The Problem with Nuclear Fusion

Take the Real Engineering X Brilliant Course and get 20% off your an annual subscription: brilliant.org/realengineering
Watch this video ad free on Nebula: nebula.tv/videos/realengineer...
Links to everything I do:
beacons.ai/brianmcmanus
Get your Real Engineering shirts at: standard.tv/collections/real-...
Credits:
Writer/Narrator: Brian McManus
Editor: Dylan Hennessy
Animator: Mike Ridolfi
Animator: Eli Prenten
Sound: Graham Haerther
Thumbnail: Simon Buckmaster
References:
[1] aip.scitation.org/doi/10.1016....
[2]
hyperphysics.phy-astr.gsu.edu/...
[3] hyperphysics.phy-astr.gsu.edu/...
[4] world-nuclear.org/information....
[5] www.osti.gov/servlets/purl/68...
[6] www.iter.org/sci/FusionFuels#...
[7] link.springer.com/article/10....
[8] www.iter.org/sci/MakingitWork....
[9] www.sciencedirect.com/science...
Select imagery/video supplied by Getty Images
Thank you to AP Archive for access to their archival footage.
Music by Epidemic Sound: epidemicsound.com/creator
Thank you to my patreon supporters: Adam Flohr, Henning Basma, Hank Green, William Leu, Tristan Edwards, Ian Dundore, John & Becki Johnston. Nevin Spoljaric, Jason Clark, Thomas Barth, Johnny MacDonald, Stephen Foland, Alfred Holzheu, Abdulrahman Abdulaziz Binghaith, Brent Higgins, Dexter Appleberry, Alex Pavek, Marko Hirsch, Mikkel Johansen, Hibiyi Mori. Viktor Józsa, Ron Hochsprung

[@radomiljean-francois4256]

Humans are in a forever quest to find the most efficient way to boil water that spins something

[@stdesy]

If we ever figure out He3 + He3 fusion we won’t have to bother with that water boiling. All the products are charged so their energy can be extracted directly with a magnetic field

[@davisdf3064]

@@stdesy Yeah, but giant nuclear powered water boilers are cool

[@jameswu7850]

@@stdesy Won't be so easy tho (unless someone else has researched it). Plasma instability has been a major road block in fusion researches and I can only imagine that an inductive coil on the plasma only makes it worse.

[@thiccccc_chicke4869]

When you upgrade the steam engine to a higher level

[@simoncangguajila7743]

@@stdesy Helion's reverse configuration torus likes to have a word with you

[@ramuk1933]

"Technology is [almost] always overestimated in the short term, and underestimated in the long."

[@InnuendoXP]

I think warp drive in 200 years is a tad overambitious

[@t.g.2777]

Who is this a quote by or you come up with it?

[@bunsenn5064]

@@InnuendoXP We went from the Turing machine to a supercomputer the size of a suitcase in under a century, technology is developing faster and faster.

[@kingsman3087]

I remember my uncle said he had conversations with ET aliens, and he said that humans have been making so many mistakes with their pursuit of fusion like there's so many other ways different from a steam turbine to extract energy from fusion,etc, we need to change our perception of fusions and methods around it

[@piuthemagicman]

@@bunsenn5064 this is mostly due to microprocessor tech advancement making it possible. now we have reached the limits with our couple of nanometers big chips, waiting for quantum computing to kick off.

[@The_fusion_physics_guy]

As a fusion researcher, titles like this are pretty frustrating since we have very little control over the public image of fusion, and impressions that don't click on the video get a negative impression. However, this video itself is pretty solid, i'm halfway through and it's been all good and accurate points. The key is we need a societal push to produce effective fusion, ideally similar to space-race level support. otherwise it will continue to take a long time. People like to say it's always been 20 years away, but fail to mention that that's primarily because the funding for fusion research has been slashed over and over again ever since we stopped competing with the soviet union over it as a technology. If you don't fund something, it stops moving as quickly.

[@The_fusion_physics_guy]

Hm, okay, follow up, didn't realize you were with Helion, just so everyone knows Helion is a private "fusion" company who makes their money by selling technology and components to public fusion research, while on the side developing a very unresearched method of fusion. They use a "Field Reversed Configuration" confinement technique, and their understanding of it is about 40+ years behind modern tokomaks, since they just recently announced they've mostly figured out neoclassical confiment. The arguments about Berrillium blankets in this video are kind of niche and very manageable.... you can just purify berrillium.... I think it gets caught up in the weeds at the end (these are not the main problems with fusion) because private fusion makes their investment money off of calling mainstream fusion research misguided and their approach a miracle. Other than the last few minutes, great vid.

[@cod6guy12]

@@The_fusion_physics_guy I don't see how modern tokomaks like ITER are ever going to be economical but then again I'm not the physics guy

[@NPCSpotter]

The laws of physics don’t care about how much “support” you put behind something it’s says isn’t going to work. Just like with the space race. Humans will never colonize Mars or leave the solar system

[@88Superphysics88]

If you want to make a working commercial fusion reactor in two years, and get commercial heat, I can help you. I have made a great world-class scientific discovery about nuclear fusion in the atmosphere of the Sun. The assumption by scientists all over the world about nuclear fusion in the core of the Sun is well known. This is a fallacy. For over 72 years, scientists have not been able to make a working commercial thermonuclear reactor, and will not be able to make one for many years to come. The reason? The misconception of nuclear fusion in the Sun. Nuclear fusion in the Sun's atmosphere begins under the physical conditions existing there at an initial plasma temperature of 5,000 K; by the end of the fusion reaction, the solar plasma temperature reaches 1,500,000 K, on average. Sunspot temperatures on the Sun from 3,000 K, sunspots can be up to 100,000 miles in size. Doesn't this prove that nuclear fusion occurs on the surface of the Sun, not in the core of the Sun? If we take a good look at and study sunspots, it is clear that nuclear fusion takes place in the Sun's atmosphere. I know how to replicate the physical conditions for nuclear fusion in the Sun's atmosphere. I propose a reactor design with the same physical parameters for nuclear fusion and excess heat as in the Sun's atmosphere. kzbin.info/www/bejne/fJTcoaqli7R0d7s To make a small working prototype confirming the principle of nuclear fusion in the Sun's atmosphere and obtain commercial heat needs about 10 million euros, manufacturing time 2 years. It could be less. Depends on the country where the prototype will be made.

[@evrythingis1]

Thats the whole point, disinformation to keep public opinion against Nuclear power until Oligarchy owned oil companies can guarantee themselves a monopoly over the inevitable transition.

[@kek207]

Advanced fission reactors are also incredible. Breeder Reactors that produce their own fuel are also possible. You essentially use something that doesn't slow down neutrons as much as water and add thick Uranium cladding to inner walls of the reactor. Preferably that uranium is deluded in a liquid so it can be refined easily. One of the issues is that we use about 1% of the available uranium and the rest is waste. But with a working Breeder reactor you could have so much more efficient designs that don't need a refuel in decades

[@jacksimpson-rogers1069]

Right! The USA had breeder reactors in the 1960s and the Nixon for a President. Another kind in the 1980s, which Clinton murdered in 1984. Both, in US labs, were meltdown-immune technologies and producing actual power before the infamous but exaggerated Chernobyl meltdown, that were capable of breeding their own fuel and did NOT create "long lived waste", most of which is wasted by edict of decent, genuinely Christian, but stupid, Jimmy Carter. ORNL, under Alvin Weinberg, who invented the PWR (Pressurized Water Reactor) that powers our Capital ships, the aircraft carriers and submarines, proved that the slight shortcomings (slight compared with any other technology, including oxen, peasants, donkeys, and even slaves and elephants) of his liquid water designs could be alleviated by using molten salt solvent instead of water for the energy carrier, and carbon instead of hydrogen atoms as the neutron moderator. Dear KEK, I quite like the idea of deluded uranium, but you probably meant diluted or better, dissolved. The MSR used alkali fluoride as the solvent, which in the pure LFTR (Liquid Fluoride Thorium Reactor) breeds Uranium 233 from Th-232 by letting the thorium capture a neutron, and decay to Protactinium 233 then U-233. The nice thing about U-233 is that thermal neutrons fission nearly all of it. But for bomb-making, that process is a bit slow. The ordinary civilian reactor produces neptunium 239 when uranium 238 captures a neutron, then the Np-233 captures another and becomes Pu-239. unfortunately, in a way, the three year exposure of the fuel rods only consumes a bit more than half of that plutonium, because some thermal neutrons get captured and kept. Pu-240 fissions spontaneously, which is a Good Thing if you don't want bombs. To breed bomb grade plutonium, which the Manhattan Project did in 1945, you can use very pure graphite and raw natural uranium, but you need to remove the fuel rods from the reactor"pile" in 90 days, and extract the plutonium, or too much of it will give you too soon an explosion.

