SHOTGUNS: The Right Tool for the Wrong Player

[@Verbose_Mode]

A huge thing for balancing shotguns is actually _the number of pellets._ More pellets makes it more consistent, with a missed pellet meaning less. Edit: Dividing the damage between pellets is more complicated than my initial two sentences implied. Lets say your shotgun deals 100 damage total. The spread is 1m at 50m range. If it only shoots 5 pellets at 20 damage each (buckshot), the odds of all the pellets hitting at longer ranges falls. Each one that DOES hit will chunk something, but it might be possible for every shot to cartoon-outline your target. This is _volatile_ damage, high highs and low lows. If it shoots, say, 20 pellets at 5 damage each (birdshot, basically), the spread is going to be more even. Yes, less will hit at longer ranges, but the odds of cartoon-outlining your target are WAY lower. You'll always get SOME consistent damage in. Where this gets really interesting is when damage reduction mechanics, specifically flat damage reduction, come in. Lets say the damage is reduced by only 2 points per instance of damage. Suddenly, the buckshot damage is much better, because it does 90 damage on a meatshot, while the birdshot is utterly shafted and only does 60. While realistic that birdshot is terrible to armor, this could cripple your game balance without special consideration. There are a lot of levers to adjust, number of pellets being one of them.

[@McCaroni_Sup]

So, Birdshot?

[@christiandelao2547]

A lot of games actually don't give a head shot bonus to shotguns, and divide damage between the 8 pellets in a 12 Guage shell, making them less effective over distance as spread increases, what balances the shot gun is reload speed, taking much longer to reload less shots but with high damage

[@IncredibleMD]

@@McCaroni_Sup Well, birdshot also has SMALLER pellets.

[@C0MR4D3C0WB0Y]

I remember when BF4 changed the shotguns, most of the shotguns where incredibly underpowered from the defensive spec reducing body damage. Most shotguns had around 8-10 pellets. DICE changed it to the semiautomatic shotguns had 14-16 pellets and pump guns had 16-20 pellets and it broke the damn game. Assault rifles suddenly where far less effective even in bigger maps due to the number of pellets the shotguns where throwing. They timed it down but those guns are still surprisingly effective at ranges most shotguns wouldn’t be effective. Also not to mention Insurgency Sandstorm…

[@christiandelao2547]

@C0MR4D3C0WB0Y typical shot gun has an effective range around 150 meters, with shot, and with slugs it's not much shorter then most rifles something like 300 meters

[@RawBerserker]

I think there is no more satisfying gun to use in a game than a well functioning shotgun. Even if it's not the "optimal" choice, I'd go for it every time.

[@Numbskulli]

Shotguns are my favorites as well. Sad that some games i play make them underpowered or they stop working as soon as the enemy is 2 feet away.

[@randomplaceinruralamerica9618]

Shotguns are really nice feeling but a revolver will always be my go to pick even if it usually doesn’t do enough damage to oneshot in the body and has a worse fire rate than most sidearms, pulling out a revolver and getting a headshot just feels so good.

[@2BrosOfficialGaming]

same

[@TheKirBoi]

If there's ONE gun you don't wanna mess up, it's the shotgun.

[@imgonnacream]

all of you cannot aim high sens + decent ish tracking means easy kills with no aim

[@shanweeboy]

The spas-12 was made to be a police shotgun. It had the pump mode on account of the non lethal loads not having enough chamber pressure to cycle the weapon in semi auto mode. They did the pump mode for those shells.

[@jamesbailey6257]

Gonna be a pendant here because I feel like it's a time it actually really matters, not non lethal, less lethal, less lethal rounds still can and do kill people because it turns out firing ammunition at protestors isn't exactly safe

[@whytho1690]

Neat tidbit

[@superpilotdude]

clever girl

[@mathewsvr5355]

This is true, but generally with how bulky the spring was even some standard loads wouldnt cycle all the way. But yes I 100% agree

[@shanweeboy]

@@mathewsvr5355 Yeah it was a chonk gun.

[@thedomainofsealteamaqua]

the "shotgun" is basically the equalizer: even the newbie's can use it, and the pros fear it.

[@tabula_rosa]

i replayed Doom 2 recently & realized part of the reason the shotty feels so good to use is that the damage falloff isn't artificial, it fires a bunch of pistol shots with the same damage & range as a pistol, and how much damage it does depends on how many of the pellets lands -- if you're close enough to cluster the enemy you do full damage, no matter how far they are means not only can you chunk single enemies but if ur firing into a crowd and each pellet hits someone ur still doing full damage, even if ur 40 feet away circlestrafing their fireballs

[@ssjbread2803]

Also, the original Doom shotgun lacks vertical pellet spread, which gives it a surprisingly REALLY strong medium range game and allows it to make do as an impromptu sniper rifle in a pinch, as you're pretty much guaranteed to get at least a couple of pellets on target at any given distance. The super shotgun lacks this boon, but makes up for it by both possessing more pellets AND dealing more damage per pellet, making it serviceable in medium range, ineffective at long range, and doing equivalent damage to the ROCKET LAUNCHER at point blank range. The shotgun is less a "shotgun" in the role it fills and more your workhorse rifle; the super shotgun fills the genuine "shotgun" role, and does a DAMN good job at it.

[@hi-i-am-atan]

@@ssjbread2803 also, all the doom 1 hitscan weapons have the exact same spread, so even without the quirk of completely horizontal spread, the shotgun has completely average accuracy anyway. the pistol and chaingun still have the advantage at long range due to having perfect accuracy when tap-firing, but long range encounters are pretty rare in doom 1 furthermore, both shotguns benefit significantly from two quirks: each pellet is only traced after the prior one has already done its damage, and hitscans pass right through actors that aren't shootable - including monsters whose hp just hit 0. this is the reason you, unfortunately, can't ever gib so much as a zombieman with a shotgun shot, even with the ssg at point blank, but it also has the far more useful consequence of letting excess shells "penetrate" on lethal hits. this is a _major_ reason why the ssg is so excellent at crowd control, as the full 20 pellets can distribute themselves with extreme efficiency to wipe out groups of mooks instead of all getting caught on the unlucky mob in the front and center. just another trait that makes the shotguns such great workhorse guns!

[@rafaelcastor2089]

Not an FPS, but i love the shooty in Intravenous for pretty much the same reason. It has a lot of spread between each pellet, yes, but the fact that they actually behave like somewhat like pellets actually behave in real life means it does a fuckton of damage and you don't even need to really aim, just point it at the general direction of guy and, unless he is far away, he is gone. The stealth part of the game is cool, but clearing a whole ass mob within 5 second is priceless

[@helloagain.andagain.andagain]

try ultrakill

[@aircraftcarrierwo-class]

The Super Shotgun is so beefy because while it consumes 2 shells of ammo, it fires 3 shells of pellets (21 pellets vs 7 from the regular shotgun). The Shotgunner enemy fires the exact same pellet, but only 3 of them. Doom was rather clever in balancing its shotguns around the number of pellets, with all the pellets otherwise behaving the same.

[@russellhassan7773]

i love how shotguns function in high ttk shooters like team fortress and quake; when shotguns don't/can't easily one shot, they become a very skillful weapon since you need to hit all your pellets to maximize your damage output.

