SHOTGUNS: The Right Tool for the Wrong Player

Can make all the differences in the world, Mr Freeman
☆ Support me on Patreon: www.patreon.com/user?u=87093422
☆ Discord: / discord
☆ Twitter: / archmeton
☆ My Other Channels: @Archmeton @HeyHistorically
⍜ SUPPORTER TIER PATRONS: - THANK YOU! -
⤷ Buldo
⤷ Jan375
⤷ Kapitein Eenbeen
⤷ Kennsile
⤷ Pitstab
⤷ PixelDot Original
⤷ S0r3
⤷ Smifel
⤷ therealjreturns
⍜ Musician Featured in this Video:
⤷ Chris Doerksen: / chrisdgnq
⤷ HOME: • HOME - Tides
⍜ Timestamps
00:00 - Intro
01:22 - The beginning
05:48 - Sticking Stick
08:09 - The Stats Part
14:24 - Luck?
18:05 - The Brothers Return
20:38 - Ew...
23:57 - Conclusion!
Arch is a channel that releases high quality videos on media like games, series and movies... aside from the shorter ones I guess :)

[@RawBerserker]

I think there is no more satisfying gun to use in a game than a well functioning shotgun. Even if it's not the "optimal" choice, I'd go for it every time.

[@Numbskulli]

Shotguns are my favorites as well. Sad that some games i play make them underpowered or they stop working as soon as the enemy is 2 feet away.

[@randomplaceinruralamerica9618]

Shotguns are really nice feeling but a revolver will always be my go to pick even if it usually doesn’t do enough damage to oneshot in the body and has a worse fire rate than most sidearms, pulling out a revolver and getting a headshot just feels so good.

[@2BrosOfficialGaming]

same

[@TheKirBoi]

If there's ONE gun you don't wanna mess up, it's the shotgun.

[@imgonnacream]

all of you cannot aim high sens + decent ish tracking means easy kills with no aim

[@Verbose_Mode]

A huge thing for balancing shotguns is actually *the number of pellets.* More pellets makes it more consistent, with a missed pellet meaning less.

[@McCaroni_Sup]

So, Birdshot?

[@christiandelao2547]

A lot of games actually don't give a head shot bonus to shotguns, and divide damage between the 8 pellets in a 12 Guage shell, making them less effective over distance as spread increases, what balances the shot gun is reload speed, taking much longer to reload less shots but with high damage

[@IncredibleMD]

@@McCaroni_Sup Well, birdshot also has SMALLER pellets.

[@C0MR4D3C0WB0Y]

I remember when BF4 changed the shotguns, most of the shotguns where incredibly underpowered from the defensive spec reducing body damage. Most shotguns had around 8-10 pellets. DICE changed it to the semiautomatic shotguns had 14-16 pellets and pump guns had 16-20 pellets and it broke the damn game. Assault rifles suddenly where far less effective even in bigger maps due to the number of pellets the shotguns where throwing. They timed it down but those guns are still surprisingly effective at ranges most shotguns wouldn’t be effective. Also not to mention Insurgency Sandstorm…

[@christiandelao2547]

@C0MR4D3C0WB0Y typical shot gun has an effective range around 150 meters, with shot, and with slugs it's not much shorter then most rifles something like 300 meters

[@SaltSpirits]

Fun Shotgun Fact: While your average 12g shell will come in a variety of colours, from your standard red, to blue, green, and everything in between, they will *never* be yellow. This colour is reserved for 20 gauge shells and acts as a warning sign to help prevent one from loading the wrong shell into the wrong gun.

[@cevatkokbudak6414]

Cool

[@rebel6301]

interesting, thank you for sharing

[@cavemanthog]

There are also Bolt-Action Shotguns

[@Boristhaspydr]

Do 16 gauge do that I purple too?

[@gameingwiththewolf8440]

Don't get me wrong I love the 20 gauge but the reason why 12 gauge is still used is because it was the one that least jammed the most newer models are more prone to jamming than the older ones

[@kookbook4399]

wait this isnt ahoy

[@nexus8824]

honestly, i still love this type of video.

[@davidvavrin1469]

At this point just make a game. PLEASE

[@Riseofhistiry]

DO IT DO IT

[@cynohammond-mw3ow]

YES

[@StuShitpost]

YES YES YES

[@DaMailman]

YEEEEES

[@Roguelemonhead]

Bro fr

[@shanweeboy]

The spas-12 was made to be a police shotgun. It had the pump mode on account of the non lethal loads not having enough chamber pressure to cycle the weapon in semi auto mode. They did the pump mode for those shells.

[@jamesbailey6257]

Gonna be a pendant here because I feel like it's a time it actually really matters, not non lethal, less lethal, less lethal rounds still can and do kill people because it turns out firing ammunition at protestors isn't exactly safe

[@whytho1690]

Neat tidbit

[@superpilotdude]

clever girl

[@mathewsvr5355]

This is true, but generally with how bulky the spring was even some standard loads wouldnt cycle all the way. But yes I 100% agree

[@shanweeboy]

@@mathewsvr5355 Yeah it was a chonk gun.

[@Desi-qw9fc]

I've always wanted to make a roguelike FPS that revolves entirely around one shotgun, and the point of it is to get better at cycling the gun (like Receiver 2 with a shotgun mod), at modifying it with weights and chokes and stuff, and at mixed-loading different kinds of shells for different situations (like H3VR where you can load different shells in any order).

[@denekhesab.2527]

maybe you should check out shotgun king

[@brodiscool2752]

I don't think shotgun king is an FPS, and no its not close enough to an FPS either.@@denekhesab.2527

[@taffyadam6031]

Mothergunship does something like this

[@user-ze1fs4ir8k]

make please, please make!!! c:

[@zerrierslizer1]

i'll support you with Audio Design if you wanna go for it. i have equipment to Record, Edit and fine tune all Audio for whatever is needed.

[@drummar_boy]

There's an exotic shotgun in Destiny 2 called Duality (people who play D2 probably see where I'm going with this), and it has a perk very similar to what you proposed around 15:36. However, the difference is when ADS, it turns into a slug shotgun, as opposed to a pellet spread when firing from the hip. It's not the most used shotgun in PvP (Conditional Finality is still dominant at time of writing), but I like the predictability and versatility of it. It really rewards actually being accurate with shots at medium range.

[@Angelzvx]

Duality’s versatility has got to be its best trait. It’s Break action reload is even great with On Black Wings only making it better. Probably the best Dual Function weapons compared to most of the others in terms of pick up and play and easy access to both functions. Skyburner’s Oath, Revision Zero, Vex Mythoclast. Kinessa’s Sniper Rifle in Paladins and the Widow’s Kiss in Overwatch also come to mind with that dual functionality between hip fire and ADS.

[@enbycracker9349]

destiny 2 mentioned

[@JoelHernandez-tz3vk]

Argus, anyone?

[@chowbox87]

Battlefield 4 made an interesting solution, they had 2 zones where random pellets could land. Most would land in the center, say 5 of the 8 pellets. Then the other 3 are spread in an outer circle, so that when you’re in point blank range you’ll likely hit all or most of your shots but as you go out, you have to be more careful aiming, utilizing the consistency of the inner pellets to get headshots

[@jodlaa5142]

and in bf they have a lot longer range than something like cod if I'm not mistaken, I remember playing bf4 for the first time and seeing a normal buckshot shotgun kill pretty consistently in 1-2 shots from ranges which would be max range in cod, I think it was because in cod pretty much everything is hitscan and shotguns are coded in a way that after a certain distance the pelets just disappear, while in bf, where I think everything is a projectile, they get to travel longer and still do solid dmg at like medium range

[@chowbox87]

@@jodlaa5142 yeah definitely, plus you know a conquest flag can be the size of some cod maps so everything needs stretched out a bit

[@Saurygiel]

XDefiant uses the same exact technique. I found that out when using their firing range, which I thought was pretty smart.

[@BenignStatue71]

I believe Battlefield 4 uses a headshot multiplier of 1x; as in it doesn't deal any more damage to a target (except for Slugs). Shooting the Buck and Flechettes at players is best done to centre mass and nowhere else.

[@BusinessWolf1]

You just described cone recoil, which every decent game uses. No shit.