[@isocarboxazid]

I love deluded uranium. It calls itself plutonium!!!

[@The_fusion_physics_guy]

I'm also a huge fan of fission reactors, a lot of the modern designs are fantastic and very safe.

[@michaeldavidfigures9842]

One Anagram: LFTR.

[@tysenp8193]

Damn, this is really impressive timing. This video clearly took a long time to make, and you managed to release it right on the heels of the major fusion announcement. Props man.

[@mattpopovich]

Is it luck though? Cleo Abram also released a fusion video today... Not sure how they knew this announcement was coming! kzbin.info/www/bejne/rqTMnKqOo7qWeNU

[@thephilosopher7173]

Its apart of the documentary he mentioned so I imagine this was easier than that lol.

[@NazriB]

Lies again? MLS NFL Ramenten Rakuten

[@drunkpaulocosta9301]

@@mattpopovich well if you know how alot of media releases rhese days work this wouldnt suprise you at all. Plenty of people in the wings and who know people working on it ect, unless something is classified entirely. Then often content creators will be fed information to ensure they are controlling the narrative ect. For example if you have 5 YT journalists saying the same thing before the news does. Its alot harder for some anchor with no clue to change the narrative. So yeah its common for things to be fed to specific channels with an already cultivated and respected community. This is 100 times more effective in todays world than giving the ibfo to the news first. When i want to know something i check reddit or youtube. I dont check news sources and other places for new news. This is alot of people. You have to use the same brain as reading a newspaper and be skeptical and ask questions. But for live up to date info. Social media has the most instant pull in permiating information to the masses

[@CosmicBackgroundRadiation01]

Suspiciously so. I had to go check the dates because what are the odds.

[@TasX]

Great video. I’ve worked on magnetic confinement nuclear fusion at a National lab. One of the big problems is that everything is a massive partial derivative. Let’s say you have a hundred million particles inside the reactor. Each one has 7 dimensions of conserved motion. So traditionally to simulate it, you need either an extremely watered down equation that can make dozens of simplifying assumptions or a supercomputer that can take days to do a short simulation. Each particle can massively change their trajectory in just 10 microseconds, meaning if you want a perfect simulation for like 5 minutes, you need to run (100,000,000 * 5 * 60 * 10^5)^7 calculations which is probably some number bigger than the amount of atoms on earth. The good thing is that machine learning and GPUs are perfect for this kind of problem. So it’s gradually becoming the backbone of confinement modeling so the particles won’t fly out unexpectedly or the machine suddenly crash. In fact confinements not much of an issue anymore I’d say. Like I was able to take a 42 hour long simulation, rewrite it in CUDA, and have it run the same thing in less than 20 minutes. And on the experimental side, people have been able to run their devices for almost 10 minutes now which is extremely stable. And on top of all that, MIT recently made a high termperature superconductor that can generate massive magnetic fields so the machines can be scaled down to like 1/10th the size and still produce more power than ITER. While it’s still experimental, it’s basically in its last stages. The only things to worry about now is elmo. The next stage will be finding the right materials to make the walls out of that will preserve the reaction and dissipate the energy over long runs. Tungsten has been generally used as the newer material but there’s still room for massive improvement. People have been experimenting with depositing an atom layer thick lithium gas on tungsten or using Liquid Metal walls that act kind of like a waterfall + cpu cooler inside the tokamak. The tritium breeding issue is still on the horizon. Theoretically it shouldn’t be too hard to carry out. Just get a slab of lithium metal and put it right behind the tokamak or whatever device. But that’s a issue for another day. Edit: also don’t forget that’s only tokamak fusion. There’s also like 20 other types of fusion techniques, some of which are very promising. ICF (kind of a budget laser-powered nuclear bomb) is experimentally like 70% (now >100%!) of the way to net energy. This is a massive jump considering how it was 5% just 3 years ago. Other ones are field reverse configuration with folding plasma whirlpools in the z direction, magnetic mirrors, z pinch (like a nuclear lightning bolt), and whatever that doesn’t need tritium and won’t produce neutrons so that the energy can be directly harvested with a magnet. Edit: from Joesph Li I do research currently at a fusion research institute. Some things worth noting: You're right that lots of folks are looking to ML and big data but traditional MHD and kinetic simulations are still the mainstay. Whole volume gyrokinetic simulation is widely used and actively researched to better understand transport as a whole. Neutral and wall interactions, and especially precise treatment of edge regions is mostly done via traditional methods rather than ML. Next on fusion techniques. You're correct that there are many different methods for containing a plasma, but the region the device landscape looks as it does today is because magnetic mirrors, Z-pinch, and other open designs have serious inherent confinement issues. As for ICF, the NIF actually reported a break even last summer on fusion gain in 2021 (not sure if published yet). One major issue the NIF faces is that ICF fusion requires several laser shots per second to be economical, but as of now I believe the rate of discharge is closer to once every several hours. Lastly, I want to comment on smaller devices and different fusion fuels. MITs technology definitely holds a lot of promise, but one should temper expectations on output in smaller devices. Neutrons don't interact strongly and slips through solid material given enough energy (like those resulting for D-T reactions), so any D-T fuelled device necessitates fairly thick blankets and walls to efficiently extract energy. Moreover, one must still shield the outside of the vacuum vessel from neutron irradiation lest we risk the creating of radioisotopes outside the device from neutron bombardment. The obvious solution of using different fuel isn't so simple when one considers the much greater activation energy of those reactions. We can't even break even on D-T, never mind considering continuous operation on D-D or D-He3. Progress is certainly being made but science takes time. And fusion is too expensive to get wrong. It's best to not get too hasty with our expectations. Edit edit: just now, NIF achieved laser Q > 1 which is amazing for science. But it’s still a ways away from economic Q > 1 (where you can actually use it to produce power). But definitely a milestone and not number fudging anymore.

[@venomous_zxs5493]

what did u study, how can i walk on the same path as you?

[@TasX]

@@venomous_zxs5493studied physics. Most people in this field do physics, math, material science, aerospace engineering, nuclear engineering, or electrical engineering. And the big 7 ITER countries should all have really good fusion programs that you can intern at. So US, China, India, Russia, France/UK/Germany, South Korea, and Japan. When you look for these programs, look for the word “plasma” instead of “fusion” research. I’m not sure why but it took me too long to figure that out.

[@gladlawson61]

Please please comment more.. excellent post.

[@venomous_zxs5493]

@@TasX thx

[@alphabetamathematical5016]

By fusion of gravitational and manetic forces like hydrogen atoms can assess the process. We need to engineer three concentric confinement bottles to develope the atmoshere for the fusion in space

[@amackclassic6737]

The fact that we can all learn about this stuff whenever we like is absolutely incredible. Thank you so much for sharing this content with the world!

[@Z3R0US]

@@oneaboveall1895 /rwooosh

[@Z3R0US]

@@oneaboveall1895 obvi that’s what he meant lmfao 😂

[@smilemore1997]

​@@oneaboveall1895 you act like every country has easy access to the internet let alone KZbin.

[@ulmasbekrakhmatullaev8808]

@@oneaboveall1895 Is it? I thought it’s a cable TV

[@dogwalk3]

for real. i learned more in this video than i have in entire semesters.

[@cina9218]

Of note: (And this is a common error in media) when you mention cooling of MRI machines, the clip is of a CT machine. This is likely a common error because CT machines are safe to film when not actively scanning, while MRI magnets are always active even when not in use.