[@SyRose901]

Those games lack the omega strong assault rifles; and machineguns deal as little as 5 damage per shot, and even the Lightning Gun deals 160 per second, with Quake having players be able to achieve as much as 400 effective health, the shotguns become very, very balanced as it is the only weapon that works perfectly at point blank range or close range. Quake's Lightning Gun or TF2 Minigun both shred opponents at this range, but they're hard to use compared to the shotgun. At farther range, rocket/grenade launchers do better. Railgun/Sniper Rifle is king at long range.

[@pancakeperson8905]

@@poleve5409 The Sniper Rifle (TF2) is an infinite-range insta-kill weapon that has sparked numerous debates within the community for not belonging in the game.

[@smokey3504]

There are games with low TTK where hitting all your pellets with a shotgun is a skill barrier. I've been playing alot of COD WWII lately and the M30 Luftwaffe Drilling has such a tight spread and low base damage that it requires the player to aim with it accurately like a slug shotgun. In return it takes people down in one-shot at a range where other, easier shotguns can't even deal any damage

[@DexieTheSheep]

hell yeah, like the lever/tac in Fortnite

[@colbyboucher6391]

Yeah, this guy's videos are all about a *very specific* sort of shooter and there's a reason this *very specific* sort of shooter didn't get popular for a while, it inherently introduces balance issues like this. Better yet, go the Halo route and make your OHK shotgun a pickup people fight over. Just acknowledge that it *is* insanely powerful.

[@SaltSpirits]

Fun Shotgun Fact: While your average 12g shell will come in a variety of colours, from your standard red, to blue, green, and everything in between, they will *never* be yellow. This colour is reserved for 20 gauge shells and acts as a warning sign to help prevent one from loading the wrong shell into the wrong gun.

[@cevatkokbudak6414]

Cool

[@rebel6301]

interesting, thank you for sharing

[@cavemanthog]

There are also Bolt-Action Shotguns

[@Boristhaspydr]

Do 16 gauge do that I purple too?

[@gameingwiththewolf8440]

Don't get me wrong I love the 20 gauge but the reason why 12 gauge is still used is because it was the one that least jammed the most newer models are more prone to jamming than the older ones

[@GoobertNoobster]

Doom eternal: like it or not, you're playing with it, bucko

[@Batchall_Accepted]

"I'll have a pistol please" "A shotgun?" "No, a pistol... Pis-tol" "Shot-gun" "P-I-..." "S-H..."

[@smolfishyboi7887]

​@@Batchall_Accepted "P-I-..." "P-I-..." "...S-T..." "...S-T..." "...O-L" "...O-L" "PISTOL" "SHOTGUN"

[@chowbox87]

Battlefield 4 made an interesting solution, they had 2 zones where random pellets could land. Most would land in the center, say 5 of the 8 pellets. Then the other 3 are spread in an outer circle, so that when you’re in point blank range you’ll likely hit all or most of your shots but as you go out, you have to be more careful aiming, utilizing the consistency of the inner pellets to get headshots

[@jodlaa5142]

and in bf they have a lot longer range than something like cod if I'm not mistaken, I remember playing bf4 for the first time and seeing a normal buckshot shotgun kill pretty consistently in 1-2 shots from ranges which would be max range in cod, I think it was because in cod pretty much everything is hitscan and shotguns are coded in a way that after a certain distance the pelets just disappear, while in bf, where I think everything is a projectile, they get to travel longer and still do solid dmg at like medium range

[@chowbox87]

@@jodlaa5142 yeah definitely, plus you know a conquest flag can be the size of some cod maps so everything needs stretched out a bit

[@Saurygiel]

XDefiant uses the same exact technique. I found that out when using their firing range, which I thought was pretty smart.

[@BenignStatue71]

I believe Battlefield 4 uses a headshot multiplier of 1x; as in it doesn't deal any more damage to a target (except for Slugs). Shooting the Buck and Flechettes at players is best done to centre mass and nowhere else.

[@BusinessWolf1]

You just described cone recoil, which every decent game uses. No shit.

[@AxiamWolfe]

The roster of shotguns in Titanfall/Apex Legends approaches the design in an interesting way. None of the shotguns have random spread, and you get to choose between: - Horizontal Spread of Mastiff - Star-shaped spread of Peacekeeper, with ability to ADS and compress the pellets into a single point - Funky 8 shaped spread for the Auto EVA-8 - 3 pellets for the Mozambique

[@ajh3461]

Similar thing with the Panic Attack in Team Fortress 2, although TF2 also has fixed spread in comp

[@gentlefauna]

Honestly peacekeeper was the gun i thought of when he was talking about the pump shotgun

[@erinkarp]

mozambique here!

[@bear3616]

The mastif was a very fun weapon. You often need to lead your shots quite a bit when going fast. And being good at it is amazing.

[@flazerrazer2992]

the mozambique also has a choke like the peacekeeper just cant be toggled

[@CaptainTechnicalityLP]

Worth noting that TF2 has the fixed pellet patterns for shotguns. Normally this is enabled as a server option, which is usually used in competitive play, however, there is also a shotgun in the game called The Panic Attack that has the fixed spread pattern as a built in stat.

[@notgray88]

panic attack is so underrated. it might not be the most powerful shotgun in the game, but it's really fun to use

[@thedog5k]

@@notgray88 Uncle dane says its legit I feel like its legit. Idk, i think its legit :)

[@Benneth12]

gun

[@IndonesianKomodo]

Yeah that luck cap thing he said is bassically CoDM sg ads BSA

[@Dryfloorsign]

the panic attack is probably the best shotgun only behind the family business, or maybe engineer shotguns

[@Jhet]

Ahoy is now a genre. I love the quality of this channel and i don't think it's a knockoff. Let's just hope the other channels that try this style keeps up the quality.

[@Trashedac]

The slug idea is pretty smart in my opinion it wouldn’t fit perfectly in every game but I still think it’s a good idea

[@jtjoemamma]

They did it with the ksg in black ops 2 and others

[@mrvandal131]

Yes, I liked the idea as well

[@RiggedFem]

Destiny 2 also has a system where the slug shotguns are completely separate from the other shotgun frames. God if he thinks nos shotguns in other games are diverse, wait until he discovers precision frame shotguns in D2

[@The_Questionaut]

I prefer slugs, it makes the shotgun more fun.

[@JustABaptistApoligist]

@@RiggedFem or warframe’s many shotguns and custom guna

[@p5ychojoe138]

I used to hunt with slugs growing up. Was pretty darn accurate with them, too. Always frustrated me when I knew they were in range but the game would say "no" even with slugs.

[@xtvernon15]

Ksg In bo2 was I think the perfect representation of them wile staying “balanced”

[@Grim_Erudite]

Indeed

[@ryang2573]

There are a lot of things, even in 'realistic' games, associated with guns that are either tweaked or omitted entirely for the sake of gameplay. What you said is just a subset of the larger problem of realistic firearms just being too lethal to be much fun in a video game. Even if someone is wearing body armor or is shot in a non-vital area, it really doesn't matter all that much what they're shot with: they're going to be hurting and, in some cases, probably severely injured as well. This is especially true for shotguns. If someone is shot by a garden variety 12 gauge loaded with 00 Buckshot, they're going down. Whether they get up again is a function of how good their body armor is, but - at a minimum - they are not going to be very combat effective for a while.