[@russellhassan7773]

i love how shotguns function in high ttk shooters like team fortress and quake; when shotguns don't/can't easily one shot, they become a very skillful weapon since you need to hit all your pellets to maximize your damage output.

[@SyRose901]

Those games lack the omega strong assault rifles; and machineguns deal as little as 5 damage per shot, and even the Lightning Gun deals 160 per second, with Quake having players be able to achieve as much as 400 effective health, the shotguns become very, very balanced as it is the only weapon that works perfectly at point blank range or close range. Quake's Lightning Gun or TF2 Minigun both shred opponents at this range, but they're hard to use compared to the shotgun. At farther range, rocket/grenade launchers do better. Railgun/Sniper Rifle is king at long range.

[@pancakeperson8905]

@@poleve5409 The Sniper Rifle (TF2) is an infinite-range insta-kill weapon that has sparked numerous debates within the community for not belonging in the game.

[@smokey3504]

There are games with low TTK where hitting all your pellets with a shotgun is a skill barrier. I've been playing alot of COD WWII lately and the M30 Luftwaffe Drilling has such a tight spread and low base damage that it requires the player to aim with it accurately like a slug shotgun. In return it takes people down in one-shot at a range where other, easier shotguns can't even deal any damage

[@damsen978]

It also puts the Scout at maximum risk for being close as the fastest yet one of the lowest health classes in TF2. The higher the risk = the bigger the reward.

[@DexieTheSheep]

hell yeah, like the lever/tac in Fortnite

[@famulanrevengeance3044]

Shotgun complaining will never be valid in games with snipers that one shot a close range. They dominate every game, every range, every situation. Especially bodyshot 1 shot snipers. They ruin the flow of the maps, make people hide and camp. It's insane how this one class of weapons truly destroys games but for some reason people are deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in much danger if you play at range or play cover.

[@neerGdyahS]

"They dominate every range, every situation" "deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in danger." Okay, go try that and let me know how it works out.

[@famulanrevengeance3044]

@@neerGdyahS Lol I have and it's boring as hell. CoD, Battlefield, CS, Valorant, whatever. Most unskilled, cowardly playstyle there is, not fun for the enemy to deal with and requires the least amount of aim, recoil control and crosshair placement

[@SilverScarletSpider]

5:48 why tf did we turn it into a stick

[@YokaK80]

All guns are just sticks that explode stuff

[@Fishy378]

​@@YokaK80and they are deadly

[@heitordau108]

Because they are boomsticks

[@MGMac_]

I don't even play shooters and I like watching these videos

[@Adster2008]

Same bro same

[@coreydorce8246]

I play shooters and I like watching these videos

[@Bean_guy2]

@@coreydorce8246 ok

[@cruze_the]

Yeah man I play brawlhalla

[@Trashedac]

The slug idea is pretty smart in my opinion it wouldn’t fit perfectly in every game but I still think it’s a good idea

[@jtjoemamma]

They did it with the ksg in black ops 2 and others

[@mrvandal131]

Yes, I liked the idea as well

[@RiggedFem]

Destiny 2 also has a system where the slug shotguns are completely separate from the other shotgun frames. God if he thinks nos shotguns in other games are diverse, wait until he discovers precision frame shotguns in D2

[@The_Questionaut]

I prefer slugs, it makes the shotgun more fun.

[@JustABaptistApoligist]

@@RiggedFem or warframe’s many shotguns and custom guna

[@somo4227]

no gun will ever feel as good as the shotgun in tf2 universally used and reliable while not overshadowing other weapons,i especially love using it on soldier beacuse people expect me to bring out the shovel when they get close

[@rambysophistry1220]

There is a problem with 17:58. You need to add the versatility and frustration meter to every weapon and each one is interfaced with the other guns, since people compare and contrast their experiences between weapons. The shotgun is a leveler, and keeps the frustration meter against every other gun type lower then it otherwise would be. Why, because it is an appropriate counter to a skilled player. Making it a less appropriate counter will make every other weapon much more frustrating to fight against.

[@AxiamWolfe]

The roster of shotguns in Titanfall/Apex Legends approaches the design in an interesting way. None of the shotguns have random spread, and you get to choose between: - Horizontal Spread of Mastiff - Star-shaped spread of Peacekeeper, with ability to ADS and compress the pellets into a single point - Funky 8 shaped spread for the Auto EVA-8 - 3 pellets for the Mozambique

[@ajh3461]

Similar thing with the Panic Attack in Team Fortress 2, although TF2 also has fixed spread in comp

[@gentlefauna]

Honestly peacekeeper was the gun i thought of when he was talking about the pump shotgun

[@erinkarp]

mozambique here!

[@bear3616]

The mastif was a very fun weapon. You often need to lead your shots quite a bit when going fast. And being good at it is amazing.

[@flazerrazer2992]

the mozambique also has a choke like the peacekeeper just cant be toggled

[@athenajayvieljerios8343]

Shotguns in games: confetti Cannon Shotguns IRL: *Non-scoped crit-boosted sniper rifles* Edit: thanks for likes, and "Tonk Fortress 2" will be released soon! ^_^

[@bradley4465]

body armor eradicates shotguns. also sustained fire sucks ass.

[@BierBart12]

​@@bradley4465 body armor turns shotguns into extreme stun guns, unless one pellet hits your head

[@donny8652]

​@@bradley4465those guys are wearing body armor! Loads homemade white phosphorus shell

[@tabnk2]

@@bradley4465 the slug in question:

[@TechnicalOveride]

nothin like people who don't have combat training debating on how good a shotgun is in combat not saying i know what i talk about either, i just think you're all wrong

[@jacuzzirp]

Just stumbled across this channel and I am already in love with the content, images to picture what you are talking about and great explanations.

[@namekiangod7750]

for The Slugger you can make it shoot at longer intervals(maybe 2-3 seconds per slug) due to it's destructive capability. To not get countered by multiple people rushing at the same time, give The Slugger a Penetration stat so that if multiple enemies are lined up, The Slugger could kill 2-3 enemies in a line

[@tabula_rosa]

i replayed Doom 2 recently & realized part of the reason the shotty feels so good to use is that the damage falloff isn't artificial, it fires a bunch of pistol shots with the same damage & range as a pistol, and how much damage it does depends on how many of the pellets lands -- if you're close enough to cluster the enemy you do full damage, no matter how far they are means not only can you chunk single enemies but if ur firing into a crowd and each pellet hits someone ur still doing full damage, even if ur 40 feet away circlestrafing their fireballs

[@ssjbread2803]

Also, the original Doom shotgun lacks vertical pellet spread, which gives it a surprisingly REALLY strong medium range game and allows it to make do as an impromptu sniper rifle in a pinch, as you're pretty much guaranteed to get at least a couple of pellets on target at any given distance. The super shotgun lacks this boon, but makes up for it by both possessing more pellets AND dealing more damage per pellet, making it serviceable in medium range, ineffective at long range, and doing equivalent damage to the ROCKET LAUNCHER at point blank range. The shotgun is less a "shotgun" in the role it fills and more your workhorse rifle; the super shotgun fills the genuine "shotgun" role, and does a DAMN good job at it.

[@hi-i-am-atan]

@@ssjbread2803 also, all the doom 1 hitscan weapons have the exact same spread, so even without the quirk of completely horizontal spread, the shotgun has completely average accuracy anyway. the pistol and chaingun still have the advantage at long range due to having perfect accuracy when tap-firing, but long range encounters are pretty rare in doom 1 furthermore, both shotguns benefit significantly from two quirks: each pellet is only traced after the prior one has already done its damage, and hitscans pass right through actors that aren't shootable - including monsters whose hp just hit 0. this is the reason you, unfortunately, can't ever gib so much as a zombieman with a shotgun shot, even with the ssg at point blank, but it also has the far more useful consequence of letting excess shells "penetrate" on lethal hits. this is a _major_ reason why the ssg is so excellent at crowd control, as the full 20 pellets can distribute themselves with extreme efficiency to wipe out groups of mooks instead of all getting caught on the unlucky mob in the front and center. just another trait that makes the shotguns such great workhorse guns!