[@Muonium1]

Hi, I've been an engineer on one of the largest laser driven nuclear devices for a couple decades now and while I disagree that actinide contamination of a beryllium multiplier will be a major issue for future machines (several common chemical purification techniques could refine the Be such that it is a nonissue), I liked the video overall and thought it was a good layman's overview to the present state of MFE research problems. I can also offer your viewers a bit of "inside" rumor-mill information on fusion that I don't see being reported anywhere in the press yet that they may be interested in. Perhaps you heard of the record yield shot on the NIF laser in summer of last year that produced 1.3 megajoules of energy for an input of 1.9MJ laser light and that this was 25 times the previous highest record shot taken just a couple years earlier. Well they've been trying to recreate that magic shot for over a year and a half now without success....until 2 weeks ago. The rumor is a shot in the last week of November exceeded 2.5 megajoules in yield. The scientists are in the process of crossing their t's and dotting their i's before going to publication in the coming days and issuing a press release to make sure the result is real, but it's likely to be confirmed and is beyond any shadow of a doubt an unambiguous achievement of thermonuclear ignition and breakeven in the laboratory. This is a MAJOR breakthrough (and that's coming from someone who loathes the overuse of that word) that countless scientists and engineers have devoted their entire careers to attaining without seeing it happen over the last half-century, and now it is done. NIF is of course not a power reactor, just an experiment, and so this is the achievement of scientific breakeven rather than engineering breakeven. But keep in mind there is on the order of roughly 100 times more fuel in one of these capsules yet to be burned, and the laser driver can be increased from its current 1% efficiency to >40% efficient with the use of diode laser pumps and a crystalline lasing material. Even in the very unlikely event the fusion yield of these implosions isn't increased further, this is still a tremendous milestone that brings an entirely new ultra-bright neutron source "tool" for research into the laboratory. EDIT: looks like the cat's out of the bag much earlier than I thought it would be - article is up on the Financial Times titled "Fusion energy breakthrough by US scientists boosts clean power hopes"

[@_acwangpython]

Please post a link to a reputable site summarizing some details and the publication itself when it's published!

[@BlueZirnitra]

Boss I'm trying to park at NIF so I can go clean the toilets but you're in my parking space shilling on KZbin again. Don't you have some bolts to tighten?

[@Muonium1]

@@_acwangpython will do, but it's a major milestone. I expect it'll be everywhere in mainstream media when the announcement is made. EDIT: Ok everybody, looks like the cat's out of the bag even earlier than I expected, there is an article with some details in the Financial Times titled "Fusion energy breakthrough by US scientists boosts clean power hopes" (I can't link to it lest youtube's artificial stupidity algorithm autodelete this comment). Looks like the 2.5MJ yield was sufficiently and unexpectedly high enough that it damaged some diagnostics on the machine complicating yield quantification. The official announcement is coming from the DOE on Tuesday.

[@smdutton]

Very much looking forward to this news being published to the masses!

[@penguinswithdynamite]

This is very exciting if its true, I wonder if its using their new magnetisation technique with DT fuel. However to make a viable ICF power plant they still have the big problem of how to produce ~800,000 targets a day of exceptonal quality, which is something the other fusion approaches don't have to deal with. This is a problem almost as challenging as getting to net fusion gain.

[@Nick-bh5bk]

Given the last 24 hours, I'd love to hear an update on opinions of where this is all going.

[@autohmae]

I read The Atlantic article and it's basically saying: great achievement, which shows it's possible, but has no real world solutions yet: "Two megajoules is about the amount of energy released by burning a small chunk of kindling, so thousands upon thousands of such shots a day would be required before the energy production became in any way usable. Unfortunately, NIF’s lasers use huge slabs of glass that take hours to cool down between shots" So or: we would need to be able to do it faster or with much higher yields. I suspect the last of those two will improve the most.

[@marvelaturraz5405]

There is deep deception behind this. But just as doctors and nurses and bankers, etc. may be authentically doing what they believe is right, Admin often is operating under a hidden agenda. Investigate the fusion research being done by David LaPoint.

[@meltdown6165]

@@autohmae And they need 400 megajoules of grid power to pump the lasers for the shot. Huge conversion losses until the energy finally reaches the Hohlraum with the fuel in it.

[@agranero6]

The news are misleading: National Ignition Facility uses inertial confinement: this will never, ever , ever create a working practical fusion device. The proof is that nobody else researches inertial confinement. NIF was not even created for that it was created mainly to get a way to research nuclear devices without doing the banned tests. Now it is trying to reinvent itself. The stellarators and tokamaks is the real future (meaning: magnetic confinement). Inertial confinement is as useful as muon catalyzed fusion (meaning it is useless). But news ALWAYS misunderstands science and must put all in terms of grandiose words, major breakthrougs and clickbaits. And yes I am a physicist. Lets remember when news insisted in calling the Higgs boson "the God particle" (a name coined by an opportunistic editor), when it said ISON would be the brightest comet ever, when press made all that fuss for faster than light neutrinos (that never existed), more recently headlines saying dark matter does not exist (a gross overstatement), and that brain uses quantum mechanisms just to cite the newest ones.

[@zapzapzarap6148]

It’s still a really really long way. I’m hopeful that I will still see a fusion reactor in my lifetime tho.

[@SpottedHares]

The thing is that unlike some other technologies were their was something missing we didn't know that made a massive leap forward, theirs doesn't appear to be anything as of yet like that with Fusion. We just have to do the hard work and make out plasma hotter and more stable till its hot enough and stable enough for it to be cost effective.

[@alvaroorteganadal6359]

Amazing video. Easy to understand for People not close to the topic and slightly detailed with some technical info. Congrats !!

[@PNurmi]

Breeder blankets: being a nuclear engineer who has researched tritium breeder blankets, one material being considered is F-Be-Li molten salts. It gives you a combination of features: as a heat transfer fluid, Be for neutron multiplication, and the lithium to generate tritium. It would also maximize tritium generation if enriched to nearly 100 percent as Li-6. Looking forward to your documentary on Helion since I have been reading up on them.

[@mikemurphy5898]

I have a Fl-Be-Li blanket on my bed right now... it's pretty good👍

[@davidhimmelsbach557]

It'll NEVER work. 'Hot' Fluorine destroys ALL containments. It's the universal solvent. The US and USSR spent billions on just this issue. After 25-years, Congress cut off funding. Only then the boys with the iron rice bowl admitted that they'd reached a dead end -- in 1960. (!) That's twenty-years of just screwing around.... In sum, it'll NEVER work. It's a materials problem.

[@John-sp7ne]

What happens if uranium or another fissile material used in fission reactors is used to line the walls of a fusion reactor to add heat from fission to the steam generator. Would that be a way to "turn on or off" fission? Adding a layer of safety to fission reactors and added efficiency of direct electric induction of fusion reactors? Also would this allow longer use of u235 and it's byproducts?

[@gigabyte2248]

Quick question: 'Fl' - *flerovium?!* Is that a typo?

[@PNurmi]

@@gigabyte2248 Yes, it's Fluorine. I'll fix that.

[@prateekkarn9277]

Wendover and real engineering fighting each other like siblings always makes me chuckle

[@RagaarAshnod]

Shots fired.

[@LuisSierra42]

Top 10 anime rivalries

[@rosskrt]

lmao fr

[@HypnosisBear]

Bruh

[@dustinsearle4672]

Real engineering vs guy who reads Wikipedia to you

[@KaiserThanatos]

I’d like a citation on how fission reactors are uneconomical. I googled it and yeah they’re expensive to start up but they make a lot of power for a long time after startup. Most of the reason for shutting them down recently is fear mongering and concern trolling about nuclear accidents.

[@randomguy2108]

Just had a nuclear module and this video basically covered the first introduction lesson, thanks for the quick and easy explanation.

[@Ikbeneengeit]

In spite of there being 100s of fusion videos on KZbin, you find the perfect balance between highly engaging presentation with juicy technical details and engineering considerations, like Tritium breeding and annual consumption. Well done, Real Engineering.