[@cdogdeluxe6037]

Only more realistic games that have very fast times to kill can properly represent shotguns without breaking the game.

[@sosig6445]

@@ryang2573 So a realistic game would kill you in 1 hit if you have no armor and stun you if you have armor

[@Fluffypancakes-o7q]

Shotguns in games: confetti Cannon Shotguns IRL: *Non-scoped crit-boosted sniper rifles* Edit: thanks for likes, and "Tonk Fortress 2" will be released soon! ^_^

[@bradley4465]

body armor eradicates shotguns. also sustained fire sucks ass.

[@BierBart12]

​@@bradley4465 body armor turns shotguns into extreme stun guns, unless one pellet hits your head

[@donny8652]

​@@bradley4465those guys are wearing body armor! Loads homemade white phosphorus shell

[@tabnk2]

@@bradley4465 the slug in question:

[@TechnicalOveride]

nothin like people who don't have combat training debating on how good a shotgun is in combat not saying i know what i talk about either, i just think you're all wrong

[@MrNobody-zx4jz]

Very beautiful and professional made! Congrats! I want more content like this, you really have imagination and know how to express yourself, wish the best.

[@Zorro9129]

Shotguns with realistic range are balanced in games with realistic ranges, because you still have a disadvantage at longer ranges in exchange for an advantage at shorter ranges. Combine this with buckshot having much less effectiveness against good body armor, and it becomes a very balanced weapon.

[@ADMICKEY]

Cough phantom forces cough

[@zyad48]

Yeah Insurgency Sandstorm kind of gets this, that said a lot of that game _is_ with indoor objectives and such, so shotguns kinda end up being extremely effective overall, even if the .50 cals can basically one-shot you through several walls and LMGs are insane on the bipod.

[@Nurse_Xochitl]

As I always say, realism balances itself out. But dumb fucks want shotguns and snipers/DMR nerfed to oblivion, while they want SMGs and ARs buffed.

[@tylerjohnson7204]

Hell Let Loose is a very good example of this. You can easily kill within 70 or so meters but beyond that you need a few shots unless a pellet hits a head.

[@eon2330]

Yes and no. Sadly most games don't even balance shottys in those games. Fact is shotguns are THE BEST handheld anti-human non-explosive weapon at 200m or closer. Its like a grenade you instantly detonate facing someone. Especially the full auto ones. The problem all game developers have is balancing automatic shotguns vs the semi autos vs smgs. Shotguns ironically should have longer range than most SmGs and overall faster firerate and projectiles IRL. Handguns are pointless. Smgs are sidearms not main weapons. This is the problem with balancing. Lmgs, Ars and shottys are the 3 main weapons. Snipers/dmrs are just higher caliber or more accurate AR(should just be a mod or attachment). So they use similar ammo and should have the same damage but more range or pen. Games don't EVER get that right. Even tarkov messes that up and doesn't have any semi-full auto higher caliber weapons. Like a scar or battle rifle. Fact is. Weapons like the aa12 should be THE only viable close range weapon. The 7.62 ir 5.56 weapons the only viable mid range, and the snipers the only viable long range. Mid range being 200m+ Long range being 450m+ Most games don't have any reason for you to fight at 400+m. Thats the problem. So everything gets claustrophobic. Smgs are sidearms for spec ops missions. They are the "don't shoot the airlock accidentally and over pen" weapons. Don't kill the hostage etc.

[@mcsmileycorp]

While not realistic I always liked how the titanfall games and apex handle it's shotguns, each gun having fixed and interesting spread patterns useful for different scenarios and rewards high skill players by giving them optimal points to aim for on opponents.

[@reiarukaza7490]

the fact that they flip the problem at its head by making the pellets only spread within the reticle blows my mind, as it really becomes a high skill floor weapon that really rewards accuracy with high dmg output, not to mention in combination with the fast paced gameplay

[@bear3616]

They were extreme fun. Sadly I haven’t been able to play it for a while. I’m on X-Box.

[@zyad48]

well, titanfall 1 at least Sadly the Eva-8 Auto in Titanfall 2 is a complete luck-based disaster after the nerfs :( I very clearly recall this because it pissed me off to no end, I played after the nerfs, amped the Eva (amping weapons reduces the number of shots required to kill by one, and for shotguns reduces the number of pellets needed for a one-shot by one) which would mean I only need to hit _3_ out of the 8 pellets it fires to get a kill flew directly into a guy and pull the trigger at point blank range, only to die right after and see on the killcam that he had only been hit by _one pellet_ The Eva in Apex does definitely have something going on that makes its spread more consistent though, but that speaks more to Respawn realizing how bad they screwed up a lot of the balance and gun designs in Titanfall 2 than anything else lol. (The R-201 in Titanfall 2 is an incredibly high recoil, low damage """rifle""" that only works because of the insane aim assist controllers give it, meanwhile the R-301 in Apex is a lovely smooth and very accurate proper rifle and even has a sort of recoil pattern to it as well, compared to the random mess of vertical and horizontal recoil in Titanfall 2)

[@Bone220]

Titanfall 2 is just honestly the Superior game in my opinion. It's underrated and sadly abandoned but Titanfall 2 was such a fun game, amazing campaign and a multiplayer that's genuinely replayable.

[@JohnSmith-kt3yy]

Wait is that why the shotguns in apex feel like shit?

[@samuelantoniocastillomeza5034]

As a former owner of a Mossberg 500, I'm already loving this! Pump action shotguns are so satisfactory.

[@wr3nche5]

i own a mossberg 88 (a cheaper version of a 500 that still functions just as well) and i can confirm this

[@Abel-Alvarez]

Mossberg 590 shockwave here🔥 They're so cool. My next plan is to go for an Ithaca model 37 and a Winchester lever action. 🤘😮‍💨

[@floofyboi7546]

@@Abel-Alvarez I recently purchased my first firearm, 590’s are amazing. Im just sad most indoor ranges don’t allow shotguns

[@Abel-Alvarez]

@@floofyboi7546 would it be because of those that use birdshot/buckshot would bounce around the walls creating a safety hazard? Or something else entirely different?

[@floofyboi7546]

@@Abel-Alvarez I have no clue, I just tried all my local indoor ranges and they told me no shotguns

[@somo4227]

no gun will ever feel as good as the shotgun in tf2 universally used and reliable while not overshadowing other weapons,i especially love using it on soldier beacuse people expect me to bring out the shovel when they get close

[@autismusmaximus4933]

The Shotgun in Insurgency Sandstorm is quite a tale in itself It is pretty much the most realistic representation of a shotgun in a video game. You WILL get domed by a shotgunner from 50 Meter away. In this game, the primary upsides are that Shotgun is cheap, meaning you can run it alongside a lot of other equipment, and that it is light, since it is basically just a pipe that shoots bucks, and you run with only a little ammo to slow you down. Its spread is so tight that you still need to properly aim this gun even at the closest ranges, and the fact that it one hit kills everything is overshadowed by the fact that pretty much every weapon does so. It's main downsides are that it fires very slow, only a sixteenth of the M4 (detremental when every shot is lethal) and that it has a rather long profile (The shorter the profile of a gun, the closer you can stand at a wall etc. the physical length of a gun is a stat in this game, meaning it is a bad weapon to peek corners or breach doors), which is bad, since the only class with access to the shotgun is the breacher. I think this is a very interesting take on balance for the shotgun

[@Appletank8]

yeah, when every weapon is lethal, shotguns don't stand out as much, which kinda holds true for sniper rifles. But when you scale things down to take at least 2 or 4 "shots" to kill in a best case scenario, you need to consider what kind of damage spread you want for all the different types of weapons.

