (no randomeness) as well as a very long reload time. It also has a super satisfying *POP* 👍
@Ozzykan
@Ozzykan 7 ай бұрын
I agree I thought it was odd at first that it did not get a headshot bonus at all (none of the shotguns do in the finals except i think the slug) although there is no benefit to ADS and in most cases its detrimental since it slows down your rotation speed. Bad habit i had to unlearn from Destiny was ADS all the time since that game makes many guns very inaccurate when hip-firing.
@kookbook4399
@kookbook4399 Жыл бұрын
wait this isnt ahoy
@nexus8824
@nexus8824 6 ай бұрын
honestly, i still love this type of video.
@Clazzette
@Clazzette 5 ай бұрын
this comment made me realize that
@ChristopherMB87
@ChristopherMB87 5 ай бұрын
Waiting for the crossover
@yourcanadianbuddy3024
@yourcanadianbuddy3024 5 ай бұрын
That's exactly what I thought when I clicked on the video
@MaxKulik
@MaxKulik 4 ай бұрын
Walmart Version
@eye9359
@eye9359 Жыл бұрын
This is a really interesting and I think a well informed process of trying to balance shotguns. I guess the next step is to implement these ideas into different games to understand what works, what doesn't and how there can be a fix for these issues in the specific game. It'd be pretty interesting seeing all of these ideas combined into a video too.
@danielhale1
@danielhale1 Жыл бұрын
This is about multiplayer, but in single player the game feel and ammo economy can matter a lot. I grew up on games like Quake and Half Life where the shotgun was a staple, if not frightening, short-range weapon you loved to use when you had the shells and could justify using them (close range against foes that needed firm negotiation).
@hikermrsblood1
@hikermrsblood1 10 ай бұрын
0:05 shotguns are actually pretty good for learning how guns work irl (due to it just yeeting pellets and not worrying about accuracy) so a shotgun being used to let “youngins” learn the basics of firearms would be accurate as “baby’s first gun”
@Hyperlaser_Merc
@Hyperlaser_Merc 7 ай бұрын
While also having a decently high skill floor to master it. (In some games)
@hikermrsblood1
@hikermrsblood1 7 ай бұрын
@@Hyperlaser_Merc meh, good point I guess
@Z3R0NU11
@Z3R0NU11 3 ай бұрын
In real life shotguns are some of the hardest to master. Good luck shooting half the ammo you do from any other gun without your hands cramping
@hikermrsblood1
@hikermrsblood1 3 ай бұрын
@@Z3R0NU11 I meant it in terms of teaching folks gun safety and basic gun knowledge, also DANG this comment is old
@Checkpoint_King
@Checkpoint_King 3 ай бұрын
@@Z3R0NU11semi auto shotguns have entered the chat. Drum fed high capacity semi auto shotguns like the Daewoo USAS 12 or the more modern AA12 have entered the chat.
@AdamSchadow
@AdamSchadow Жыл бұрын
This is certainly one of the best videos about shotguns in games. I would say you got the shotgun categories a bit wrong. There are actually only 3 options: 1. Double barrel so two shots quickly in a row with long reload either needs one or two shots to kill. 2. Pump action this one has plenty ammo but fires so slowly that it needs to oneshot unless your game has some absurd time to kills or is ok with the animations being comically fast. 3. Auto it does not matter if its semi or full in most cases since shotguns dont fire fast enough and also dont require pin point precision where it being semi would be a significant downside. These again either two shot and fire fast or oneshot but at much lower ranges than the pumps to be balanced. To reduce the randomness you dont need to force a fixed pattern you just need to make the shotgun fire enough pellets since the more pellets it fires the more balanced out the spread will be. The peaking strategy is only really a problem if you kill each other slowly or you move incredibly quickly so you can just bring that down or even simpler just make the normal peeking slow but make it so that if you run and jump around a corner you peek much faster but wont be able to go back very quickly. (ofc this is all relative to the time to kill of guns) Headshot damage on shotguns is not the best thing because it increases the randomness and makes them disproportionally weaker at range where you cant force the pellets to go towards the head.