[@rafaelcastor2089]

Not an FPS, but i love the shooty in Intravenous for pretty much the same reason. It has a lot of spread between each pellet, yes, but the fact that they actually behave like somewhat like pellets actually behave in real life means it does a fuckton of damage and you don't even need to really aim, just point it at the general direction of guy and, unless he is far away, he is gone. The stealth part of the game is cool, but clearing a whole ass mob within 5 second is priceless

[@helloagain.andagain.andagain]

try ultrakill

[@aircraftcarrierwo-class]

The Super Shotgun is so beefy because while it consumes 2 shells of ammo, it fires 3 shells of pellets (21 pellets vs 7 from the regular shotgun). The Shotgunner enemy fires the exact same pellet, but only 3 of them. Doom was rather clever in balancing its shotguns around the number of pellets, with all the pellets otherwise behaving the same.

[@samuelantoniocastillomeza5034]

As a former owner of a Mossberg 500, I'm already loving this! Pump action shotguns are so satisfactory.

[@wr3nche5]

i own a mossberg 88 (a cheaper version of a 500 that still functions just as well) and i can confirm this

[@Abel-Alvarez]

Mossberg 590 shockwave here🔥 They're so cool. My next plan is to go for an Ithaca model 37 and a Winchester lever action. 🤘😮‍💨

[@floofyboi7546]

@@Abel-Alvarez I recently purchased my first firearm, 590’s are amazing. Im just sad most indoor ranges don’t allow shotguns

[@Abel-Alvarez]

@@floofyboi7546 would it be because of those that use birdshot/buckshot would bounce around the walls creating a safety hazard? Or something else entirely different?

[@floofyboi7546]

@@Abel-Alvarez I have no clue, I just tried all my local indoor ranges and they told me no shotguns

[@MrNobody-zx4jz]

Very beautiful and professional made! Congrats! I want more content like this, you really have imagination and know how to express yourself, wish the best.

[@noobyboilolz]

Doom eternal: like it or not, you're playing with it, bucko

[@p5ychojoe138]

I used to hunt with slugs growing up. Was pretty darn accurate with them, too. Always frustrated me when I knew they were in range but the game would say "no" even with slugs.

[@xtvernon15]

Ksg In bo2 was I think the perfect representation of them wile staying “balanced”

[@Grim_Erudite]

Indeed

[@ryang2573]

There are a lot of things, even in 'realistic' games, associated with guns that are either tweaked or omitted entirely for the sake of gameplay. What you said is just a subset of the larger problem of realistic firearms just being too lethal to be much fun in a video game. Even if someone is wearing body armor or is shot in a non-vital area, it really doesn't matter all that much what they're shot with: they're going to be hurting and, in some cases, probably severely injured as well. This is especially true for shotguns. If someone is shot by a garden variety 12 gauge loaded with 00 Buckshot, they're going down. Whether they get up again is a function of how good their body armor is, but - at a minimum - they are not going to be very combat effective for a while.

[@cdogdeluxe6037]

Only more realistic games that have very fast times to kill can properly represent shotguns without breaking the game.

[@sosig6445]

@@ryang2573 So a realistic game would kill you in 1 hit if you have no armor and stun you if you have armor

[@autismusmaximus4933]

The Shotgun in Insurgency Sandstorm is quite a tale in itself It is pretty much the most realistic representation of a shotgun in a video game. You WILL get domed by a shotgunner from 50 Meter away. In this game, the primary upsides are that Shotgun is cheap, meaning you can run it alongside a lot of other equipment, and that it is light, since it is basically just a pipe that shoots bucks, and you run with only a little ammo to slow you down. Its spread is so tight that you still need to properly aim this gun even at the closest ranges, and the fact that it one hit kills everything is overshadowed by the fact that pretty much every weapon does so. It's main downsides are that it fires very slow, only a sixteenth of the M4 (detremental when every shot is lethal) and that it has a rather long profile (The shorter the profile of a gun, the closer you can stand at a wall etc. the physical length of a gun is a stat in this game, meaning it is a bad weapon to peek corners or breach doors), which is bad, since the only class with access to the shotgun is the breacher. I think this is a very interesting take on balance for the shotgun

[@Appletank8]

yeah, when every weapon is lethal, shotguns don't stand out as much, which kinda holds true for sniper rifles. But when you scale things down to take at least 2 or 4 "shots" to kill in a best case scenario, you need to consider what kind of damage spread you want for all the different types of weapons.

[@ownedpilot4324]

Haha, that is why I like Insurgency so much. “F*ck balance, make everything op.”

[@hoonterofhoonters6588]

If you start with the premise that people usually die if you shoot them, the balance issues around shotguns disappear.

[@leifwulffstephan3725]

@@ownedpilot4324 realistic

[@autismusmaximus4933]

@@leifwulffstephan3725 Guns are pretty Over Powered in real life, though.

[@excuses6016]

How in the world is this channel not more popular then it is? This is literally some of the highest quality most entertaining content I’ve ever watched

[@J2K9ine]

You achieved what every video essay-ist should strive for! You took a subject that I the viewer am not particularly invested in, and made a video so well written and produced that I BECAME invested in your vid!

[@jgjg5182]

At 4:00 you show a simple animation of a Spas-12 and it is incorrect. The animation shows a direct blowback operation, whereas the Spas-12 is short stroke gas operated, which means when a shell is fired it vents some of the expanding gas from the barrel into a piston, which then pushes the bolt backwards, cycling the action. It is an important distinction

[@eveleynce]

important for real life, but not for video games, where the only defining factor is what values the developer uses to program them

[@leifwulffstephan3725]

Nerd Jk I also love firearms

[@Two-BallTyrone]

sounds like a whole lotta hoopla

[@SlerpyDerrpyBlue]

Thanks Einstein. Relax it was a joke.

[@Reactivity760]

This sh-t sounds so good

[@mcsmileycorp]

While not realistic I always liked how the titanfall games and apex handle it's shotguns, each gun having fixed and interesting spread patterns useful for different scenarios and rewards high skill players by giving them optimal points to aim for on opponents.

[@reiarukaza7490]

the fact that they flip the problem at its head by making the pellets only spread within the reticle blows my mind, as it really becomes a high skill floor weapon that really rewards accuracy with high dmg output, not to mention in combination with the fast paced gameplay

[@bear3616]

They were extreme fun. Sadly I haven’t been able to play it for a while. I’m on X-Box.

[@zyad48]

well, titanfall 1 at least Sadly the Eva-8 Auto in Titanfall 2 is a complete luck-based disaster after the nerfs :( I very clearly recall this because it pissed me off to no end, I played after the nerfs, amped the Eva (amping weapons reduces the number of shots required to kill by one, and for shotguns reduces the number of pellets needed for a one-shot by one) which would mean I only need to hit _3_ out of the 8 pellets it fires to get a kill flew directly into a guy and pull the trigger at point blank range, only to die right after and see on the killcam that he had only been hit by _one pellet_ The Eva in Apex does definitely have something going on that makes its spread more consistent though, but that speaks more to Respawn realizing how bad they screwed up a lot of the balance and gun designs in Titanfall 2 than anything else lol. (The R-201 in Titanfall 2 is an incredibly high recoil, low damage """rifle""" that only works because of the insane aim assist controllers give it, meanwhile the R-301 in Apex is a lovely smooth and very accurate proper rifle and even has a sort of recoil pattern to it as well, compared to the random mess of vertical and horizontal recoil in Titanfall 2)

[@Bone220]

Titanfall 2 is just honestly the Superior game in my opinion. It's underrated and sadly abandoned but Titanfall 2 was such a fun game, amazing campaign and a multiplayer that's genuinely replayable.

[@JohnSmith-kt3yy]

Wait is that why the shotguns in apex feel like shit?

[@encinoman903]

The spas is a very interesting shotgun. The pump action allows it to fire low-power rounds that wouldn't otherwise cycle the semiautomatic action.

[@dylanbuford6512]

Honestly this is a great video, I wasn't sure what to expect going in but I would love to see or play a game that balanced shotguns like this. Especially the double barrel and slugger, that sounds fun!

[@CaptainTechnicalityLP]

Worth noting that TF2 has the fixed pellet patterns for shotguns. Normally this is enabled as a server option, which is usually used in competitive play, however, there is also a shotgun in the game called The Panic Attack that has the fixed spread pattern as a built in stat.