[@ownedpilot4324]

Haha, that is why I like Insurgency so much. “F*ck balance, make everything op.”

[@hoonterofhoonters6588]

If you start with the premise that people usually die if you shoot them, the balance issues around shotguns disappear.

[@leifwulffstephan3725]

@@ownedpilot4324 realistic

[@autismusmaximus4933]

@@leifwulffstephan3725 Guns are pretty Over Powered in real life, though.

[@FormerlyOrca]

I'm surprised no one has mentioned the guns from Titanfall 2 in these comments, not only are they great examples of weapons balanced with unique playstyles in mind they're also not afraid to leave the realm of reality for the sake of fun/balance. The Mastiff shotgun in that game even changes it's wide line spread spread to a consistent circle when ADSing just like in your vid!

[@Jetiko27]

Love the Mastiff, but could never get into the EVA8.

[@gokufromfortnite5600]

@@Jetiko27 Eva 8 shreds

[@endurgai]

cold war

[@Sillypenguinfake]

​@@Jetiko27I had the opposite situation where I couldn't get into the mastiff but loved the EVA8

[@damiankrause6622]

"balanced" *spitfire LMG would like to join the chat*

[@angel89775]

I feel like both shotguns and snipers were introduced as a way to teach fundamental lessons. shotguns were designed to teach players to treat every corner like theres a bad guy around it, and snipers were made to teach how to respect a sightline, as well as both of them forcing a player to learn how to solve a problem in another way, rather than just running at it. with the oneshot mechanic weighing on a player's mind, it will subconsciously make them play safer, and smarter.

[@Vv_JASPER_vV]

Players not being able to run at the problem, being forced to think--not very popular with gamers these days...

[@lawjef]

What fundamental lessons are taught by using a riot shield? It’s a trick question, riot shields are a waste of everyone’s time.

[@ahmettmi7432]

@lawjef flanking, the most important tactic of warfare

[@ZestyAlone]

Nah they just asked what guns they could add in and came up with shotguns and sniper don't think there was ever a masterplan involved

[@MGSLurmey]

@@ahmettmi7432 Precisely this. Flanking, and by extension, teamwork. You can't outflank a good shield player by yourself as they can just turn to keep facing you. Your buddy, on the other hand, presents a real issue for the shield player as they can't defend two directions at once.

[@19-phamtrungquan]

As a wrong player, I can confirm this is true

[@LiberatedSpirit1]

lol

[@someguy3763]

I love how Ultrakill “solved” the issue of balancing shotguns at longer ranges by letting you punch a single bullet from the spread to essentially create a highly explosive missile that always lands wherever your cursor is.

[@jetnyan2348]

i love how that was originally a bug but hakita decided "its a feature now and it also gives you tons of style so bye hard damage"

[@helloagain.andagain.andagain]

Machine, I am not going to sugarcoat it 2 + M1 + F.

[@juanmanuelfariasmarroncell2514]

Bro, that's like having a problem like... a table that has a slightly shorter leg. And solve it fucking mining 2 kilometers down and then installing a spaceship propulsor in the short leg, but leave it with just enough power to not fly out of the atmosphere, but only to lift it the 3 millimeters the leg is off.

[@Jazz-dh2ds]

@@juanmanuelfariasmarroncell2514 Gotta rewrite that, that was a tough read but I get you. Could've made a better metaphor but whateves

[@patrickfrost9405]

@@juanmanuelfariasmarroncell2514 It's like having your son die but you're a scientist and you download his soul into a tomagachi and give the tomagachi to his brother.

[@ahoy1014]

Another solution to the pellet spread without making it non-random is how Fatshark did in in Darktide: shotguns have a Minimum Pellet Count, which means that if a shotgun is fired, if fewer pellet than the MPC value connect, the damage inflicted on the enemy is increased to match the MPC. The MPC subsequently increases in value when aimed down sights.

[@ayaderg]

another good way is to put them on a bell curve instead of being evenly distributed, and you could also do several layers where several pellets are guaranteed to be within that range, that way you always know vaguely where you will hit, but the farther out you go, the less leeway you have with it

[@migueeeelet]

@@ayaderg Yeah but the issue turns into how you code that. Someone talked about a game where 5 out of 8 pellets shoot in a tight ring while the remaining 3 shoot in a wider ring, that'd be a good approach

[@Krystalchan2009]

3:40 Gun Nerd time; the Spas 12 is made for BOTH semi auto and pump action operation. And this is why various games tend to pick one or the other. This is because the semi-auto fire mode is made for traditional rounds, such as pellets and slugs. While on the otherside, the pump action is for low pressure shells or specialty shells such as the flash shells, beanbags and even dragons breath.

[@tranngockha6562]

That is so cool to know. Thanks mate.

[@PhoniexStudio]

And in games, usually speaking, the semi auto version deals less damage (balanced by faster fire rate) and the pump action version deals more damage (balanced by slower fire rate)

[@ssjbread2803]

​@@PhoniexStudio and then there's half life...who mistakes the magazine tube as an extra barrel

[@stoneraptor6219]

I finally get to understand it

[@notNajimi]

@@ssjbread2803at least the tube is actually there irl, the mp7’s “grenade launcher” second barrel is just some shit they made up. The mp7 from that game is such an abomination 😭

[@EsmerayFrost]

that launch at 11:30 was glorious - full backflip and everything

[@MGMac_]

I don't even play shooters and I like watching these videos

[@Adster2008]

Same bro same

[@coreydorce8246]

I play shooters and I like watching these videos

[@Bean_guy2]

@@coreydorce8246 ok

[@cruze_the]

Yeah man I play brawlhalla

[@iamishin7675]

You can't have a 1-shot for the shotgun rely on headshots, because you are only realistically going to get that "1 or 2 pellet headshot hit" at medium range. A shotgun at point-blank range should be able to one-shot to the body, but under this scenario this would never be the case. It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots, which would throw off the close-medium-longe range curve.

[@Kwotzi]

This is exactly what I was thinking. For the shotgun to do enough damage for 1-2 pellets to headshot, the damage would also be high enough for it to still one shot body shot anyways since the body is a bigger target and more pellets are likely to hit it. Making the shotgun effectively one shot at anything but long-range still.