@ElNeroDiablo
@ElNeroDiablo Жыл бұрын
I mean, look at DOOM II's Super Shotgun from back in 1994 - double barrel, more powerful than the Regular Shotgun, but fires both barrels each time and has a reload animation for cooldown after firing. It'll make mincemeat out of most mobs you come across short of the Boss Fight mobs, but also makes you keep in mind your ammo count to decide if you should use it on a room full of trash mobs or save your Shells for use in a boss fight. If you wanted to spit out a lot of firepower to clear a room, you had the Chaingun and Plasma Rifle as fast-firing alternatives to spray-n-pray with.
@syphia9841
@syphia9841 Жыл бұрын
I think an important part of shotgun balance is not just range or map design, but instead accounting for how a fight starts. Players aren't dropped into a fight knowing where everyone is, they have to find each other first and someone has to shoot first. In the case of shotguns, they allow a player who knows the map and can predict other players to outplay them, by using better positioning. In this way shotguns can be fair and skillful even when they easily kill in one shot, because getting close enough without being detected requires its own skill and game knowledge, even if it's not mechanical skill (i.e. aiming accuracy). A player can counter the shotguns by maintaining situational awareness and avoiding corners or flushing out buildings where shotgun users are likely to come from.
@mediumplayer1
@mediumplayer1 Жыл бұрын
Exactly! All of the shotguns in Counter-Strike can kill in one hit without a need to headshot. Even the semi-automatic one. And all of the kills made by shotgun net you a triple kill reward (900$ with 300$ being the default). Because it is indeed hard to approach the enemy facing you, without being seen or killed yourself. Plus, there is one thing this video never mentioned - beyond a certain, extremely close distance it becomes quite hard to hit a moving enemy.
@CoralCopperHead
@CoralCopperHead Жыл бұрын
@@mediumplayer1 It's not hard at all to land shots on moving targets in games that use hitscan weaponry like... oh, look at that, *_Counter-Strike._*
@Goodroosters
@Goodroosters Жыл бұрын
So in Fistful of Frags the double barrel shotgun used to be able to fire both shots at once. In that particular game, it was so insanely overpowered that it had to be patched out. There's definitely some differences since FoF is balanced around 6 shots and has very special rules, but I think it could be a problem in other genres too
@civotamuaz5781
@civotamuaz5781 11 ай бұрын
I just heard about this game from you boy, gonna try it right away
@DORMRR
@DORMRR Ай бұрын
3:00 bro predicted all the Xdefiant shotguns
@thesysop4998
@thesysop4998 Жыл бұрын
5:12 Genuinely surprised me to find a ravenfield clip in this video I've played that game for like a year-ish now and never realized how many people knew about it
@pyroplays599
@pyroplays599 Жыл бұрын
Same here, I've got up to 1000+ hours on it 😅
@Jessie_Helms
@Jessie_Helms Жыл бұрын
I _LOVE_ seeing more Ahoy-esque editing styles. It’s a beautiful editing style and I wish more people used it. Heck, it’s deeply inspired my work too. Good video, you’ve got a new sub
@TheGmodkilla
@TheGmodkilla Жыл бұрын
I like the idea of Slugs as a minor gadget for shotguns. Slight ammo cap nerf but you grab a few slugs for unique situations that require a reload to set.
@brycemedvin8765
@brycemedvin8765 Жыл бұрын
Sure, as long as we limit armor-piercing rounds as well.
@feywinterfox9630
@feywinterfox9630 6 күн бұрын
christ, you blew my mind on the shells alone! I had no idea they had that kind of range!
@swaws1577
@swaws1577 Жыл бұрын
You should have gone over Tarkov's implementation of shotguns and their ammunition, they did a very good job at accurately representing them.
@SpaceMissile
@SpaceMissile Жыл бұрын
tarkov is king.
@nanksm4583
@nanksm4583 Жыл бұрын
This!