[@thebarkingmouse]

I wrote a paper about this in 6th grade, roughly 40 years ago. 40 years ago they said it would happen within 10 years. For years it was always 10 years away, now they're telling us is 20 years away. Face reality. This may eventually happen. But we're nowhere near it. We need to be using technology that we actually have and can use Liquid fluoride thorium reactors are technology which is available today and can free us from fossil fuels. People need to stop throwing out the baby with the bathwater. No lftrs are not perfect. They're a hell of a lot better than anything else out there. And fusion isn't there. It's not practical. We can make it happen but we can't extract more energy out than we put into it yet. And even when we can extract out more energy than we put into it is it going to be enough more to make it worthwhile. How quickly are we going to burn through our stocks of available hydrogen. Lftrs or technology which are available today... Build them now, and continue researching fusion. Maybe someday Fusion will even become practical. In the meantime we can have energy that is free of fossil fuels. For the next 10,000 years or so until we can figure out the next step

[@thebarkingmouse]

@@justiceifeme in the meantime could we please build some lftrs? I've been waiting on Fusion for 40 years now. I honestly don't have any confidence that we're going to actually ever make it practical at this point. But we could end our dependence on fossil fuels inside of 5 to 10 years if we just started building lftrs

[@paulmobleyscience]

@@justiceifeme Tritium is the Achilles heal of it all along with Tellurium embrittlement or segregation of the Hasteloy-N. Molten Fluoride Salts have never been the answer and we've known this for many decades. Tritium....when taken up in plantlife forms Organically Bound Tritium that does not have the same biological Half-life of just tritium at 12-30 days and us exactly why newer research has found it causes "DNA strand breaks, micronucleus formations, cell necrosis or apoptosis, chromosomal aberrations and various other phenomena thus negatively affecting human health". Using Tritium/Deuterium in fusion can only come from one place here on the surface of our plant as naturally occuring Tritium is extremely rare on Earth and only found in trace amounts in the atmosphere...fission reactors. Fission reactors release on average 10s of thousands of TBq per site per year. That's a huge issue

[@Boomkokogamez]

@@thebarkingmouse Sadly Fusion reactors biggest problem as stated in the video is making more energy then how much you need to start it.

[@BlueZirnitra]

"You are my favourite. How do you manage to be my favourite? Wllele dnonene Rlealelal Engniginrneering!?£¥"

[@adamh1228]

I ran a copper alloy foundry for a while, and several of my customers made me sign agreements that said that the facility did not work with ANY beryllium alloys (they are common in electrical contact gear made of copper alloys). I always thought it was because Be is insanely toxic, but in hind sight, there may have been radiological considerations after watching this episode. All of the customers asking for those "no Be" contracting were defense contractors, and it would make sense that they were sensitive to background radiation in their bearing components.

[@edwelndiobel1567]

Hmm. What do you think about stuff and things?

[@kylemccormack1785]

@@edwelndiobel1567 what a mindless response.

[@abrammedrano4392]

@@kylemccormack1785 burns compressed farts...that'll work

[@TVAProject]

@@kylemccormack1785 I feel like he is a joke bot made by a troll just to make the bot comment something that is really nonsensical.

[@bunsenn5064]

What I’ve wondered is how Beryllium, the fourth lightest element on the periodic table, could be radioactive.

[@tadvanacanakapalli6461]

I'm not entirely sure, but my understanding is that He3 (for the most part) does not fuse with another H1 atom to become He4 (it does on occasion, but it's a miniscule amount of the He4 atoms that are produced during fusion in a star). The main branch of the proton proton chain which produces He4 is when 2 He3 atoms fuse together into He4, releasing two H1 atoms.

[@Veptis]

Years ago I have seen the TEXTOR research reactor. And they were testing materials in the plasma flux. And the story we were told by researchers was that they do a few experiments per week, and all of them destroy the samples. It took them several years to find Tungsten to use for the walls in ITER

[@erikgranqvist3680]

The good thing with fusion always being 20 years away, is that one day you can honestly say it's 20 years early.

[@jessedaly7847]

Apparently we’re there. But the Livermore apparatus may take quite some time to get to commercial production.

[@TG-bq1kn]

@@jessedaly7847 don’t count on it. They didn’t add up the energy needed to fire up the lasers so they are still in the negative. A new way is needed.

[@Furiends]

@@jessedaly7847 "Apparently we’re there" not really. We've successfully proved that we can achieve on earth whats been happening on the sun for millennia. It proves that we're going in the right direction but not how close we are to getting there.

[@jessedaly7847]

@@TG-bq1kn why do I keep reading that they put 2mw in and got 3.5mw out? If that 2mw wasn’t used to power the lasers then what the hell was it used for?

[@TG-bq1kn]

@@jessedaly7847 they didn’t factor in the losses to get it fired up. They just considered the energy delivered to the pellet.

[@drone51]

My dad works at LLNL and has worked with top scientists at NIF. He’s the one who brought many of them into the lab by hiring them as his post-docs. These are the smartest people in the world. I knew we could do it from day one. Just didn’t know it would be this soon. It’s been a proud day for my family.

[@rockman1942]

just don't let the Asian steal the tech

[@mcmystix]

@@rockman1942 you won't have a number for your IQ without Asians (Aryabhata to be specific)

[@rockman1942]

@@mcmystix I am Asian, and I m sure they are just too smart to put this technology into wrong place to not benefit the mankind

[@jeremias-serus]

@@mcmystix Conflating all Asian cultures as one is extremely problematic and low key racist. Indian culture is not Asian culture in anything other than a name that was invented 3000 years ago. Do better.

[@pierreviguie]

My grand dad win the ww2.

[@thesuncollective1475]

Thank you , your the first one I read who explained it properly

[@csdn4483]

6:24 - Incorrect, the byproduct of the D + T fusion reaction leads to a neutron along with the He nucleus. The neutron is very much a danger radiation hazard. The neutron will be captured by the fusion reactor components and activate those components causing them to become radioactive. The other aspect is also the fact that we actually want that neutron to effectively create more Tritium as well with a Li blanket as part of the reactor structure as Tritium has a ~12 year half life (so it has to be produced).

[@trinitrojack]

I want to say a big thank you for highlighting the challenges engineers face in making research breakthroughs a viable solution. I work with research, and they come up with interesting prototypes, but a lot of them won't make it any further due to fundamental problems (be it economic or resource limitations). I don't think many people understand that research this is just a first step in developing a successful product.

[@tubularguynine]

I was thinking of a gravity-powered generator that you might like to research: Build twin towers with twin, water-filled weights on cables, turning a generator. One filled more, heavier, than the other, and when the heavier one gets to the ground, pump the water from it to the other one, and it comes down, pulling the other, now-lighter weight up, and continuing to turn the generator. The only energy needed is to pump the water back and forth. If you make a billion bucks, contact me, and I'll send you my PayPal number - 80% for you.😀👍🏻

[@derpderpy3075]

Then why didn't you hear the news they achieved fusion with lazers

[@mohlalefihadebe9192]

Rest in peace to the gentleman who single handedly built a car that runs on saltwater....he never had much hey.... some food for thought

[@datta1601]

mn

[@donaldkasper8346]

There are no viable solutions or breakthroughs in fusion. Hitting a pellet one time in a special enclosure capsule to get a strong output reaction achieves nothing for production fusion. Spending your life runs joltomatic donuts seems really sad and a waste of talent.

[@paulyiustravelogue]

Maybe, just maybe, that fusion power plate I “built” in the original SimCity in the early 90’s could become a reality before I die… and nice touch on that Wendover Productions bit 😂

[@D370n470r]

Thats completly how everyone alive heard about the existence of Fusion Power.

[@sfsrocketking3787]

@@D370n470r that’s true

[@peterknutsen3070]

There wasn’t a fusion power plant until the sequel game, Sim City 2000.

[@novadeathstar9961]

1989 SimCity didn't have an fusion reactor I'm quite sure

[@paulyiustravelogue]

Thanks for reminding me guys. Now that I think about it, perhaps it was SimCity 2000. Cheers

[@simanta2007]

At this point, there is no debating the fact that this channel produces the absolute best video content on pure unadulterated engineering so I wont comment on that. I just love the fact that Wendover Productions and Real Engineering, my two favourite channels, are buddies and can engage in friendly "leg-pulling" on KZbin with complete understanding. Cheers guys!! I would love nothing more than the two of you co-creating a video or a series of videos together which have aspects of both engineering and business on some of the most pressing issues/problems. Merry Christmas and a happy new year World :) Much Love!!