[@CoralCopperHead]

"It might be that the shotgun would become more effective at medium range than close range due to the pellet spread occasionally hitting headshots..." That's pretty much how it works in Payday 2. The game doesn't divide the damage total across all pellets, instead a hit is a hit that deals full damage, regardless of whether it was just one pellet or a full meatshot -- however, the game uses the headshot multiplier, again, even if only a single pellet hits the enemy's head. Actually had a newer player ask what shotgun I was using back when I first picked it up (the trusty Loco, for the record), they were surprised I was using it effectively to fight across the street. Not from sidewalk to sidewalk, either, I was fighting from the china shop in Four Stores and shooting down enemies in the tech store on the other side of the road. Spitting distance for a real shotgun, sure, but fukken video games. (I still remember my utter disbelief when my roommate and I confirmed, in splitscreen, that the pellets from CoD's shotguns _literally disappear after seven meters._ To this day, I'm annoyed that it didn't piss me off, but I was just too stunned to believe what we'd proven.)

[@daegan_ftw]

@@Kwotzi Give headshot damage multiplier a drop-off curve over distance; you need all the pellets to hit to get a headshot kill from long range (basically impossible) or only two thirds at medium range and 1/3 at close range and body shot one hit kills at point blank.

[@Imaperson1020]

@daegan_ftw That increases frustration as it's extremely easy to one shot, which comes around to the issue at the start. If you only need 1 pellet to one shot, then you can one ahit by aiming at the upper torso or neck, so you at least need some kind of skill to get consistent close range one taps.

[@keyboardstalker4784]

@@CoralCopperHead Is it really true COD's shotguns literally don't do damage past 7 meters? Which COD did you test it in?

[@dominik9506]

It's just nice to see that some content creators really care about quality. Continue with these masterpieces

[@Rubblemover]

Omg I loved that little smile your avatar did during the intro sequence. That's how you know quality video editing right there

[@Rubblemover]

Also really good flow of a script! I love finding video documentaries like this where I won't even be too interested in the topic, but just the character of content created is so amazing!

[@catcatcatcatcatcatcatcatcatca]

Team Fortress 2 managed to have extremely well balanced shotguns by simply not having an assault rifle. Not having any such hitscan weapon that excels at mid range and high base-hp compared to damage on midrange meant that shotguns had a very comfortable spot to fill. I wish more games just didn’t have assault rifles. It’s a perfectly valid choice and naturally opens up a lot of ways to build dynamics and counterplay.

[@evilded2]

Yes.

[@ssjbread2803]

I completely agree, but at the same time given how many FPS games are Generic Military Shooter #361927917™, that's kind of an issue. Granted, if your game isn't a military shooter, this isn't a problem, but even if it is, there's still a weapon you can remove to give shotguns a comfortable niche - the SMG. In real life, they have an equivalent effective range, and in shooters they're constantly stepping on one another's toes as the designated CQC weapons. This can allow shotguns to fill that close-to-medium niche that, in other games, get dominated by the SMG, and it means that having a one-shot kill at point-blank is no longer top priority. Instead, their capabilities at range can actually be expanded upon a bit, with a two shot kill at close ranges and a 3 shot kill or so at medium ranges seeming pretty fair to me. In addition, if you plan on using multiple shotguns, you could have this trait taken by semiauto shotguns, while keeping the "traditional point blank OTK" role of the pump shotgun. Slugs could be balanced by having better shot accuracy, damage, and range, but being overall a fair bit slower and with a LOT more recoil, which would not only keep balance but also reflect real life.

[@aSmallGreenDot]

I'm probably biased as a tf2 player but I find sniper rifles way more frustrating to play against than shotguns

[@happyjohn354]

@@ssjbread2803 Evil with military shooters shotguns are fine if you give them realistic range and spread. You can absolutely wreck people shit at 60 meters with 00 buck. One of the only games I know that does this well are Insurgency Sandstorm and Enlisted.

[@plantain.1739]

@@happyjohn354 I've always found it weird how many games market themselves as realistic, and yet have basically the TF2 shotgun with hyper realistic smgs. I guess most gun companies only really give a shit about service rifles, and demand they get special treatment.

[@zeropoint5794]

A pro tip to normalize stickgun's damage output at medium range: The Normal Distribution! Instead of dropping pellets at random inside a circle, use the bell curve to guide your randomness, now you get more pellets in the middle and less on edges, both making the damage more consistent and rewarding the player more for pointing the stickgun directly at the target

[@jamesphillips2285]

Normal distribution can still be random. You are referring to the shape of the probability distribution.

[@zeropoint5794]

@@jamesphillips2285 yea thats why i mentioned using the bell curve to guide randomness. It's still random and can lead to major flukes, but overall it's going to be way more reliable

[@spacecatsftw]

@@zeropoint5794also make sure at least one pellet always lands in the center of the crosshair!

[@StarComet7]

Pattern and some randomness is better imo

[@HazardThe2st]

I still think its just best to have the pellets fire in a set circle pattern as it has no randomness, unless you count the spread changing size depending on whether youre crouching, prone, standing, moving, etcetera

[@jgjg5182]

At 4:00 you show a simple animation of a Spas-12 and it is incorrect. The animation shows a direct blowback operation, whereas the Spas-12 is short stroke gas operated, which means when a shell is fired it vents some of the expanding gas from the barrel into a piston, which then pushes the bolt backwards, cycling the action. It is an important distinction

[@ayaderg]

important for real life, but not for video games, where the only defining factor is what values the developer uses to program them

[@leifwulffstephan3725]

Nerd Jk I also love firearms

[@Two-BallTyrone]

sounds like a whole lotta hoopla

[@SlerpyDerrpyBlue]

Thanks Einstein. Relax it was a joke.

[@Reactivity760]

This sh-t sounds so good

[@stillton1]

This is purely a shower thought but: One part of shotguns that I feel a lot of games get wrong is they include both the bloom, or simulated handling, and spread of the bullets together. I believe a more realistic approach is to separate them into two different circular fields. The outer is supposed to simulate the handling of the weapon by the main character and the inner is the spread of the shells. The inner circle is required to be fully inside the outer circle and the pellets can only be inside the inner circle. The outer circle would tighten or simply disappear when aiming down the sights meaning ADS is most likely needed to even hit opponents at medium to long ranges. For different types of shells and barrel modifications the inner circle will be our variable. While using slugs, the inner circle would be incredibly tight, allowing for greater prowess at longer ranges at the trade-off of being a huge gamble while hip-firing at anything but almost point-blank. Chokes and other barrel mods will change the inner circle based on the mod. A duckbill mod will change the circle to ellipse or a line with the orientation of the mod changing how pellets will fire. A choke will simply tighten the inner circle and a sawing off the barrel will increase the size of the inner circle. For stock and grips the outer circle will be our variable. These would mostly be the same with shotguns being able to take one of each kind. Shotguns with grips and stocks would have better simulated handling and usually lower recoil at the trade-off of being less effective in close-quarters combat, but not by much. Modded shotguns would generally be better for long-range combat and less effective in close quarters combat, rewarding accuracy. The biggest problem I can see with this is the deviation from the nature of shotguns as the close-range weapons that suffers at long ranges, but I believe that some games would benefit from having a more realistic system in place, especially games that try already to appeal to that hyper-realistic gun feel.

[@naominekomimi]

I feel like limited versatility isn't necessarily a bad thing. It changes the way you play and makes the game feel very different, having to build around mobility and learn the areas of the map with ranges that favor you vs areas where you'll be outranged consistently.