@CaptainRasco
@CaptainRasco Жыл бұрын
yup, and it makes it so that only the best rounds (and flechettes IRL are dogshit) can actually kill a player when you're aiming for armored vitals, because buckshot plinks off of armored plates. well done, makes shotguns actually fun to use when you kneecap people
@swaws1577
@swaws1577 Жыл бұрын
@@CaptainRasco very true! the only inaccuracy as of now is that buckshot fires in a spread and if someone is wearing armor plates and gets unlucky a pellet could still miss a plate and do a lot of damage, wheres in game armor that covers an area covers all of fhat area, not just where the armor is on the body. Once they add true armor hitboxes (which is soon) i think it will be one of the best implementations of shotguns in any game, if it isn't already.
@lil_lion69
@lil_lion69 Жыл бұрын
These animations are so great. Simple, colorful and most importantly informational. Seeing a behind the scenes would be so cool.
@sourlab
@sourlab Жыл бұрын
Behind the scences will be a team editing on a computer 💀
@thewoodpeckers655
@thewoodpeckers655 Жыл бұрын
Everybody gangsta till Arch posts. Then everybody’s even more gangsta.
@MarcelEnglmaier_1
@MarcelEnglmaier_1 3 ай бұрын
Ready or Not is the only gun that did shotguns justice. 0.2 splits, high recoil, but it destroys “over there”. No gun comes close to a shotgun’s power but its way harder to control after a single shot
@flameninja_
@flameninja_ Жыл бұрын
I absolutely love your videos man. The editing and art is amazing and I hope you continue to grow here on KZbin. I understand that you don't normally do analysis videos like this but I really like this content from you.
@eddebrock
@eddebrock Жыл бұрын
Very often the main culprit is the maps. Because for some reason level designers like to use what I call "cunt-design". It's where they design maps to not have good angles or long LOS. Which is basically the how-to for making shotgun maps. The other problem is that as soon as you go indoors, you're in the shotgun's house!
@ububububububububub1667
@ububububububububub1667 Жыл бұрын
that's true
@kaden-sd6vb
@kaden-sd6vb Жыл бұрын
The other main issue is the majority of fps games being what I call "instakill shooters" where time-to-kill is unbelievably low(well under half a second), no matter the gun. This understandably makes balancing strange, if not impossible. I do not like instakill shooters.
@amistrophy
@amistrophy Жыл бұрын
​@@kaden-sd6vb it can be made more balamced by changing the recoil, ergonomics, and control characteristics of the guns. Which are soft damage modification features. Good game for this would be deadline on roblox, but it's a milsim like insurgency/tarkov blend. Very innovative gunplay though. Best I've ever had.
@TacticalBaguette
@TacticalBaguette Жыл бұрын
@@kaden-sd6vb Insurgency does a good job at balancing this by having maps that have a good mix of engagement ranges. All of the guns may be able to kill in under 3 shots, but even with more realistic range capabilities, an SMG can't reach out far enough to take care of something a sniper can, unlike for example COD where everything is balanced around the small map size. Insurgency also has a point system for loadouts, so choosing a capable gun and kitting it out can cost you armor, carrying capacity, grenades and other useful equipment.
@Escruonn
@Escruonn Жыл бұрын
​@kaden-sd6vb Back in my day, we called that insta-gib.
@atcubaking1
@atcubaking1 Жыл бұрын
As someone who's spent a lot of time around firearms as of recently, I can say that most people greatly overestimate the amount of spread that 00 Buck will have, and the amount of felt recoil when compared to their non-shotgun counterparts. I'd honestly take a slightly different approach to balancing shotguns. Start with the break action and make the spread super tight but have the icon for it bounce around while in hipfire, so the player knows where it is but cannot easily predict unless they slow down before firing, and so they have to aim the break action at close range to ensure that they don't completely miss (to mitigate poking). From there progress to pump -> semi -> full auto. As you move along the list, increase the pellet spread (in both ads and hipfire) and decrease the recoil to compensate. Ideally the randomness introduced by the increased spread is compensated by the fire rate, and the recoil goes down slightly across these weapon types because of more components and therefore a heavier gun to help better place these wider groups. As it turns out, most semiautomatic or full auto shotguns tend to have wider groups as a design choice, so it better reflects real life.