[@mydogworriesalot1840]

Having a practical working super conductor might be a stepping stone to undertanding fusion there seems to be a lot of "push" to get things done maybe some "di-hedral" to help pull you up as well 🖖

[@Elijah-2000]

In light of breaking news in the US on Nuclear Fusion, I find the TIMING of this video very interesting, because it must have taken time to do all the animation in this video, so clearly you were not influenced by the Breaking News. I don't know what to make of all this, so I remain a skeptic until I'm convinced otherwise.

[@tylerjoseph5695]

I'm also a skeptic about the announcement and what it actually means. I just found out about it literally 5 minutes ago, and before then I felt that it might be unobtainable in my lifetime. With it now supposedly being done, I'm curious to see what comes of it, but I'm not getting my hopes up at all. Would I like it to be true? Absolutely. Would I like it to be utilized in renewable energy? Well obviously. It is the DOE though after all...

[@adamschaeffer4057]

Interesting achievement, and technically does advance the technology. But it doesn't address the age old problem of moving the energy. Making it is one thing, using it and getting it to where it needs to be still requires a lot of energy. In this experiment they still haven't created usable, viable "free energy" because they can't harness it for anything useful. I think in this instance they used 2 terawatts of electricity and got 3 back out. But in order for this to be sustainable and actually power our society it would have to be something like 2 terawatts in and 5-10 terawatts out. Still a long, long way to go.

[@david_4246]

Looks like it's just a bunch of stock footage he edited together. Probably didn't take that long to put the video together.

[@manfredvonkarma4752]

I’ve come to realize all of electricity is based on finding the best way to boil water

[@Poctyk]

Wind and photoelectric solar literally doesn't. Same as tidal.

[@TasX]

@@Poctyk wind is ocean water being heated

[@Rippedyanu1]

@@Poctyk which is also part of why they are terrible at generating energy comparative to other types of energy production.

[@HSuper_Lee]

A slightly more accurate statement would be that all electricity is based on finding the best way to make stuff spin, and it just so happens that boiling water is a good way to make stuff spin.

[@Rippedyanu1]

@@secretname4190 even the most advantageous and well placed solar panel or wind turbine capacity factor and efficiency is lower than hydro, nat gas, coal and especially nuclear fission. They still don't hit the necessary EROI to be sustainable and still require backup power which right now is predominantly fossil fuels. They're better than nothing but considering the cost and resources for manufacturing and the carbon released, that's not saying much.

[@user-pp9yq3qx3x]

So if one force is the center connected to the core, there is a second force that pulls the first one on each end pulling one another around the first force but the negative ground in-between the two is actually the negative requirement.

[@Dr.Schlitz]

As a kid, I did a science fair project on nuclear fusion, and back then nuclear fusion was 20 years in the future. Problem is: this science fair was over 40 years ago.

[@JesterHorse]

I love the jabs all of you educational creators take at each other in your videos. It offers a nice break to laugh during such complicated Videos that contain such vast amounts of information.

[@toadofsteel]

Nebula Cinematic Universe has been fantastic over the years

[@timwatts9371]

@David Brown "nattering nabobs of negativity" Nice alliteration but you're avoiding the fact that problems can only be solved when all the negative considerations are taken into consideration and dealt with. It's a fallacy that "positive thinking" actually solves anything. Careful, coherent thinking that addresses major problems will solves them.

[@deaddocreallydeaddoc5244]

The best solution for the future of energy supply is the construction of Molten Salt Thorium Reactors. Besides providing abundant, cheap electricity, they can provide a myriad of other functions that will completely defuse the Green New Deal. They cannot melt down because the molten salt is the fuel carrier. Thorium is preferred over Uranium because it has 200 times more energy potential and it is literally dirt cheap. Thorium is abundant and has been the "waste" product of rare earth mining in the past. The reaction occurs between 600-800 degrees F. If the molten salt should ever overheat the reaction stops and a freeze plug in the bottom of the fuel jacket melts and the molten salt flows into a holding tank where it cools down naturally. They can be set up to burn the waste from light water uranium reactors because they are so efficient. They can be used for producing non-carbon diesel fuels. They can be used to cheaply desalinate seawater, and scrub carbon from the atmosphere. They are safe and can be built anywhere. They can be made small enough to power a car or big enough to power a city. The U.S. has about t a dozen companies that are either ready or near ready to construct them France is developing them and Denmark has one company developing them. I don't know about Germany, but Germany would clearly benefit from them and could erect them quickly if they desired. They must get over their anti-nuclear sickness, however. There is no time to waste. here is a four-minute introductory video to MSRs. - kzbin.info/www/bejne/oWeliamta9Krqtk

[@HelionEnergy]

This is a great overview of the potential of fusion energy and some of the current challenges, Brian. We're looking forward to welcoming your audience into our facility in next week's video so we can go deeper into our approach to fusion.

[@TasX]

Ooh Helion

[@mucia55]

Looking forward to seeing your methods on the subject as well as the work at your lab and progress you've made this far.

[@SpencerFH]

This is so cool I can’t even stand it.

[@williamyoung9401]

There's a reason we haven't utilized Nuclear Fission. Chernobyl. 3-Mile Island. Government incompetence and Corporate Greed combined to make the worst of both worlds to destroy ours.

[@Bjawu]

Looking forward to it! Would be especially interested in currently identified bottlenecks for scaling up to a global level (from materials to supply chain issues, and plain old economic inertia).

[@thunderbirdizations]

The timing of this video was incredibly impeccable

[@FakenameStevens]

Every time there's a problem, you can always count on him to explain how we can counter it. He would then list the disadvantages of the counter, then a solution to COUNTER the COUNTER to the original COUNTER.

[@jamesbentonticer4706]

Just had a mega milestone in human history! 50% more power harvested than used for the reaction. This is actually a pivotal moment in our species' history.

[@matthewnyberg3151]

Not exactly. 50% more energy out than the laser energy on the capsule. To create the laser took ~100x what they got out. The NIF is a weapons facility, not for energy generation

[@foxwithaplan858]

Well, they send in laser photons of 2MeV and got products with 3MeV thermal energy out. But to produce the laserphotons in their absolutely not optimized laser generators, they needed 200MeV electric power.

[@Bob-nc2zt]

Wouldn't that break the laws of thermodynamics?

[@foxwithaplan858]

​@@Bob-nc2zt The laser generators produce mostly waste heat

[@AnAntidisestablishmentarianist]

After decades of useful fusion power always being "20 years away" I'm shocked how few people bother to question the LLNL announcement.

[@fushumang1716]

US DOE just announced a breakthrough in Fusion. Would love to hear an update of this so-called breakthrough and if they had really solved the fusion problem

[@NiklasLarssonSeglarfan]

They really havent solved the fusion problem at all.. Just proven that it is possible to get more energy out of it (which we kinda knew already since we've had hydrogen bombs for 70 years and, you know, the sun).. Its a cool breakthrough, but they "sustained" the process for a millionth of a second and used 100 times more energy to power the lasers that started the process. Still cool though!

[@zimriel]

In short: it's hype. In long: the Powers That Be want us to keep chasing after fusion so they can distract us from the lack of cheap energy we can get from fission - and from orbital-redirected solar. Meanwhile we get the lockdowns, which they'll impose upon us for The Climate.

[@bvbxiong5791]

@@NiklasLarssonSeglarfan spoken like a salty european. the method used in the US is completely different from the stuff in this video and what the europeans are doing...alot of the stuff in the video doesn't apply. and what does it matter that they used "100x" more energy to power the lasers? (which is a baseless claim anyways) they got 1.5x the energy out...which is the whole point of fusion and what everyone has been trying to achieve.

[@cartanfan-youtube]

@@bvbxiong5791he would probably still find a way to complain if nuclear fusion was handed to him completely and for free ☠️”yea but the reactor is painted a color I don’t like” headass

[@qwertygirl334675]

@@kentw.england2305 Except they literally got net positive energy out of it.