[@notgray88]

panic attack is so underrated. it might not be the most powerful shotgun in the game, but it's really fun to use

[@thedog5k]

@@notgray88 Uncle dane says its legit I feel like its legit. Idk, i think its legit :)

[@Benneth12]

gun

[@Indoball1945]

Yeah that luck cap thing he said is bassically CoDM sg ads BSA

[@muselibarnless]

the panic attack is probably the best shotgun only behind the family business, or maybe engineer shotguns

[@Zorro9129]

Shotguns with realistic range are balanced in games with realistic ranges, because you still have a disadvantage at longer ranges in exchange for an advantage at shorter ranges. Combine this with buckshot having much less effectiveness against good body armor, and it becomes a very balanced weapon.

[@ADMICKEY]

Cough phantom forces cough

[@zyad48]

Yeah Insurgency Sandstorm kind of gets this, that said a lot of that game _is_ with indoor objectives and such, so shotguns kinda end up being extremely effective overall, even if the .50 cals can basically one-shot you through several walls and LMGs are insane on the bipod.

[@Nurse_Xochitl]

As I always say, realism balances itself out. But dumb fucks want shotguns and snipers/DMR nerfed to oblivion, while they want SMGs and ARs buffed.

[@tylerjohnson7204]

Hell Let Loose is a very good example of this. You can easily kill within 70 or so meters but beyond that you need a few shots unless a pellet hits a head.

[@eon2330]

Yes and no. Sadly most games don't even balance shottys in those games. Fact is shotguns are THE BEST handheld anti-human non-explosive weapon at 200m or closer. Its like a grenade you instantly detonate facing someone. Especially the full auto ones. The problem all game developers have is balancing automatic shotguns vs the semi autos vs smgs. Shotguns ironically should have longer range than most SmGs and overall faster firerate and projectiles IRL. Handguns are pointless. Smgs are sidearms not main weapons. This is the problem with balancing. Lmgs, Ars and shottys are the 3 main weapons. Snipers/dmrs are just higher caliber or more accurate AR(should just be a mod or attachment). So they use similar ammo and should have the same damage but more range or pen. Games don't EVER get that right. Even tarkov messes that up and doesn't have any semi-full auto higher caliber weapons. Like a scar or battle rifle. Fact is. Weapons like the aa12 should be THE only viable close range weapon. The 7.62 ir 5.56 weapons the only viable mid range, and the snipers the only viable long range. Mid range being 200m+ Long range being 450m+ Most games don't have any reason for you to fight at 400+m. Thats the problem. So everything gets claustrophobic. Smgs are sidearms for spec ops missions. They are the "don't shoot the airlock accidentally and over pen" weapons. Don't kill the hostage etc.

[@imscary2]

im surprised you did as well as you did in this video. the "stick gun" was a great analysis. the actually draw back to shotgun in actual combat is the weight and their lack of penetration. Rifles go through most walls.

[@axis1677]

dude, this video is what got me into ravenfield, i didn't even knew the game existed until i saw your video, in which the ravenfield gameplay was there, i gotta say, thanks, if i never saw your video i would never become so invested in it.

[@angel89775]

I feel like both shotguns and snipers were introduced as a way to teach fundamental lessons. shotguns were designed to teach players to treat every corner like theres a bad guy around it, and snipers were made to teach how to respect a sightline, as well as both of them forcing a player to learn how to solve a problem in another way, rather than just running at it. with the oneshot mechanic weighing on a player's mind, it will subconsciously make them play safer, and smarter.

[@MetaRain]

This is oddly poetic?

[@jasperjazz4467]

Players not being able to run at the problem, being forced to think--not very popular with gamers these days...

[@lawjef]

What fundamental lessons are taught by using a riot shield? It’s a trick question, riot shields are a waste of everyone’s time.

[@ahmettmi7432]

@lawjef flanking, the most important tactic of warfare

[@ZestyAlone]

Nah they just asked what guns they could add in and came up with shotguns and sniper don't think there was ever a masterplan involved

[@FormerlyOrca]

I'm surprised no one has mentioned the guns from Titanfall 2 in these comments, not only are they great examples of weapons balanced with unique playstyles in mind they're also not afraid to leave the realm of reality for the sake of fun/balance. The Mastiff shotgun in that game even changes it's wide line spread spread to a consistent circle when ADSing just like in your vid!

[@StainlessPot]

Love the Mastiff, but could never get into the EVA8.

[@gokufromfortnite5600]

@@StainlessPot Eva 8 shreds

[@endurgai]

cold war

[@penguatarctic]

​@@StainlessPotI had the opposite situation where I couldn't get into the mastiff but loved the EVA8

[@damiankrause6622]

"balanced" *spitfire LMG would like to join the chat*

[@SKY_252]

Black ops 2 was the first online FPS I played when I got it around 2012 I believe? I was so horrible at it, and I really mean it, so bad but I was still having fun. I couldn't aim properly because I was always killed in a second, then that's when I found the shotguns of the game. Using shotgun I started to learn how to be more careful and move around the maps, having at least a few kills. That's how I started to develop my FPS skills I have today, I started to develop my aim bit by bit because if you missed you were probably dead, and that slow but steady "training" ended up with me switching to other weapons after a while. I felt anxious with other weapons because they couldn't kill as fast as the Remington but before long I learned how to use AR and SMG as well and decided to stick to those. The shotguns helped me learn the game and the genre, and even though I don't use them today in any game for the most part, that whole learning process I had with them makes me keep them close to my gamer heart

[@TheGreatJon]

This is a really great breakdown for balance, well thought out mate!

[@ahoy1014]

Another solution to the pellet spread without making it non-random is how Fatshark did in in Darktide: shotguns have a Minimum Pellet Count, which means that if a shotgun is fired, if fewer pellet than the MPC value connect, the damage inflicted on the enemy is increased to match the MPC. The MPC subsequently increases in value when aimed down sights.

[@eveleynce]

another good way is to put them on a bell curve instead of being evenly distributed, and you could also do several layers where several pellets are guaranteed to be within that range, that way you always know vaguely where you will hit, but the farther out you go, the less leeway you have with it

[@migueeeelet]

@@eveleynce Yeah but the issue turns into how you code that. Someone talked about a game where 5 out of 8 pellets shoot in a tight ring while the remaining 3 shoot in a wider ring, that'd be a good approach

[@someguy3763]

I love how Ultrakill “solved” the issue of balancing shotguns at longer ranges by letting you punch a single bullet from the spread to essentially create a highly explosive missile that always lands wherever your cursor is.

[@jetnyan2348]

i love how that was originally a bug but hakita decided "its a feature now and it also gives you tons of style so bye hard damage"

[@helloagain.andagain.andagain]

Machine, I am not going to sugarcoat it 2 + M1 + F.

[@juanmanuelfariasmarroncell2514]

Bro, that's like having a problem like... a table that has a slightly shorter leg. And solve it fucking mining 2 kilometers down and then installing a spaceship propulsor in the short leg, but leave it with just enough power to not fly out of the atmosphere, but only to lift it the 3 millimeters the leg is off.

[@Jazz-dh2ds]

@@juanmanuelfariasmarroncell2514 Gotta rewrite that, that was a tough read but I get you. Could've made a better metaphor but whateves

[@patrickfrost9405]

@@juanmanuelfariasmarroncell2514 It's like having your son die but you're a scientist and you download his soul into a tomagachi and give the tomagachi to his brother.

[@devilinwilliam4121]

The quality of ur videos are just muah. Top level.

[@thedirtydiddler8287]

Omg I loved that little smile your avatar did during the intro sequence. That's how you know quality video editing right there

[@thedirtydiddler8287]

Also really good flow of a script! I love finding video documentaries like this where I won't even be too interested in the topic, but just the character of content created is so amazing!

[@Krystalchan2009]

3:40 Gun Nerd time; the Spas 12 is made for BOTH semi auto and pump action operation. And this is why various games tend to pick one or the other. This is because the semi-auto fire mode is made for traditional rounds, such as pellets and slugs. While on the otherside, the pump action is for low pressure shells or specialty shells such as the flash shells, beanbags and even dragons breath.

[@tranngockha6562]

That is so cool to know. Thanks mate.