[@sourlab]

I love how their used in re games specifically re8 and re4 they feel like a power weapon when im feeling claustrophobic scared put that thing out and BAM it always looks and works amazing

[@grzegorzbrzeczyszczykiewic563]

Also, low versatility means that mastering it can be more satisfying, seeing as, in order for the weapon to be viable, the one who has to become highly adaptable and responsive is you. This ideally means the shotgun would have a rock bottom skill floor (shoot at the dude at close range and you're officially 1/0) and a sky high skill ceiling (you can never rely that your gun will get you out of a sticky situation, so every situation is higher stakes than usual).

[@BlazeMakesGames]

The fixed spread idea is really interesting and could also be used for some very subtle ways to balance the weapon at longer ranges. For example if you made the spread a circle pattern, you could balance the exact range of the weapon by the size of that circle compared to the angular size of a target's head. In theory up to a certain range, a good enough player could have all of the pellets hit the target's head, so that even if the gun could normally max out at 50 damage, it would still kill in one shot because every pellet would get doubled from the headshot damage. But then if you were shooting at someone farther away, even if the damage wasn't reduced any more, it would be impossible to fit all of the pellets inside the target's head, and thus be impossible to get a one-shot kill. And of course at even further ranges it would be impossible to fit all the pellets even just on the target's body as a whole. Thus, this could be a way to balance the weapon without needing to reduce its damage completely at long ranges, because the fixed-spread would make it impossible to hit with all of the pellets anyways. You could even theoretically take into account the maximum amount of pellets you could fit into a headshot or bodyshot at different ranges to fine tune the details. On top of that, that could introduce good side effect where the shotgun becomes good at fighting multiple enemies at long range, even if it's not good at fighting a single enemy. Because if say the sum total of all pellets still does 50 damage at long range, even if it's impossible to hit a single target with all the pellets, if you're fighting a group of enemies in say a more team-focused environment, you could more reliably distribute that damage over the group, which could either help soften them up for an ally to finish them off, or at least make it easier to fight them when they get closer, since you could probably shave off that 10 damage you need to one-shot them with short range bodyshots.

[@doomspud6302]

I've played a couple games that do that, and it usually works well. The most recent one was Aliens: Fireteam Elite. All the shotguns in it fire a pattern that looks random, but is actually always the exact same. Which is nice, because it makes them more predictable when surrounded by Xenomorphs. The other is Borderlands 2. Several of the unique shotguns have special spread patterns. Like a pirate shotgun that makes a skull and crossbones. I haven't played any PVP games that do this, though.

[@armadis4168]

​@@doomspud6302 competitive tf2 has fixed spread

[@jblazerndrowzy]

⁠​⁠​⁠​⁠​⁠@@doomspud6302 There are many pvp games, especially recent ones, that have fixed spread like TF2, Fortnite, Apex, etc.

[@lunasagaming5801]

@@doomspud6302 The Panic Attack in tf2 has a wide rectangular spread.

[@PrimordialNightmare]

Vermintide 2 and Remnant from the ashes are two games I've played that have crossbows that can shoot multiple bolts at once, though usually in a fixed horizontal line spread pattern, which made them interesting to use and pretty much turned them to low range high damage or mid range anti group weapons. I found them to be fun.

[@j.r.mocksly5996]

I like the solution in the insurgency series and other more realistic shooters: make every gun lethal. When every gun performs at least somewhat realistically, the shotgun becomes more of a style choice that rewards players with good aim since it just isn't as good as a full auto gun. As in insurgency, sure your rifle might take 2, 3 at most shots to kill, but failing to get a kill on a shotgun shot is sure to lose you the fight. The shotguns just feel very satisfying and have a lot of punch behind them and can perform at range, but any full auto gun is just easier to use. It flips the normal shotgun dynamic on its head

[@Nurse_Xochitl]

Realism balances itself out. Players need to stop being stupid and running around like headless chickens. If they did that, then they might find tactical shooters (not CSGO, not R6S - those are arcade shooters) and milsims fun. Besides that, they get to learn how shit works IRL to an extent, which can be valuable knowledge when SHTF.

[@packwolf445]

​@@Nurse_Xochitlusually the people who complain in insurgency when they face a shotgun are the guys not bothering to throw a nade on OBJ and get a buckshot tearing their arm off

[@Nurse_Xochitl]

@@packwolf445 true

[@yuvalgabay1023]

​@@Nurse_Xochitlor like in many insurgency maps..every camps . camping is the bane of every sims .

[@Nurse_Xochitl]

@@yuvalgabay1023 lol cry about it xD

[@sethplayzminecraft2671]

11:50 "Turn them opaque" he says as they become transparent. Amazing video by the way, great job!

[@Barumar]

The level of detail and analysis provided is truly impressive. I really appreciate how the video dives into the mechanics and characteristics of shotguns, giving viewers a deeper understanding of their effectiveness in gameplay. The visuals and explanations are clear and engaging, making it easy to follow along and learn. Thank you for creating such an informative and enjoyable video!

[@OfficialArch]

My pleasure :)

[@Mahashma]

I think Tarkov has done it best so far. Shell selection is everything. 8mm express buckshot can slap you sideways from 20m but only if it hits somewhere unprotected, while AP-20 can punch through Class 4 body armor at 50m. You can spam a Saiga-12 as fast as you can mag change. And each pellet is modeled individually.

[@lolobuf]

Looks at how rust has done it wayyy better

[@mafiapenguin9878]

​@@lolobufkys

[@GatorDontPlayNoShit69]

@@lolobufno. Just. No.

[@ruipereira4134]

What about into the radius

[@lolobuf]

@@ruipereira4134 50m with slug is easy kill but you can do 1/4 damage at 200m when you shoot buck i dont know

[@pirateFinn]

I think the most interesting "balancing" I've seen recently for shotguns is Ready or Not, because levels of body armour penetration, lethality and whether you even want the spread or you may accidentally shoot a hostage matters. Along with the fact that if you miss, the time spent firing the next may be what spells your doom while being shot. Very interesting game.

[@xostler]

I was in here to talk about shot ballistics and chokes but I just realized it was talking about gaming lol Does RoN have semi auto shotguns?

[@pirateFinn]

@@xostler It has the M4 Benelli as a semi auto option!

[@cameronsloss3829]

RoN definitely high lights disadvantages of pumps but not highlight why people choose to use the two in a tactical setting. With semi auto’s you are restricted to loads you are able to use while a pump action will feed and cycle anything. I had to tinker and work in my gas system so I can use game loads on my 11-87 police which was designed for 2 3/4 heavy loads like slugs and 00buck.

[@aloedg3191]

Haha Doom

[@skyninja979]

I don't usually care when it comes to "first impressions" with KZbin videos, as my "first impression" with this video, was that you were trying to be another "Ahoy". But I was pleasantly surprised to see so much depth in the gaming side of things, rather than the actual history side. And your art/content style is very satisfying to look at! Glad I came across this video! I will definitely be binging more of your stuff!