@devilinwilliam4121
@devilinwilliam4121 7 ай бұрын
The quality of ur videos are just muah. Top level.
@excuses6016
@excuses6016 11 ай бұрын
How in the world is this channel not more popular then it is? This is literally some of the highest quality most entertaining content I’ve ever watched
@isaacmacqueen9695
@isaacmacqueen9695 Жыл бұрын
My favorite shotguns are from insurgency sandstorm for somewhat realism and decent range. But I love the way cyberpunk shotguns blow heads apart. And MW2019 has the best animations for any shotgun. A game that would combine the 3 into one would be amazing. Cod or even Halo would really benefit from someone like you on the balance team great video you earned yourself a subscriber
@puppypunter8316
@puppypunter8316 Жыл бұрын
YES. i LOVE insurgency shotguns, they feel so good to hipfire
@isaacmacqueen9695
@isaacmacqueen9695 Жыл бұрын
@@puppypunter8316 i think everything feels good to hipfire in that game lol
@getthegoons
@getthegoons Жыл бұрын
MW2022 had some of the coolest Shotgun customization ever. It really should be the standard. Too bad literally everything else about that game sucks ass
@puppypunter8316
@puppypunter8316 Жыл бұрын
ok now im interested@@getthegoons
@MTF-EPSILON-11-5-NULL
@MTF-EPSILON-11-5-NULL Жыл бұрын
@@isaacmacqueen9695pov realistic guns
@northropi2027
@northropi2027 Жыл бұрын
One thing I feel kinda got overlooked that could work in the favor of the slower shotguns is all the special ammo types left out for simplicity. The reason the SPAS-12 has a pump-action mode is because that mode doesn't need to use pressure from the shell to work- which allows it to use shells that offer too little or too much pressure to cycle the action on their own. Specialty shells like batons, smoke, and flashbangs- and possibly a very generous portrayal of Dragon's Breath and more fantastical options like defense-reducing acid shells and so on- would not be able to be fired semi-automatically or fully-automatically. They'd be all but precluded on the AA-12 (IRL, you could in theory manually pull the bolt back every shot, but this would be really impractical if it was your main weapon, so we won't do it for the game), and the SPAS-12 would have to accept descending to a pump-mode to use it. You could further balance out the SPAS-12 by just a little by reflecting the factors that made it historically a little unpopular- its pump mode is really hard to use because of all the extra parts in it, which also make it heavy, hard to reload even by shotgun standards, etc. A pump shotgun could, say, put out an acid shell to boost its effective damage on a reasonably quick followup shot, or a flashbang to make a window for said followup shot, whereas a hybrid semi-auto/pump like the SPAS would be able to do the same with more DPS in a followup barrage at the expense of a longer, highly exploitable window between the opener and the finisher and a really, really slow reload if you manage to miss? And then we'd have a dedicated semi-auto (Benelli M4, Browning Auto 5) without the potential frills of a pump but somewhat better flat DPS and much handier than the SPAS, and the Full-Auto about where it was before. You could even gate slugs to pumps (and also break-actions) as a special ammo type, as a lot of them have *too much* pressure for many semi-auto shotgun platforms to cycle, fitting them into the dynamic of giving manual cycling the option for "special" attacks- I feel like this *could* be better than having a dedicated "Slugger" weapon, though the semi-auto I-Hate-Walls-Niche could be filled by the M82/M107/any of those funny big-bore AR like .50 Beowulf/.458 SOCOM if you'd like. Also, while well out of the purview of the typical team shooter format, an RPG setting could also make a lot of use of pump-actions being friendlier to Less-Lethal/Less-Than-Lethal rounds than most firearms, with the aforementioned baton (and often rock salt) shells presenting options for non-lethal takedowns and whatever story implications could come with those.