[@PhoniexStudio]

And in games, usually speaking, the semi auto version deals less damage (balanced by faster fire rate) and the pump action version deals more damage (balanced by slower fire rate)

[@ssjbread2803]

​@@PhoniexStudio and then there's half life...who mistakes the magazine tube as an extra barrel

[@stoneraptor6219]

I finally get to understand it

[@notNajimi]

@@ssjbread2803at least the tube is actually there irl, the mp7’s “grenade launcher” second barrel is just some shit they made up. The mp7 from that game is such an abomination 😭

[@catcatcatcatcatcatcatcatcatca]

Team Fortress 2 managed to have extremely well balanced shotguns by simply not having an assault rifle. Not having any such hitscan weapon that excels at mid range and high base-hp compared to damage on midrange meant that shotguns had a very comfortable spot to fill. I wish more games just didn’t have assault rifles. It’s a perfectly valid choice and naturally opens up a lot of ways to build dynamics and counterplay.

[@evilded2]

Yes.

[@ssjbread2803]

I completely agree, but at the same time given how many FPS games are Generic Military Shooter #361927917™, that's kind of an issue. Granted, if your game isn't a military shooter, this isn't a problem, but even if it is, there's still a weapon you can remove to give shotguns a comfortable niche - the SMG. In real life, they have an equivalent effective range, and in shooters they're constantly stepping on one another's toes as the designated CQC weapons. This can allow shotguns to fill that close-to-medium niche that, in other games, get dominated by the SMG, and it means that having a one-shot kill at point-blank is no longer top priority. Instead, their capabilities at range can actually be expanded upon a bit, with a two shot kill at close ranges and a 3 shot kill or so at medium ranges seeming pretty fair to me. In addition, if you plan on using multiple shotguns, you could have this trait taken by semiauto shotguns, while keeping the "traditional point blank OTK" role of the pump shotgun. Slugs could be balanced by having better shot accuracy, damage, and range, but being overall a fair bit slower and with a LOT more recoil, which would not only keep balance but also reflect real life.

[@aSmallGreenDot]

I'm probably biased as a tf2 player but I find sniper rifles way more frustrating to play against than shotguns

[@happyjohn354]

@@ssjbread2803 Evil with military shooters shotguns are fine if you give them realistic range and spread. You can absolutely wreck people shit at 60 meters with 00 buck. One of the only games I know that does this well are Insurgency Sandstorm and Enlisted.

[@plantain.1739]

@@happyjohn354 I've always found it weird how many games market themselves as realistic, and yet have basically the TF2 shotgun with hyper realistic smgs. I guess most gun companies only really give a shit about service rifles, and demand they get special treatment.

[@G_Gearshift]

All the videos U make are so great and easy to understand. I love it

[@GraffitiGamer991]

I love the commitment he has on all of his vids. Keep up the good work!🤓

[@BlazeMakesGames]

The fixed spread idea is really interesting and could also be used for some very subtle ways to balance the weapon at longer ranges. For example if you made the spread a circle pattern, you could balance the exact range of the weapon by the size of that circle compared to the angular size of a target's head. In theory up to a certain range, a good enough player could have all of the pellets hit the target's head, so that even if the gun could normally max out at 50 damage, it would still kill in one shot because every pellet would get doubled from the headshot damage. But then if you were shooting at someone farther away, even if the damage wasn't reduced any more, it would be impossible to fit all of the pellets inside the target's head, and thus be impossible to get a one-shot kill. And of course at even further ranges it would be impossible to fit all the pellets even just on the target's body as a whole. Thus, this could be a way to balance the weapon without needing to reduce its damage completely at long ranges, because the fixed-spread would make it impossible to hit with all of the pellets anyways. You could even theoretically take into account the maximum amount of pellets you could fit into a headshot or bodyshot at different ranges to fine tune the details. On top of that, that could introduce good side effect where the shotgun becomes good at fighting multiple enemies at long range, even if it's not good at fighting a single enemy. Because if say the sum total of all pellets still does 50 damage at long range, even if it's impossible to hit a single target with all the pellets, if you're fighting a group of enemies in say a more team-focused environment, you could more reliably distribute that damage over the group, which could either help soften them up for an ally to finish them off, or at least make it easier to fight them when they get closer, since you could probably shave off that 10 damage you need to one-shot them with short range bodyshots.

[@doomspud6302]

I've played a couple games that do that, and it usually works well. The most recent one was Aliens: Fireteam Elite. All the shotguns in it fire a pattern that looks random, but is actually always the exact same. Which is nice, because it makes them more predictable when surrounded by Xenomorphs. The other is Borderlands 2. Several of the unique shotguns have special spread patterns. Like a pirate shotgun that makes a skull and crossbones. I haven't played any PVP games that do this, though.

[@armadis4168]

​@@doomspud6302 competitive tf2 has fixed spread

[@jblazerndrowzy]

⁠​⁠​⁠​⁠​⁠@@doomspud6302 There are many pvp games, especially recent ones, that have fixed spread like TF2, Fortnite, Apex, etc.

[@lunasagaming5801]

@@doomspud6302 The Panic Attack in tf2 has a wide rectangular spread.

[@PrimordialNightmare]

Vermintide 2 and Remnant from the ashes are two games I've played that have crossbows that can shoot multiple bolts at once, though usually in a fixed horizontal line spread pattern, which made them interesting to use and pretty much turned them to low range high damage or mid range anti group weapons. I found them to be fun.

[@zeropoint5794]

A pro tip to normalize stickgun's damage output at medium range: The Normal Distribution! Instead of dropping pellets at random inside a circle, use the bell curve to guide your randomness, now you get more pellets in the middle and less on edges, both making the damage more consistent and rewarding the player more for pointing the stickgun directly at the target

[@jamesphillips2285]

Normal distribution can still be random. You are referring to the shape of the probability distribution.

[@zeropoint5794]

@@jamesphillips2285 yea thats why i mentioned using the bell curve to guide randomness. It's still random and can lead to major flukes, but overall it's going to be way more reliable

[@spacecatsftw]

@@zeropoint5794also make sure at least one pellet always lands in the center of the crosshair!

[@StarComet7]

Pattern and some randomness is better imo

[@HazardThe2st]

I still think its just best to have the pellets fire in a set circle pattern as it has no randomness, unless you count the spread changing size depending on whether youre crouching, prone, standing, moving, etcetera

[@Qeseriju]

that was incredibly entertaining, laughed all the way through!

[@reaper4812]

Beautiful choice of music, brother.

[@frederikvoigt132]

It would be extremely cool to see a game where the guns are based on your balancing ideas

[@somedudethatripsplanetinha4221]

The double barrel would be something in of itself

[@BustyCatbot]

Wouldn't be surprised if smaller game devs are taking notes, I know I am

[@acake6654]

i hope the game devs looking for advice actually consider if it fits their game before accepting it, cause this video is full of holes

[@BustyCatbot]

@@acake6654 Literally the end of the video said this advice doesn't fit in every game, and it's a given that you should consider if it fits, no shit. The only thing full of holes is your understanding of the video.

[@acake6654]

​@@BustyCatbot so let me get this straight, he keeps talking about shotguns like its the generalized term with most FPS games out there, but how many even have the highest headshot damage out of all weapons? what about the differences between random bullet spread and fixed spread? what about the games where increasing accuracy or using ADS somehow tightens the spread but for others its a fixed point? why do we have an entire stick section dedicated to explaining how shotguns arent realistic like its rocket science and we forget that videogames are unrealistic..? im sure you wont arrive in the hospital in time if you get shot in the thigh with a rifle. i dont like his video format, as in these, he simply regards a version of a weapon category's balance based on many, many games that couldnt possibly represent any of them.

[@j.r.mocksly5996]

I like the solution in the insurgency series and other more realistic shooters: make every gun lethal. When every gun performs at least somewhat realistically, the shotgun becomes more of a style choice that rewards players with good aim since it just isn't as good as a full auto gun. As in insurgency, sure your rifle might take 2, 3 at most shots to kill, but failing to get a kill on a shotgun shot is sure to lose you the fight. The shotguns just feel very satisfying and have a lot of punch behind them and can perform at range, but any full auto gun is just easier to use. It flips the normal shotgun dynamic on its head

[@Nurse_Xochitl]

Realism balances itself out. Players need to stop being stupid and running around like headless chickens. If they did that, then they might find tactical shooters (not CSGO, not R6S - those are arcade shooters) and milsims fun. Besides that, they get to learn how shit works IRL to an extent, which can be valuable knowledge when SHTF.