[@OzixiThrill]

There is one value that's worth considering in basically ALL balance topics - Obtainability. In games like CS, weapons are lost between matches and you only carry them through the rounds if you don't die. And each weapon costs a different amount. This means that they have some leeway at making weapons less balanced, as the fundamental gameplay loop makes getting a stronger weapon more of a gamble than simply just an upgrade.

[@MightyGachiman]

Also you dying with a shotgun hurts less because the enemy can only loot that weapon instead of an awp or an assault rifle.

[@TheFirstCurse1]

That's something that's very specific and niche for shooter games, especially multiplayer ones. In most shooters you can choose whatever you want in your loadout and you have it the whole game.

[@CoralCopperHead]

I'll take your Obtainability and Gambling balance factor, then attach "Map Knowledge" and "In-Map Weapon Spawns" to introduce you to what the Arena Shooter used to be. UDM2 MAP01; the BFG is _right there_ in the pavilion, and the button to lower the lift is easy to access -- but the lift takes long enough to rise that you're a sitting duck in the most wide-open part of the map while going for it. I've picked off people going after the BFG in that map with a freakin' pistol.

[@CoralCopperHead]

@@TheFirstCurse1 "In most (bad) shooters" I fixed it for you.

[@yapflipthegrunt4687]

@@CoralCopperHead based arena shooter enjoyer

[@frederikvoigt132]

It would be extremely cool to see a game where the guns are based on your balancing ideas

[@somedudethatripsplanetinha4221]

The double barrel would be something in of itself

[@BustyCatbot]

Wouldn't be surprised if smaller game devs are taking notes, I know I am

[@acake6654]

i hope the game devs looking for advice actually consider if it fits their game before accepting it, cause this video is full of holes

[@BustyCatbot]

@@acake6654 Literally the end of the video said this advice doesn't fit in every game, and it's a given that you should consider if it fits, no shit. The only thing full of holes is your understanding of the video.

[@acake6654]

​@@BustyCatbot so let me get this straight, he keeps talking about shotguns like its the generalized term with most FPS games out there, but how many even have the highest headshot damage out of all weapons? what about the differences between random bullet spread and fixed spread? what about the games where increasing accuracy or using ADS somehow tightens the spread but for others its a fixed point? why do we have an entire stick section dedicated to explaining how shotguns arent realistic like its rocket science and we forget that videogames are unrealistic..? im sure you wont arrive in the hospital in time if you get shot in the thigh with a rifle. i dont like his video format, as in these, he simply regards a version of a weapon category's balance based on many, many games that couldnt possibly represent any of them.

[@generalpacman6414]

19:48 in Killing Floor 2 the boomstick has an alt fire that fire both barrels bound to middle mouse, so you still have the option to fire one at a time and aim down the sights.

[@TheGreatJon]

This is a really great breakdown for balance, well thought out mate!

[@nikosgalaxygames553]

Warthog auto shotgun from Deep rock galactic is a good example of realistic shotguns in video game, it can hit enemies for good damage at long range but can one shot certain enemies at close and very deadly to most high health enemies, it shoots shells with a good number of pellets to follow which can be upgraded to have more pellets. Overall a good designed shotgun which pumps those bugs full of lead.

[@randomcatdude]

Magnetic Pellet Alignment overclock my beloved

[@giantslayer9335]

ROCK AND STONE

[@HypotheticalBreaking]

Rock..... and.....STOOOOOONE

[@lambchaikies]

Deep Rock Galactics weapons are increadibly well-designed (except for the Subata...) and one thing I'd add here is the Scout's Jury-Rigged Boomstick has an additional role for its shotgun: close range AoE. In addition to having a hitscan bullet spread, it also has a small, invisible, rectangular AoE muzzle-flash that deals 20 explosive damage (just enough to kill swarmers and the jellyfish, or push over a kill threshold on a slasher). It's a clever little addition that does a lot of work, and makes it subtly even more effective at close-range.

[@Alex_Vir]

​@@lambchaikies In which ways is the subata not well designed? Just out of curiousity, I have no clue.

[@_mazarico_]

FEAR's shotgun was legendary! Its only weakness was against armored Replica soldiers past medium range but even then, it still had a fairly accurate pellet spread for a video game shotgun. And within that limited range, it tore enemies and the combat areas to shreds. I never replace it once I pick one up whenever I replay the campaign.

[@XenoSpyro]

Even against armored enemies the VK12 is still good. That's just how bad the AR and SMG were. The 3-burst rifle was really good but there's crap for ammo, and the nailgun overshadows all of them anyway.

[@heideknight9122]

Same

[@hiiambarney4489]

Can't quite remember. Have some fond memories playing Fears multiplayer back in the day though.

[@EJB9]

I think the way the AA12 was done in spec ops: the line was good. It was an end-game weapon only dropped by elite enemies, and it does all those nice things shotguns are good for, but was also properly balanced similarly to an assault rifle, and its super satisfying to use.

[@CJmtb91]

Also one of the best representations of what an AA-12/USAS-12 is actually capable of was the pre-nerf explosive rounds in Battlefield 3, the thing made you a walking assault platform.

[@dustronyt4565]

I found it ironic that, if you put some time in training, the pump action shotguns are the fastest ones. Depicting this in games isn't viable of course, but it's an interesting thing You could do 3 or even more shots per second with a pump action, which isn't possible even for a fastest semi-automatics. Full auto shotguns actually the slowest ones once you put time in training Ye, I'm aware how much of "if you train enough" here, but it's really interesting fact

[@LeoJohnGalt]

@@CJmtb91 My god, core memory unlocked. I'll never forget 64-man Metro pre-nerf. The entire match was nothing but smoke and explosions and even death couldn't give you a break from it. I still remember a medic train reviving me like five times in a row in one of the hallways all the while both teams were using the explosive slugs.

[@LeoJohnGalt]

@@dustronyt4565 From what I can tell, those slamfire shotties actually can unload faster than an AA-12.

[@JK4600Ace_of_Spades]

​@@dustronyt4565the saiga 12k could maybe keep up

[@blitz7488]

I always think of a ww2 trench gun, the backboard blaster type. I love the traditional boomstick that spits a wall of bullets to really reaffirm your personal space.

[@BunkeredGaming]

Really glad that the stick gun is balanced around the AR, it would be super overpowered otherwise.

[@maybebirb]

-Appears on KZbin -Makes the greatest videos on balancing guns in FPS games ever seen with professional quality implying he's been doing this for years -Refuses to elaborate -Vanishes for 2 months I do love Arch

[@ashentwo6608]

I love these kinds of youtubers

[@Frostgiantbutsmall]

​@@ashentwo6608 No drama, no bullshit, no screaming, minimal "nostalgia", just solid, focused presentations. Wish they were more common.

[@AlairrJC]

@@Frostgiantbutsmall I AGREE

[@andrewvirtue5048]

Well he's got my vote now. Subscribbled!

[@sushiiixo]

​@@FrostgiantbutsmallSomething so nice about watching these videos. Just sid down with a meal and relax. ♡ Best kind of content on KZbin.

[@UncleRJ]

The most mind-blowing thing about this video is not once it's shown the DOOM's Super Shotgun, which is arguably the most iconic shotgun in video games.