@kirbyjoe7484
@kirbyjoe7484 Жыл бұрын
This brings back fond memories of the KSG back in Black Ops II. You had to play when your ping was low and the net code was running smooth as butter, but if you got into the zone with it the results were hilarious. The trick was that it fired a slug and you could one-hit kill with headshots at ridiculous distances which is no easy feat since it had nothing but iron sights and just a single projectile. I got accused of cheating repeatedly when the servers were running well. People just had no clue how a shotgun was one-hitting them at like 50 meters. Although 50 meters doesn't sound like that far, it is insane compared to the standard 870 which had a max range of about 12 meters and an effective range of about 6. I used to love dual-wielding pistols in that game as well. I can't remember the last time I have used and enjoyed pistols in a CoD game other than BO2. Usually, they are just such trash.
@MurlocScout431
@MurlocScout431 Жыл бұрын
you are talking to yourself
@Gatorade69
@Gatorade69 11 ай бұрын
The MW2 reboot actually had great pistols. The deagle could consistently 1 shot headshot if your aim was good. Probably the most fun I had using pistols in a game.
@notNajimi
@notNajimi 7 ай бұрын
@@MurlocScout431also known as leaving a comment
@J2K9ine
@J2K9ine 11 ай бұрын
You achieved what every video essay-ist should strive for! You took a subject that I the viewer am not particularly invested in, and made a video so well written and produced that I BECAME invested in your vid!
@HerMajestyVelvet
@HerMajestyVelvet Жыл бұрын
I really want to see a mode in a fps where one player is a juggernaut with a shotgun and sniper going against 10 or so other players armed with weak pistols and items like poison gas, kinda like dead by daylight but the goal is to kill the big guy instead of avoiding him
@tonyth9240
@tonyth9240 Жыл бұрын
I'm pretty sure that mode exists in some games, with a juggernaut, though he usually has a minigun, and the players AR's.
@R3TR0J4N
@R3TR0J4N Жыл бұрын
@@tonyth9240 yea, bet someone along the way of custom maps made one
@octakhan4673
@octakhan4673 Жыл бұрын
The fat-kid gametype.
@TJdaberry
@TJdaberry 3 күн бұрын
There’s nothing I love more then a great shotty, one of my favorite eras of warzone was when the duel wield fire shotguns were meta lol.
@Raansu
@Raansu Күн бұрын
Just means you can't aim.
@salty1201
@salty1201 Жыл бұрын
8:13 or make the gauge different! 20 gauge for auto (less damage) 12 gauge for pump/semi as an all rounder shot, and finally 10 gauge or lower for double barrels. I should mention that 10 gauge fucking hurts, anything lower starts to enter man portable cannon territory.
@DogeickBateman
@DogeickBateman Жыл бұрын
When Arch said "I am the Boomstick" and turned into a 12-gauge I knew this was the analysis of all time
@aloedg3191
@aloedg3191 Жыл бұрын
Oh yeah
@R3TR0J4N
@R3TR0J4N Жыл бұрын
i lol'd
@drummar_boy
@drummar_boy 11 ай бұрын
There's an exotic shotgun in Destiny 2 called Duality (people who play D2 probably see where I'm going with this), and it has a perk very similar to what you proposed around 15:36. However, the difference is when ADS, it turns into a slug shotgun, as opposed to a pellet spread when firing from the hip. It's not the most used shotgun in PvP (Conditional Finality is still dominant at time of writing), but I like the predictability and versatility of it. It really rewards actually being accurate with shots at medium range.
@Angelzvx
@Angelzvx 10 ай бұрын
Duality’s versatility has got to be its best trait. It’s Break action reload is even great with On Black Wings only making it better. Probably the best Dual Function weapons compared to most of the others in terms of pick up and play and easy access to both functions. Skyburner’s Oath, Revision Zero, Vex Mythoclast. Kinessa’s Sniper Rifle in Paladins and the Widow’s Kiss in Overwatch also come to mind with that dual functionality between hip fire and ADS.
@BumbleBea05
@BumbleBea05 10 ай бұрын
destiny 2 mentioned
@JoelHernandez-tz3vk
@JoelHernandez-tz3vk 6 ай бұрын
Argus, anyone?