[@packwolf445]

​@@Nurse_Xochitlusually the people who complain in insurgency when they face a shotgun are the guys not bothering to throw a nade on OBJ and get a buckshot tearing their arm off

[@Nurse_Xochitl]

@@packwolf445 true

[@yuvalgabay1023]

​@@Nurse_Xochitlor like in many insurgency maps..every camps . camping is the bane of every sims .

[@Nurse_Xochitl]

@@yuvalgabay1023 lol cry about it xD

[@camping_bastard3198]

i'm glad to see a soon to be huge KZbinr (and one of my favourites) feature Ravenfield!

[@OrionGaming115]

I hope you post more, these videos are gonna be helpful for developers

[@dominik9506]

It's just nice to see that some content creators really care about quality. Continue with these masterpieces

[@naominekomimi]

I feel like limited versatility isn't necessarily a bad thing. It changes the way you play and makes the game feel very different, having to build around mobility and learn the areas of the map with ranges that favor you vs areas where you'll be outranged consistently.

[@sourlab]

I love how their used in re games specifically re8 and re4 they feel like a power weapon when im feeling claustrophobic scared put that thing out and BAM it always looks and works amazing

[@grzegorzbrzeczyszczykiewic563]

Also, low versatility means that mastering it can be more satisfying, seeing as, in order for the weapon to be viable, the one who has to become highly adaptable and responsive is you. This ideally means the shotgun would have a rock bottom skill floor (shoot at the dude at close range and you're officially 1/0) and a sky high skill ceiling (you can never rely that your gun will get you out of a sticky situation, so every situation is higher stakes than usual).

[@dr_gen.]

22:11 For the slugger idea, theres something like that in Ready Or Not called the "Breaching shotgun" which is meant to break down doors 👍

[@skyninja979]

I don't usually care when it comes to "first impressions" with KZbin videos, as my "first impression" with this video, was that you were trying to be another "Ahoy". But I was pleasantly surprised to see so much depth in the gaming side of things, rather than the actual history side. And your art/content style is very satisfying to look at! Glad I came across this video! I will definitely be binging more of your stuff!

[@iamishin7675]

You can't have a 1-shot for the shotgun rely on headshots, because you are only realistically going to get that "1 or 2 pellet headshot hit" at medium range. A shotgun at point-blank range should be able to one-shot to the body, but under this scenario this would never be the case. It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots, which would throw off the close-medium-longe range curve.

[@Kwotzi]

This is exactly what I was thinking. For the shotgun to do enough damage for 1-2 pellets to headshot, the damage would also be high enough for it to still one shot body shot anyways since the body is a bigger target and more pellets are likely to hit it. Making the shotgun effectively one shot at anything but long-range still.

[@CoralCopperHead]

"It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots..." That's pretty much how it works in Payday 2. The game doesn't divide the damage total across all pellets, instead a hit is a hit that deals full damage, regardless of whether it was just one pellet or a full meatshot -- however, the game uses the headshot multiplier, again, even if only a single pellet hits the enemy's head. Actually had a newer player ask what shotgun I was using back when I first picked it up (the trusty Loco, for the record), they were surprised I was using it effectively to fight across the street. Not from sidewalk to sidewalk, either, I was fighting from the china shop in Four Stores and shooting down enemies in the tech store on the other side of the road. Spitting distance for a real shotgun, sure, but fukken video games. (I still remember my utter disbelief when my roommate and I confirmed, in splitscreen, that the pellets from CoD's shotguns _literally disappear after seven meters._ To this day, I'm annoyed that it didn't piss me off, but I was just too stunned to believe what we'd proven.)

[@daegan_ftw]

@@Kwotzi Give headshot damage multiplier a drop-off curve over distance; you need all the pellets to hit to get a headshot kill from long range (basically impossible) or only two thirds at medium range and 1/3 at close range and body shot one hit kills at point blank.

[@Imaperson1020]

@daegan_ftw That increases frustration as it's extremely easy to one shot, which comes around to the issue at the start. If you only need 1 pellet to one shot, then you can one ahit by aiming at the upper torso or neck, so you at least need some kind of skill to get consistent close range one taps.

[@keyboardstalker4784]

@@CoralCopperHead Is it really true COD's shotguns literally don't do damage past 7 meters? Which COD did you test it in?

[@generalpacman6414]

19:48 in Killing Floor 2 the boomstick has an alt fire that fire both barrels bound to middle mouse, so you still have the option to fire one at a time and aim down the sights.

[@resimatemaluleke9096]

Great Video really gives chilled vibes

[@wds204]

This type of content really reminds me of ahoy, keep it up man ❤

[@BunkeredGaming]

Really glad that the stick gun is balanced around the AR, it would be super overpowered otherwise.

[@UncleRJ]

The most mind-blowing thing about this video is not once it's shown the DOOM's Super Shotgun, which is arguably the most iconic shotgun in video games.

[@CoralCopperHead]

This entire channel seems to use the standard modern military shooter as the baseline for balancing, which the SSG absolutely shreds. There's a reason we call it "SSG _jousting"_ -- because it's less like a shotgun and more like a *_lance._*

[@dannybrine8718]

The Super Shotgun isn't a gun. It is just pure weaponized "Fuck you"

[@DinnerForkTongue]

@@CoralCopperHead Including the range! Some reach, but not a lot.

[@sportyeight7769]

This video is majoritarily influence by COD/R6 kind of gameplays. It fails to explore the shotgun in other types of games. For exemple: DOOM with the most iconic shotgun, hunt showdown who i think as the best balance between shotguns and other weapons or even TF2 with innovative designs on shotguns.

[@DIEGOLOKO82]

to be fair, when talking about Balanced weapons, DOOM is not a good example

[@lidob]

Amazing analogy, you just earned a subscriber.

[@ciCCapROSTi]

Good animations, good analysis, good jokes, overall good stuff.

[@Dni..]

your videos are so good. you just popped out of nowhere and released 5 high quality videos after only a year of content on another channel. i can't imagine how amazing your videos will be in 2025.

[@Dni..]

I noticed a typo but i recently found out that editing a comment removed a heart so i'm leaving it in

[@jodlaa5142]

yeah this guy reminds me of Ahoy/XboxAhoy who does like in depth videos of some iconic weapons from through history and their role in games, but on this channel it's a bit more oriented on the developer/balance side, which is also pretty interesting to watch and learn of that mindset when it comes to these classic weapon types we're all used to using in most fps games. I wonder @Arch, do you watch @Ahoy and was he an inspiration to you towards these videos? Also, it would be pretty cool to see a potential collab with you two some day.

[@Barumar]

The level of detail and analysis provided is truly impressive. I really appreciate how the video dives into the mechanics and characteristics of shotguns, giving viewers a deeper understanding of their effectiveness in gameplay. The visuals and explanations are clear and engaging, making it easy to follow along and learn. Thank you for creating such an informative and enjoyable video!

[@OfficialArch]

My pleasure :)

[@stillton5592]

This is purely a shower thought but: One part of shotguns that I feel a lot of games get wrong is they include both the bloom, or simulated handling, and spread of the bullets together. I believe a more realistic approach is to separate them into two different circular fields. The outer is supposed to simulate the handling of the weapon by the main character and the inner is the spread of the shells. The inner circle is required to be fully inside the outer circle and the pellets can only be inside the inner circle. The outer circle would tighten or simply disappear when aiming down the sights meaning ADS is most likely needed to even hit opponents at medium to long ranges. For different types of shells and barrel modifications the inner circle will be our variable. While using slugs, the inner circle would be incredibly tight, allowing for greater prowess at longer ranges at the trade-off of being a huge gamble while hip-firing at anything but almost point-blank. Chokes and other barrel mods will change the inner circle based on the mod. A duckbill mod will change the circle to ellipse or a line with the orientation of the mod changing how pellets will fire. A choke will simply tighten the inner circle and a sawing off the barrel will increase the size of the inner circle. For stock and grips the outer circle will be our variable. These would mostly be the same with shotguns being able to take one of each kind. Shotguns with grips and stocks would have better simulated handling and usually lower recoil at the trade-off of being less effective in close-quarters combat, but not by much. Modded shotguns would generally be better for long-range combat and less effective in close quarters combat, rewarding accuracy. The biggest problem I can see with this is the deviation from the nature of shotguns as the close-range weapons that suffers at long ranges, but I believe that some games would benefit from having a more realistic system in place, especially games that try already to appeal to that hyper-realistic gun feel.