[@rmd9746]

Still is always important as you briefly mentioned that atomic fission is far better then coal, oil and gas since the power that it give us is much more reliable and in the long run more economically efficient (to not talk about safety compared to the others). You should do a whole video about the pros since you're trusted and have quite the following.

[@user-ip3pu4pm3x]

I have worked in ITER for 6 years. Extremely good video.

[@IwanPieterse-iwanzbiz]

You timed this video perfectly 👌 Not being sarcastic, this highlights what a breakthrough today was. Ignition has happened! I know it’s still years before anything resembling a power generating reactor is realized but I feel the forever 20 years away has today become actually 20 years away, maybe even less. Excited!

[@Nauda999]

The saying was fusion reactor is always 30 years in the future.

[@Rkcuddles]

I don’t think it’s going to take 20 years… this is limitless, clean, energy. This is the civilization tipping point. Incredible amounts of money are about to be pumped into this technology. I wouldn’t be surprised if within the decade, we had working power plants

[@Nauda999]

​@@Rkcuddles pumping incredible amounts of money into science doesn't guarantee success, I wouldn't be surprised that the age old saying a fusion reactor is 30 years in the future, even after 30 years would be still true And scaling is no joke, for example an ant can lift 50 times it's own weight, doesn't mean there are any humans that can lift 50 times own bodyweight.

[@maxsim_racing]

the breakthrough tho was announced a day or to before saying: scientists to announce a breakthrough in fusion but never said what exactly, and then this official confirmation happened today/yesterday. i’d guess they were confirming everything before making it public. it’s really HUGE!

[@ThomasJr]

Yes, but the breakthrough doesn't use either of these 2 methods shown in the video

[@TheSateef]

i love you get into the real details, not just simply regurgitate the basic pop science stuff

[@user-zt1xo6kb3p]

UK JET just produced 69 Megajoules of energy. Or in layman terms enough power for 4-5 hot baths after 40 years of R&D ITER originally costing 5B Euros, has been delayed and quadruple in cost. 20B Euros sure feeds a lot of R&D scientific careers for a few more years.

[@paulweber4684]

The tokamak is a dead end for a fusion reactor. In 40+ years the two big questions still remain unanswered... 1. How do we get heat (energy) out in a usable manner? 2. How do we get waste products out, additional fuel in, all while keeping fusion ongoing? The tokamak being a sealed system can never solve question number 2. What is needed is a new process.

[@terramater]

Breaking news just one day after your upload: For the first time, scientists were able to generate more energy than they invested in the process. The researchers used 2.1 megajoules of energy, with the help of laser beams, to initiate the fusion of two hydrogen isotopes. The fusion reaction in the facility generated 2.5 megajoules of energy.

[@manatoa1]

Keep in mind that it took around 500 megajoules to generate the laser pulse. 2.1 megajoules of which hit the fuel pellet, initiating fusion, and producing 2.5 megajoules. It's a breakthrough, but also an extremely tiny OVERALL energy return.

[@epicspacetroll1399]

@@manatoa1 While I am skeptical of inertial confiment fusion being in any way practical for electricity in the near future, I would like to point out that the laser inefficiency is less of a hurdle than it might seem from the numbers. As your numbers show, the lasers used in the experiment have something like 0.5-1% efficiency. However, as I understand it, the lasers used in many of these facilities are rather old and outdated. They're bulky and use flashlamps and other older tech to pump the lasers, mainly because that's what was available when the facilities were built. Modern diode-based lasers can have efficiencies of roughly 40% or something like that, which would bring down the input energy required to run the lasers drastically. Personally I think magnetic confinement fusion is much more likely to become effective for electricity production in the (relatively) near future than ICF, simply because current ICF setups typically have to obliterate a metal houlram (might have misspelled that) with every shot. Considering electricity costs and typical material limitations, I find it hard to imagine getting enough energy from a shot to cover the cost of the metal being expenses with the fuel. Then again, I'm not a nuclear engineer. Just a aero/mechanical one. Ok sorry for the rant lol.

[@manatoa1]

@@epicspacetroll1399 I thought it was quite a thoughtful reply. Firstly, I'm not any kind of engineer, I just read some longer articles and got really annoyed with the way this story has been reported. The majority of people seem to be under the impression that we've achieved a net return on energy invested, which is horribly wrong. If we have diode based lasers that work in this application, I think that's great. I'm a fusion skeptic, overall, but if we could actually do it effectively it'd be a godsend. I agree with you that if we can do it, it'll probably be magnetic confinement that works. Mostly, I'm a nukebro who hates seeing people say we should skip fission in favour of waiting for fusion. When people are fooled into thinking fusion is a lot closer to commercial reality than it is, the argument for waiting gains traction. I think there's a rapidly closing window where we can decarbonise, and I hate the distraction fusion represents in the short and medium term.

[@neon-john]

No they didn't achieve breakeven. The press release lied. The input energy of 2.1 megajoules was only the energy contained in the laser beams. It does not account for all the energy the NIF consumes getting ready for and making a shot. From the NIF website, the NIF consumes 200 MWe continuously during make-ready and the actual shot. Taking that into account, the plant is only a few millionths of a percent efficient. Many orders of magnitude away from break-even, much less net energy production.

[@ct92404]

@@manatoa1 If I hear the words "carbon footprint" or "carbon neutral" or any other of that nonsense just one more time, I'm going to be nauseous. If environmentalist nutters hate CO2 (a naturally occurring gas) so much, they can just learn to stop breathing...

[@benene055]

Tbh, this kind of story where it says something like "they do everything differently and achieve goals everybody dreamed of" sounds like a scam... Really looking forward to the documentary!! :) Great work! Thanks for addressing this subject.

[@ebonaparte3853]

This video really revealed the problems with the tokamak reactor design. We need a different approach for fusion to work.

[@EricAllen8494]

#HelionEnergy #Fusion directly uses the magnetic field like a piston converting it directly to electricity. An amazing approach.

[@callumsmith1516]

unfathomable is a fun word, love your channel dude. you have the same vibe as economics explained and I'm here for it. keep up the good work and I wish you success in all your endeavours

[@azgarogly]

Except the idea that "cheap and clean" energy technology would change the "face of the world" is indeed a pipe dream.

[@rphb5870]

Well here is the definition: kzbin.info/www/bejne/r5fTn2mNgcd0npY

[@azgarogly]

@Thawne whatta'bout it?

[@azgarogly]

@Thawne You mean Albert Einstein born 14 March 1879 in Ulm, Kingdom of Württemberg, right? He was a scientist, mainly in a field of theoretical physics. Engineering is a totally different thing. And no, not _every_ successful engineer is _always_ talking about "positive mindset", you are wrong. Successful engineers tend to do engineering work designing and building stuff rather than giving talks. So unless you are just trolling, please, make a point. How this "mindset" thing is connected to the topic?

[@MikeMaragni]

I want to say, your videos are always amazing. I've always loved physics, but after high school I was scared off of engineering, and went to management and economics... Finding your channel has reignited the interest i have in physics and engineering as a whole, and i want to thank you for it. I hope i can find it in myself to actually pursue this interest while i still have the time.

[@armaanoo]

It's amazing to see how every question we think we have an answer for needs sooo much more thinking.

[@jeremyguillory8304]

I stood inside the largest fusion reactor about 6 months ago while on a shop visit…. The one being installed in France… Absolutely amazing.

[@heidirabenau511]

I watched the Engineering The Future episode about Fusion, and found it fascinating and hopefully this renewable energy source can become a reality soon! Please could you make a video about space mining, and why we haven't seen it yet!

[@linecraftman3907]

the answer is pretty simple, it's hella expensive to launch mass into space and really tough to bring stuff back

[@kingsman3087]

I remember my uncle said he had conversations with ET aliens, and he said that humans have been making so many mistakes with their pursuit of fusion like there's so many other ways different from a steam turbine to extract energy from fusion,etc, we need to change our perception of fusions and methods around it

[@Bramble20322]

@@kingsman3087 Yeah, your schizo uncle is tottally right, bud.