@ender_z4nd3r83
@ender_z4nd3r83 4 ай бұрын
black ops 3 did it first with the argus (and probably some game did it before black ops 3)
@RequiemL34
@RequiemL34 3 ай бұрын
​@@Angelzvx literally my shotgun, and I may have never proc on black wings like a was just reloading sometimes the first week in season of the hunt, then always transversives, and now that holster mods exist it won't be reloaded ever again.
@ChristochatBTW
@ChristochatBTW 11 ай бұрын
I like what they did with the sawed off in the finals, you can one tap any class with both shells, and even one shot light with one shell, but you need to literally hit all of your pellets with heavy to do so, oh and there is no headshot multiplier so just go for center of mass
@tagg218
@tagg218 Жыл бұрын
For slugs instead of making holes, I would just give them full wall penetration (only thru a single wall though). Keep the power and the other stats the same, but make the trade off your spread is 0 at all times, but shooting at medium and long range becomes an RPGfest to make up for the incredibly strong ability to penetrate thin cover
@kuso_yaro_
@kuso_yaro_ Жыл бұрын
This channel surely deserve more love and views. The animation are smoot af and the script well written
@laboon344
@laboon344 Жыл бұрын
is smooth*
@MoterX
@MoterX Жыл бұрын
dude i have never EVER had a problem with the tf2 shotgun, imo it's the best shotgun in all video games ever
@DzekoZacher
@DzekoZacher Жыл бұрын
the only class has a shotgun but isn't intended to use still really kick ass with it lol, the shotgun's damage in tf2 is really low to compared to most if not all the other fps games, in exchange of sustainability and reliable damage, just... the only real problem is random crit but random crit is a problem to all other weapons anyway
@logicproblems3654
@logicproblems3654 Жыл бұрын
Valve meat rider
@Mate_Antal_Zoltan
@Mate_Antal_Zoltan Жыл бұрын
incorrect the MAG-7 in CS:GO is better
@DzekoZacher
@DzekoZacher Жыл бұрын
out of all games i doubt CS:GO has a good shotgun design
@MoterX
@MoterX Жыл бұрын
@@logicproblems3654 bro valve is just a good game company
@rem8183
@rem8183 Ай бұрын
When you talked about random spread pellets it reminded me about how the Panic Attack evolved into how it functions today in TF2.
@droman608
@droman608 Жыл бұрын
The balancing you refer to makes the shotguns more in line with semi auto rifles. Every weapon has a characteristic that makes it unique. Any alteration to one or more of these through accessories, could change a simple break action into a sawn off, to fire faster, to reduce the recoil and even making special shells. No ranged weapon can breach like a shotty.
PISTOLS: Better Than Reloading
37:25
Arch
Рет қаралды 1 МЛН
SNIPERS: A Nightmare for Developers and Players
31:16
Arch
Рет қаралды 6 МЛН
Из какого города смотришь? 😃
00:34
МЯТНАЯ ФАНТА
Рет қаралды 2,3 МЛН
This Game Is Wild...
00:19
MrBeast
Рет қаралды 122 МЛН
Funny Memes
21:33
VaazkL
Рет қаралды 742 М.
How Good Games Go Bad
33:49
Arch
Рет қаралды 1,4 МЛН
A Tale Of Three Scouts
19:59
Lucid
Рет қаралды 662 М.
When Your Game Is Bad But Your Optimisation Is Genius
8:52
Vercidium
Рет қаралды 1,5 МЛН
The Rules for Rulers
19:33
CGP Grey
Рет қаралды 21 МЛН
2D Counter-Strike is kind of amazing
16:36
LamWarp
Рет қаралды 2,1 МЛН
Everything WRONG With The Guns In Starfield
50:12
ItsYaBoyBrandyBoy
Рет қаралды 4,4 МЛН
Could There Ever Be a Fourth Core Character Class?
21:23
Eddventure
Рет қаралды 1,2 МЛН
Why is it Hard to Be Evil in Video Games?
20:21
Strictly Mediocre
Рет қаралды 2,3 МЛН
Games you can never play again.
17:15
The Cursed Judge
Рет қаралды 5 МЛН
Из какого города смотришь? 😃
00:34
МЯТНАЯ ФАНТА
Рет қаралды 2,3 МЛН