[@GoddessOfMisfortune]

The pump shotgun you made was quite literally the ones in Dirty Bomb, splash damage knew what they were doing.

[@pirateFinn]

I think the most interesting "balancing" I've seen recently for shotguns is Ready or Not, because levels of body armour penetration, lethality and whether you even want the spread or you may accidentally shoot a hostage matters. Along with the fact that if you miss, the time spent firing the next may be what spells your doom while being shot. Very interesting game.

[@xostler]

I was in here to talk about shot ballistics and chokes but I just realized it was talking about gaming lol Does RoN have semi auto shotguns?

[@pirateFinn]

@@xostler It has the M4 Benelli as a semi auto option!

[@cameronsloss3829]

RoN definitely high lights disadvantages of pumps but not highlight why people choose to use the two in a tactical setting. With semi auto’s you are restricted to loads you are able to use while a pump action will feed and cycle anything. I had to tinker and work in my gas system so I can use game loads on my 11-87 police which was designed for 2 3/4 heavy loads like slugs and 00buck.

[@aloedg3191]

Haha Doom

[@OzixiThrill]

There is one value that's worth considering in basically ALL balance topics - Obtainability. In games like CS, weapons are lost between matches and you only carry them through the rounds if you don't die. And each weapon costs a different amount. This means that they have some leeway at making weapons less balanced, as the fundamental gameplay loop makes getting a stronger weapon more of a gamble than simply just an upgrade.

[@MightyGachiman]

Also you dying with a shotgun hurts less because the enemy can only loot that weapon instead of an awp or an assault rifle.

[@TheFirstCurse1]

That's something that's very specific and niche for shooter games, especially multiplayer ones. In most shooters you can choose whatever you want in your loadout and you have it the whole game.

[@CoralCopperHead]

I'll take your Obtainability and Gambling balance factor, then attach "Map Knowledge" and "In-Map Weapon Spawns" to introduce you to what the Arena Shooter used to be. UDM2 MAP01; the BFG is _right there_ in the pavilion, and the button to lower the lift is easy to access -- but the lift takes long enough to rise that you're a sitting duck in the most wide-open part of the map while going for it. I've picked off people going after the BFG in that map with a freakin' pistol.

[@CoralCopperHead]

@@TheFirstCurse1 "In most (bad) shooters" I fixed it for you.

[@yapflipthegrunt4687]

@@CoralCopperHead based arena shooter enjoyer

[@daltonjobe747]

One of my favorite shotguns in a video game is one from Warframe - I think it was the Tigris? Double barrel where one barrel fires as soon as you click and the other fires when you let go of the moute button. It just felt so fun to use. Really quick click was a near simultaneous two shots, or you could click and hold as long as you want to delay the second shot.

[@avriladam0404]

Was waiting for the shotgun video and I agree with all of the changes

[@Mahashma]

I think Tarkov has done it best so far. Shell selection is everything. 8mm express buckshot can slap you sideways from 20m but only if it hits somewhere unprotected, while AP-20 can punch through Class 4 body armor at 50m. You can spam a Saiga-12 as fast as you can mag change. And each pellet is modeled individually.

[@lolobuf]

Looks at how rust has done it wayyy better

[@mafiapenguin9878]

​@@lolobufkys

[@GatorDontPlayNoShit69]

@@lolobufno. Just. No.

[@ruipereira4134]

What about into the radius

[@lolobuf]

@@ruipereira4134 50m with slug is easy kill but you can do 1/4 damage at 200m when you shoot buck i dont know

[@_mazarico_]

FEAR's shotgun was legendary! Its only weakness was against armored Replica soldiers past medium range but even then, it still had a fairly accurate pellet spread for a video game shotgun. And within that limited range, it tore enemies and the combat areas to shreds. I never replace it once I pick one up whenever I replay the campaign.

[@XenoSpyro]

Even against armored enemies the VK12 is still good. That's just how bad the AR and SMG were. The 3-burst rifle was really good but there's crap for ammo, and the nailgun overshadows all of them anyway.

[@heideknight9122]

Same

[@hiiambarney4489]

Can't quite remember. Have some fond memories playing Fears multiplayer back in the day though.

[@KhunShawn]

14:50 All scenarios you get a pencil in the neck

[@Atriaa6]

Or a lawsuit

[@AlairrJC]

Great video, as always

[@maybebirb]

-Appears on KZbin -Makes the greatest videos on balancing guns in FPS games ever seen with professional quality implying he's been doing this for years -Refuses to elaborate -Vanishes for 2 months I do love Arch

[@ashentwo6608]

I love these kinds of youtubers

[@michaellooks8397]

​@@ashentwo6608 No drama, no bullshit, no screaming, minimal "nostalgia", just solid, focused presentations. Wish they were more common.

[@AlairrJC]

@@michaellooks8397 I AGREE

[@andrewvirtue5048]

Well he's got my vote now. Subscribbled!

[@Sushiii1400]

​@@michaellooks8397Something so nice about watching these videos. Just sid down with a meal and relax. ♡ Best kind of content on KZbin.

[@EJB9]

I think the way the AA12 was done in spec ops: the line was good. It was an end-game weapon only dropped by elite enemies, and it does all those nice things shotguns are good for, but was also properly balanced similarly to an assault rifle, and its super satisfying to use.

[@CJmtb91]

Also one of the best representations of what an AA-12/USAS-12 is actually capable of was the pre-nerf explosive rounds in Battlefield 3, the thing made you a walking assault platform.

[@dustronyt4565]

I found it ironic that, if you put some time in training, the pump action shotguns are the fastest ones. Depicting this in games isn't viable of course, but it's an interesting thing You could do 3 or even more shots per second with a pump action, which isn't possible even for a fastest semi-automatics. Full auto shotguns actually the slowest ones once you put time in training Ye, I'm aware how much of "if you train enough" here, but it's really interesting fact

[@LeoJohnGalt]

@@CJmtb91 My god, core memory unlocked. I'll never forget 64-man Metro pre-nerf. The entire match was nothing but smoke and explosions and even death couldn't give you a break from it. I still remember a medic train reviving me like five times in a row in one of the hallways all the while both teams were using the explosive slugs.

[@LeoJohnGalt]

@@dustronyt4565 From what I can tell, those slamfire shotties actually can unload faster than an AA-12.

[@JK4600Ace_of_Spades]

​@@dustronyt4565the saiga 12k could maybe keep up

[@thedomainofsealteamaqua]

the "shotgun" is basically the equalizer: even the newbie's can use it, and the pros fear it.

[@ChristochatBTW]

I like what they did with the sawed off in the finals, you can one tap any class with both shells, and even one shot light with one shell, but you need to literally hit all of your pellets with heavy to do so, oh and there is no headshot multiplier so just go for center of mass

[@yazoink6690]

I like the way Darktide does shotguns. The high reload time makes up for the huge burst damage you can do. Plus, the spreads are actually realistic (ish)

[@Scroolewse]

There's no point in talking about a single player game's shotgun in a video about shotguns in multiplayer. They are completely different beasts. Imagine getting a true-to-Doom Super Shotgun in CoD lmao

[@yazoink6690]

@@Scroolewse ... Darktide IS multiplayer, just like Tarkov. Both are fine with giving their shotguns the range they deserve.

[@Scroolewse]

@@yazoink6690 ok I should have said PvE is different from PvP but I figured you would get my point.. also not really sure what you're bringing up Tarkov for, I never said anything about it.

[@kubaGR8]

Darktide also does minimum pellet counts. If you fire 14 pellets with a Ripper Gun (which has a minimum pellet count of 7), then even if only a single pellet tags an enemy, it will count as 7 pellets hitting instead.

[@quickdraw6893]

Except the shotguns don't actually do all that much damage in that game lol. The slug rounds you can manually load do, but their output as a whole is pretty crap compared to a lot of other guns, even in the burst department.