[@funveeable]

Somebody like China or Russia will build a fusion plant which is gonna explode and vaporize a dozen people and HBO are gonna make a drama series about it and the entire planet will proceed to hate fusion so it never gets deployed world wide.

[@xponen]

​@@funveeable to deploy Fission reactor worldwide it has to be intentionally made cheap.

[@h.d.h]

What timing! I would love an update considering the most recent developments in Fusion energy.

[@darknight991]

You’re in for a wonderful video on Helion ☺️

[@JamesSmith-qs4hx]

No cohencidences....

[@yone6027]

tl, dw: The problem with nuclear fusion is that the energy needed to create the conditions needed for fusion is often too high to be practical, and the tritium needed for the process is becoming increasingly rare. However, research is ongoing into developing ways to extract more energy from the fusion reactions than is needed to create them, using high-energy neutrons.

[@Zircon10]

One basic problem not addressed here is the damage that high speed, highly energetic neutrons create in the fusion rectors first wall. 14 MeV neutrons will knock the atoms in the first wall off their lattice position. The resulting vacancies at these locations will migrate by diffusion and combine to form voids. This leads to rapid, uncontrolled swelling of the materials of construction that sees this neutron flux. When we were experimenting with fission breeder reactors the high energy neutrons were only about 1 MeV. These neutrons caused core structural materials to swell by 16 vol.% in as little as 360 days of operation. All that swelling introduces tremendous internal stresses and can quickly cause failure. Obviously, 14 MeV neutrons are much more energetic than 1 MeV neutrons and therefore capable of inducing damage at a very high rate. This materials problem has to be resolved before a viable commercial fusion reactor can be built.

[@maybecriminal]

My dad worked on nuclear fusion all his academic career , he always said that it will be the future, he's gone now and I miss him lots. He had a TOKOMAT he would go and play with every day. Interestingly this was not in China or Russia but in the west.

[@dsprofdoc2201]

Culham Lab?

[@maybecriminal]

@@dsprofdoc2201 Sydney Uni , yet the major government funding was to the Fission Reactor at Lucas Heights.

[@robertanderson1043]

This is a great video, and answers several "why this way and not this other way" basic questions which are not obvious and are actually not easy to find online. Great job!

[@tankeater]

1:40 right, the USA and USSR just so happened to think of the same breakthrough at the same time... Operating Paper Clip had nothing to do with that and the Germans already experimenting with this technology 🤔🤦‍♂️

[@mylittleelectron6606]

Eventually check the mathematics myself, but I've always wondered why neutrons themselves couldn't be kinetically induced to fuse seeing as though there would be no coulomb repulsion. Then by inducing beta decay, we could turn those neutrons into protons while they're already Bound in a nucleus. Kind of like building a ship in a bottle, in which you build the ship first.

[@joshwilliams8863]

That would require a constant source of free neutrons... which would need to be derived from something like a fission reactor (so it doesn't really solve the problem). Additionally, free neutrons decay in about 15 minutes, and can be captured by the surrounding wall material, making it radioactive. This is unavoidable - as you pointed out the neutrons aren't affected by electromagnetic forces and so cannot be contained using a magnetic field as plasma can.

[@ricktrickshots2642]

I can really see you spending weeks on that script and animations. Through only consuming it we never really apreciate the work behind it, so I want to say THANKS!!!

[@jdbrinton]

Ha! The stock footage shot of the helium tanks at 6:50 was taken at XCOR Aerospace, a defunct commercial aerospace company I worked at in the early 2000's. Lots of history there.

[@Creamypie626]

No matter what kind of reactor we make, it the most basic concept, it's just a fancy water boiler. We might have come a long way to react difference energy source but the way we harness that energy is the same as we did 200 years ago, we just heat up water to make steam that is the used to produce mechanical energy that is then converted into electrical energy. If we really want a game changer, we need to figure out a way to turn those fuel straight into the energy source we needed. We need to figure out how to make a nuclear reactor that doesn't use water to create electricity.

[@Digidoc316]

The Tokamak creates a D - shaped magnetic containment field limiting the compression available. Restructuring into a true circular shape, control of the magnetic containment becomes less problematic. By varying the field strength on the confinment coils, the plasma stream can be reshaped into a smoother round shape; allowing a consistant density of plasma. Increasing the magnetic containment and processional frequency, the plasma stream is compressed in diameter thereby increases the molecular density of the plasma stream as well as it's angular velocity.

[@HiddenMasters]

this aged well

[@Safetytrousers]

Wrong.

[@tyvaughnholness1985]

That was really engaging, it went in depth about the challenges and provided information you don't typically hear about fusion

[@Elasquantum]

Micro magnetism in a fusion chamber, y’all want a stable plasma basis without whatever, this sounds fit, the magnetism pulls whatever particles in through tubes or some, probably inserts. Loading so short answer plus I’m new to this, basically, I study natural conductors

[@AmogusSusAmongusSussyBakaAmogg]

5:00 the song in the background is Le cygne "The swan" by saint-saens but futurized. Edit: You can hear it better here 6:52

[@morganc5561]

Fantastic video as always!! Your content is just a joy to watch, I get excited whenever I see a new RE video available. Super excited to see the extended Helion video! Your channel motivated me to sign up for Nebula/CuriosityStream and I am super grateful. Thank you!!

[@dRUNKENyTI]

The timing of this 😂

[@emmanuelmedina3769]

You beat me to it!!!

[@rogerahier4750]

Fusion isn't going to be really practical until they develop cold fusion with Helium 3. There are no neutrons or even photons. Just pure kinetic energy on a charged particle, easily turned into electricity. You can't do cold fusion if there are free neutrons and every other reaction produces neutrons, either main or side reactions. There are no side reactions with He3, so no neutrons that need shielding and cooling. He3 has some really interesting cryogenic/magnetic properties that can facilitate getting past the coulomb barrier. We can mine Iron, Titanium and He3 on the Moon to build ships to mine the asteroids. Mars already has 2 captured asteroids to start with.

[@Deathempire666]

In the video he said that the nuclear fusion heats up so much that it could melt any matter in the universe doesn’t that mean if we could harvest the heat as well the nuclear fusion we could harvest a lot more energy.

[@logh88]

Man the animations gets better and better every time, nice work!

[@bobthepurpleninja]

Oh man, what unfortunate upload time

[@arcanegamer2723]

actually in USA we tried years ago to make disposal or radioactive waste cheap and effective by placing them in a hole in the ground in the middle of nowhere, but we never used it because despite it being approved by every regulatory agency required and the local jurisdiction people of that state like most of the usa have a not in my backyard way of thinking its the same reason we have issues with our power grid we dont have enough pylons for high voltage transportation across large distances

[@charlesvan13]

An effective solution is to continue fusion research, along with all of the nuclear chemistry to produce needed materials, and build fission power plants. Spent nuclear waste can be easily stored, and some of it, such as depleted uranium and tritium as important uses.

[@twotails]

6:40 Best crossover of the year.

[@alatereview3141]

And the day this video is posted we get a breakthrough in nuclear fusion technology and are finally able to get net positive energy from a reaction. Life is funny sometimes

[@nelsc9051]

I came here just to see what the updates are. I’ll bet they release an update asap

[@nerdydude1.882]

The brightest minds of several generations working with increasingly more precise methods of measuring reality just to make fire spin. And it's awesome.

[@qbefiluvzr2468]

Don't know where you find 216 - 560 tonnes of Beryllium (Be) needed for the reactor ? I found on Iter website : "The 440 first wall panels will be covered with 8-10 mm of beryllium armour, for a total of approximately 12 tonnes of beryllium distributed over a surface area of about 700 m2.". So Iter is going to use 12t and a little bit more ~12.5t in total if we count other systems that require Be. And even if Iter claims that they'll only need to replace these panels once, that's only 24 tonnes of beryllium. So, where did you find this 216-560 tonnes range ?

[@DJRaffa1000]

I'm really looking forward to the documentary on helion. Full scale documenteries on such topics always excites me.