[@nikosgalaxygames553]

Warthog auto shotgun from Deep rock galactic is a good example of realistic shotguns in video game, it can hit enemies for good damage at long range but can one shot certain enemies at close and very deadly to most high health enemies, it shoots shells with a good number of pellets to follow which can be upgraded to have more pellets. Overall a good designed shotgun which pumps those bugs full of lead.

[@randomcatdude]

Magnetic Pellet Alignment overclock my beloved

[@giantslayer9335]

ROCK AND STONE

[@letsrunahypothetical8734]

Rock..... and.....STOOOOOONE

[@lambchaikies]

Deep Rock Galactics weapons are increadibly well-designed (except for the Subata...) and one thing I'd add here is the Scout's Jury-Rigged Boomstick has an additional role for its shotgun: close range AoE. In addition to having a hitscan bullet spread, it also has a small, invisible, rectangular AoE muzzle-flash that deals 20 explosive damage (just enough to kill swarmers and the jellyfish, or push over a kill threshold on a slasher). It's a clever little addition that does a lot of work, and makes it subtly even more effective at close-range.

[@Alex_Vir]

​@@lambchaikies In which ways is the subata not well designed? Just out of curiousity, I have no clue.

[@TheBodyEuphoric]

you have the same vibe as ahoy and im living for it

[@thewoodpeckers655]

Everybody gangsta till Arch posts. Then everybody’s even more gangsta.

[@doughboywhine]

I think part of the reason the Mossberg is so iconic also stems from the fact that most pump actions are fairly similar, and have not changed much since being designed over a century ago

[@jpeg7352]

An educational "Tbag", subscribed!❤

[@alloyark3971]

there's nothing more satisfying than playing an re game and getting a shotgun for the first time, the raw power in your hand as an infencted you'd usually flee from approaches gets its head turned into mist is almost an equivalent to playing vergil for the first time in dmc 5 (to me atleast)

[@eddebrock]

Very often the main culprit is the maps. Because for some reason level designers like to use what I call "cunt-design". It's where they design maps to not have good angles or long LOS. Which is basically the how-to for making shotgun maps. The other problem is that as soon as you go indoors, you're in the shotgun's house!

[@ububububububububub1667]

that's true

[@kaden-sd6vb]

The other main issue is the majority of fps games being what I call "instakill shooters" where time-to-kill is unbelievably low(well under half a second), no matter the gun. This understandably makes balancing strange, if not impossible. I do not like instakill shooters.

[@amistrophy]

​@@kaden-sd6vb it can be made more balamced by changing the recoil, ergonomics, and control characteristics of the guns. Which are soft damage modification features. Good game for this would be deadline on roblox, but it's a milsim like insurgency/tarkov blend. Very innovative gunplay though. Best I've ever had.

[@TacticalBaguette]

@@kaden-sd6vb Insurgency does a good job at balancing this by having maps that have a good mix of engagement ranges. All of the guns may be able to kill in under 3 shots, but even with more realistic range capabilities, an SMG can't reach out far enough to take care of something a sniper can, unlike for example COD where everything is balanced around the small map size. Insurgency also has a point system for loadouts, so choosing a capable gun and kitting it out can cost you armor, carrying capacity, grenades and other useful equipment.

[@proctor4537]

​@kaden-sd6vb Back in my day, we called that insta-gib.

[@HerMajestyVelvet]

I really want to see a mode in a fps where one player is a juggernaut with a shotgun and sniper going against 10 or so other players armed with weak pistols and items like poison gas, kinda like dead by daylight but the goal is to kill the big guy instead of avoiding him

[@tonyth9240]

I'm pretty sure that mode exists in some games, with a juggernaut, though he usually has a minigun, and the players AR's.

[@SL4PSH0CK]

@@tonyth9240 yea, bet someone along the way of custom maps made one

[@octakhan4673]

The fat-kid gametype.

[@Fr3nchToast.]

If i ever start making a shooter. I am going to follow these videos. Thank you lots

[@blitz7488]

I always think of a ww2 trench gun, the backboard blaster type. I love the traditional boomstick that spits a wall of bullets to really reaffirm your personal space.

[@AeroQC]

15:40 Fixed pellet pattern is specifically why I loved the Blockhead shotgun in Borderlands 2, would be cool if some games opted in to this mechanic more often.

[@kindabober]

Well, Apex is still there, all the shotgun patterns are fixed to some extent (except Mosambique without ADSing)

[@screamingcactus1753]

Most popular community servers in Team Fortress 2 use fixed weapon spread, and even if you're not playing on those, the panic attack, a shotgun alt that any class that has the stock shotgun can use, also has a fixed firing pattern

[@TheReZisTLust]

*laughs while catchin a ride on The Wave of flesh and blood*

[@SusSpooder]

Most shotguns (if not all) do this in Mass Effect to great effect.

[@7tales311]

@@screamingcactus1753 yeah, it seriously makes shotguns have a different but surprisingly nicer feel. Sure you dont get random lucky meatshots, but when you get used to a fixed pattern shotgun it feels fair.

[@swaws1577]

You should have gone over Tarkov's implementation of shotguns and their ammunition, they did a very good job at accurately representing them.

[@SpaceMissile]

tarkov is king.

[@nanksm4583]

This!

[@CaptainRasco]

yup, and it makes it so that only the best rounds (and flechettes IRL are dogshit) can actually kill a player when you're aiming for armored vitals, because buckshot plinks off of armored plates. well done, makes shotguns actually fun to use when you kneecap people

[@swaws1577]

@@CaptainRasco very true! the only inaccuracy as of now is that buckshot fires in a spread and if someone is wearing armor plates and gets unlucky a pellet could still miss a plate and do a lot of damage, wheres in game armor that covers an area covers all of fhat area, not just where the armor is on the body. Once they add true armor hitboxes (which is soon) i think it will be one of the best implementations of shotguns in any game, if it isn't already.

[@bodyrumuae2914]

Thing about having the bullet path "in a straight line to exactly where you're aiming at," it takes out all the realism. No firing arch, no deviances for a number of reasons, including with a lot of games not taking into account sight picture, though the games where you do use sights, scopes, or other reticles do seem to assume the character is grouped and zeroed with every firearm they use and will always bring, even one they never used before, right to the position where they grouped and zeroed it at. With some exceptions like GTA where you have to use at least the same type for a while to improve your aiming, etc.

[@geraldplayz6388]

i clicked on this not being sure if it was gonna talk about real life or video games, and im so happy it was video games

[@AdamSchadow]

This is certainly one of the best videos about shotguns in games. I would say you got the shotgun categories a bit wrong. There are actually only 3 options: 1. Double barrel so two shots quickly in a row with long reload either needs one or two shots to kill. 2. Pump action this one has plenty ammo but fires so slowly that it needs to oneshot unless your game has some absurd time to kills or is ok with the animations being comically fast. 3. Auto it does not matter if its semi or full in most cases since shotguns dont fire fast enough and also dont require pin point precision where it being semi would be a significant downside. These again either two shot and fire fast or oneshot but at much lower ranges than the pumps to be balanced. To reduce the randomness you dont need to force a fixed pattern you just need to make the shotgun fire enough pellets since the more pellets it fires the more balanced out the spread will be. The peaking strategy is only really a problem if you kill each other slowly or you move incredibly quickly so you can just bring that down or even simpler just make the normal peeking slow but make it so that if you run and jump around a corner you peek much faster but wont be able to go back very quickly. (ofc this is all relative to the time to kill of guns) Headshot damage on shotguns is not the best thing because it increases the randomness and makes them disproportionally weaker at range where you cant force the pellets to go towards the head.

[@ElNeroDiablo]

I mean, look at DOOM II's Super Shotgun from back in 1994 - double barrel, more powerful than the Regular Shotgun, but fires both barrels each time and has a reload animation for cooldown after firing. It'll make mincemeat out of most mobs you come across short of the Boss Fight mobs, but also makes you keep in mind your ammo count to decide if you should use it on a room full of trash mobs or save your Shells for use in a boss fight. If you wanted to spit out a lot of firepower to clear a room, you had the Chaingun and Plasma Rifle as fast-firing alternatives to spray-n-pray with.