[@wcookiv]

I'd love to hear you discuss Fusion General's concept of repeatedly collapsing a sphere of mercury and using the heated mercury to generate steam, but I guess that's not gonna happen now. I find Helion's idea of using the magnetic fields very elegant, but General Fusion's ideas seem much more straightforward, scalable, and easy to manufacture than all the other fusion concepts out there. Also a fusion reactor that functions like a nuclear diesel piston is exceptionally pleasing to my aesthetics.

[@dsprofdoc2201]

At the velocity you quote the Kelvin temperature would only be around 4MK. I have another question: if fusion is occurring there would be neutron emission, and I do not see any shielding to deal with that.

[@JusTryNc]

Man I have no clue about nuclear fusion but I have become addicted to learning about it for some reason

[@arkatalukdar4472]

What timing. This video gets released on the same day as a "breakthrough" in Nuclear Fusion is announced.

[@tomlabooks3263]

Right. Coincidence?

[@JB-mg5lw]

Look up how many "breakthroughs" fusion has had, you might find it is a bit overdone.

[@tomlabooks3263]

@@JB-mg5lw You’re probably right. Today the news has already morphed to “a small step forward”…. living history day after day is so boring !!

[@dregonzz]

This video and production quality is PHENOMENAL. Bravo on all the hard work!

[@Joe-xq3zu]

Even if we somehow manage to get practical fusion, I highly doubt it could ever out compete high end fission reactors. Something like a high efficiency MSR, even a breeder reactor, is always going to be simpler to build and maintain than a fusion reactor and therefor more economical.

[@astrowuff]

The most interesting thing about H->He fusion I've learned is how improbable it is, the sun overcomes this by shear brute force and the uncertainty principle.

[@jarskil8862]

It helps when you are... well size of a sun.

[@catcatcatcatcatcatcatcatcatca]

I am very sceptical of any tech-startups that try to solve such a long researched problem. Just considering the needed resources it always begs the question why hasn’t someone with more resources tried this before? And usually the answer is that they did, and it didn’t work, or the company is actually stuck on the same key issues as everyone else, and in reality had no trump card or skeleton key to advance the technology. And its not that the private sector doesn’t do valuable and good research - rather that their marketing often promises ridiculous viability compared to other research efforts. Where researchers have optimistically promised 20 years for 60 years, private company saying they will do it in 5 sounds like an advertisement, not a honest estimate.

[@TasX]

A lot of them are spin-offs of well established research and they try to scale down with more prototyping/less theory. In fact a lot of them directly collaborate with the institutions. For example CFS. They’re relatively new but they’ve made some of the largest technical advances. But you’re right, there is a lot of marketing/hyping going on right now. We’ll have to see where this all lands 10 years down the line.

[@MrJdsenior]

Yeah, and often people talk about energy out/energy in=1 as the holy grail. Fact is that it has to be a fair bit over one, as energy is needed for supporting processes, etc within the generator. and the economics don't get interesting until the ratio rises a fair extent beyond even that. You need to be able to extract a lot of energy before very expensive plant construction is preferable to other sources, specifically fission.

[@MrJdsenior]

@@TasX I can tell you that. Based on previous performance, ten years down the line we will be twenty years from realization, just to continue the eternal, never shortening estimate. Shortening that already demonstrably ridiculous time frame does nothing. It is just nonsensical marketing. Just sayin'. I hope I'm wrong, but I likely won't be. The investing disclaimer, past performance is not always indicative blah blah blah..., and all that aside. Eventually we may get there, probably will, but, unless some pretty serious advancements are made in multiple areas, probably not during my lifetime. HEY, maybe AI will come to the rescue! And IMHO, if it does (or doesn't) a short time later it won't matter, not to the human race, anyway. Working the bugs out of the 'program' may have a whole new meaning, if you catch my drift.

[@BlueZirnitra]

Everyone thought private spaceflight was a fools game until a company came along and blew all expectations out of the water. Startups have less red tape and bureaucracy involved, which is an immense factor in their favour. As we move forward private scientific endeavours will make more of an impact as science becomes liberated from being the sole purview of nation states, politics and taxpayer money.

[@mattsoup4121]

I definitely agree that there should be a healthy skepticism with these fusion startups. I don't have the knowledgebase to verify their claims and if it's anything like the smallsat launch market there's a ton of hype and investors dumping their money into bad companies (SpinLaunch, Phantom, Arca, etc.) That said, having many less funded groups trying to solve a problem can be much more effective than having one group of people do so. A lot of these startups will be attracting passionate, driven engineers and scientists who don't like the more academic nature of the huge national projects. Having small budgets to work from will lead to innovative solutions. Will all of them succeed? Certainly not. But, if each one of them effectively solves a small part of the problem then collectively the field will be advanced.

[@ronakpatel7919]

US Department of Energy: Hold my beer

[@ryandugal]

Hahaha that’s what I came to say

[@EricPham-gr8pg]

Rearrange spin orientation to create strong weak force became attractive force rather repulsion before the strong field brings tgem close together by entangle the opposite spin of adjacent proton to attract each other and guide heat extraction as molecules combined so ensure stability

[@phprofYT]

It will also allow us to power our way to the planets and possibly the stars. Would make a great source of power for a plasma cannon as well.

[@krunchy3761]

This is the first video on this topic I've watched that actually explains how to get the heat you are going to use to generate energy. Thank you!

[@Bryzerse]

I think it would be a bit overly simplistic to say cost is the primary reasons fission plants are being shut down. In France and Germany, where the some of most are being closed, the reasons are a lot more nuanced, but otherwise this is a really good video on the topic.

[@ARabidPie]

Exactly. The problems facing fission power development are mostly political, not economic.

[@v0ldy54]

Not really nuanced: political propaganda, that's all.

[@kellymoses8566]

Irrational fear is the main reason nuclear reactors are being shut down

[@Bryzerse]

@@v0ldy54 Well France also wants to shut them down to be less reliant on nuclear, but it does all stem from the same place so you are right really.

[@AFC2022]

“The Power of The Sun, in my Palm of my Hand” -Doc Ock

[@trazyntheinfinite9895]

Its higher order technology. With so many required other technologies. The fact that we already got this far in just under 100 years is fckn amazing! I am happy we got so many bright people chasing this technology. Step by step, they will get there.

[@sjsomething4936]

The news out today regarding the ability to generate more power than consumed in producing it makes this video all the more timely, especially as it was achieved in a tokamak. Thanks for bringing the various details to your audience in a very clearly explained way Brian!

[@andrews6013]

I was about to say it seems like this came out a day ahead of the news

[@haywire4686]

It wasn't actually achieved in a Tokomak reactor, it was in the National Ignition Facility using Lasers.

[@shaunwu3910]

To my limited understanding, this was achieved using inertia confinement fusion, not through a tokamak

[@sjsomething4936]

@@shaunwu3910 oh, I’ll have to go look, I could swear the article or video I saw on it mentioned a tokamak because it stuck in my head about this video. Maybe I’m hallucinating though. Thanks for mentioning it.

[@sjsomething4936]

@@haywire4686 ok thank you, odd I could swear wherever I heard it they said tokamak but it’s probably memulti-tasking, they might have said something like “unlike normal fusion reactors which use tokamaks” and I was try to pay attention to a call at work at the same time as the news 🤣🤣

[@LMSI998]

The more I learn about nuclear fusion, the less attractive it becomes, while for fission is the opposite the case. And also, nuclear fission reactors are not everywhere uneconomical. While in Europe and the US this technology became very expensive due to loss of competency following a halt in construction of more than two decades, the Russians, Chinese and Koreans manged to build nuclear power plants cost effectively.

[@eclipse5367]

Thinking about this now, why can’t we increase the pressure inside the reactor? Increase the pressure by increasing the amount of molecules in an area. The closer they are together the more likely it will happen. It takes less energy to move a ball of iron an inch rather than a mile. Most of the energy is focused on speeding up the particles if I’m not mistaken.

[@__Azr_ael__]

XD i just love that someone pointed out that humans are just ever evolving the damn steam engine over and over again and i love that its literally like those mods in games like forts that let you endlessly upgrade your shit with literally humans have been trying to save up the damn energy and metal to fucking hit the next soft cap..........