[@CoralCopperHead]

This entire channel seems to use the standard modern military shooter as the baseline for balancing, which the SSG absolutely shreds. There's a reason we call it "SSG _jousting"_ -- because it's less like a shotgun and more like a *_lance._*

[@dannybrine8718]

The Super Shotgun isn't a gun. It is just pure weaponized "Fuck you"

[@DinnerForkTongue]

@@CoralCopperHead Including the range! Some reach, but not a lot.

[@sportyeight7769]

This video is majoritarily influence by COD/R6 kind of gameplays. It fails to explore the shotgun in other types of games. For exemple: DOOM with the most iconic shotgun, hunt showdown who i think as the best balance between shotguns and other weapons or even TF2 with innovative designs on shotguns.

[@DIEGOLOKO82]

to be fair, when talking about Balanced weapons, DOOM is not a good example

[@famulanrevengeance3044]

Shotgun complaining will never be valid in games with snipers that one shot a close range. They dominate every game, every range, every situation. Especially bodyshot 1 shot snipers. They ruin the flow of the maps, make people hide and camp. It's insane how this one class of weapons truly destroys games but for some reason people are deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in much danger if you play at range or play cover.

[@neerGdyahS]

"They dominate every range, every situation" "deluded into thinking it requires skill, when you can miss 100 times and get lucky once and never be in danger." Okay, go try that and let me know how it works out.

[@famulanrevengeance3044]

@@neerGdyahS Lol I have and it's boring as hell. CoD, Battlefield, CS, Valorant, whatever. Most unskilled, cowardly playstyle there is, not fun for the enemy to deal with and requires the least amount of aim, recoil control and crosshair placement

[@reelgesh51]

That's what I loved about siege No matter the gun - no matter the range (except buckshot shotguns) You could always 1 shot headshot anyone with the skill

[@famulanrevengeance3044]

@@reelgesh51 I don't find instant kills all that entertaining, but atleast in Siege snipers aren't that dominant

[@ender_z4nd3r83]

that's why everyone uses sniper... oh right, people use AR SMGS and LMGs much more than snipers, how is that?

[@Dni-smm-old]

your videos are so good. you just popped out of nowhere and released 5 high quality videos after only a year of content on another channel. i can't imagine how amazing your videos will be in 2025.

[@Dni-smm-old]

I noticed a typo but i recently found out that editing a comment removed a heart so i'm leaving it in

[@jodlaa5142]

yeah this guy reminds me of Ahoy/XboxAhoy who does like in depth videos of some iconic weapons from through history and their role in games, but on this channel it's a bit more oriented on the developer/balance side, which is also pretty interesting to watch and learn of that mindset when it comes to these classic weapon types we're all used to using in most fps games. I wonder @Arch, do you watch @Ahoy and was he an inspiration to you towards these videos? Also, it would be pretty cool to see a potential collab with you two some day.

[@OfficialArch]

BIG shout out to Chris Doerksen for the intro and outro songs! How'd you like them?

[@sloubie]

Færst

[@toaststealer7040]

Can't comment why?

[@toaststealer7040]

I LOVE ARCHHHH

[@CoderDev6545]

this video is pretty good ngl

[@Backfisch5927]

Have a good holiday, and thanks for these amazing videos.

[@yazoink6690]

I like the way Darktide does shotguns. The high reload time makes up for the huge burst damage you can do. Plus, the spreads are actually realistic (ish)

[@Scroolewse]

There's no point in talking about a single player game's shotgun in a video about shotguns in multiplayer. They are completely different beasts. Imagine getting a true-to-Doom Super Shotgun in CoD lmao

[@yazoink6690]

@@Scroolewse ... Darktide IS multiplayer, just like Tarkov. Both are fine with giving their shotguns the range they deserve.

[@Scroolewse]

@@yazoink6690 ok I should have said PvE is different from PvP but I figured you would get my point.. also not really sure what you're bringing up Tarkov for, I never said anything about it.

[@kubaGR8]

Darktide also does minimum pellet counts. If you fire 14 pellets with a Ripper Gun (which has a minimum pellet count of 7), then even if only a single pellet tags an enemy, it will count as 7 pellets hitting instead.

[@quickdraw6893]

Except the shotguns don't actually do all that much damage in that game lol. The slug rounds you can manually load do, but their output as a whole is pretty crap compared to a lot of other guns, even in the burst department.

[@RGIlerio]

A bit late to the conversation, I know, but I just wanted to bring up the fact that shotguns have way more balancing factors than other weapons in games. A few examples include, ammo and pellets per shot. With an assault rifle or SMG, the number of bullets you can have loaded doesn't matter too much, because missing one shot doesn't matter when you fire so many shots at such a rapid pace, but on shotguns, every shot matters. Missing one shot with a shotgun is the difference between life and death, and if you do come out alive, you spend more time vulnerable because you (typically) have to reload each individual shot. This is also why shotguns and snipers are compared so much, because missing a shot has a much higher impact than it does with any other weapon. Pellets on the other hand are usually a unique stat to shotguns, where instead of firing on bullet that deals all the damage, they fire multiple pellets that the damage is spread between. A rifle that does 30 damage per shot is just that, no more explaining needed, but a shotgun that does 30 damage per shot needs more explaining. That could mean 3 pellets that deal 10 damage each, or 10 pellets that deal 3 damage each. Another thing is that shotguns are typically a gimmick weapon, having some additional factor to encourage the player to pick it, typically knockback, whether it be on the enemy, or on the player to use as a pseudo double jump.

[@Desi-qw9fc]

I've always wanted to make a roguelike FPS that revolves entirely around one shotgun, and the point of it is to get better at cycling the gun (like Receiver 2 with a shotgun mod), at modifying it with weights and chokes and stuff, and at mixed-loading different kinds of shells for different situations (like H3VR where you can load different shells in any order).

[@denekhesab.2527]

maybe you should check out shotgun king

[@brodiscool2752]

I don't think shotgun king is an FPS, and no its not close enough to an FPS either.@@denekhesab.2527

[@taffyadam6031]

Mothergunship does something like this

[@MorganGraziano]

make please, please make!!! c:

[@zerrierslizer1]

i'll support you with Audio Design if you wanna go for it. i have equipment to Record, Edit and fine tune all Audio for whatever is needed.

[@doughboywhine]

I think part of the reason the Mossberg is so iconic also stems from the fact that most pump actions are fairly similar, and have not changed much since being designed over a century ago

[@AeroQC]

15:40 Fixed pellet pattern is specifically why I loved the Blockhead shotgun in Borderlands 2, would be cool if some games opted in to this mechanic more often.

[@kindabober]

Well, Apex is still there, all the shotgun patterns are fixed to some extent (except Mosambique without ADSing)

[@screamingcactus1753]

Most popular community servers in Team Fortress 2 use fixed weapon spread, and even if you're not playing on those, the panic attack, a shotgun alt that any class that has the stock shotgun can use, also has a fixed firing pattern

[@TheReZisTLust]

*laughs while catchin a ride on The Wave of flesh and blood*

[@SusSpooder]

Most shotguns (if not all) do this in Mass Effect to great effect.

[@7tales311]

@@screamingcactus1753 yeah, it seriously makes shotguns have a different but surprisingly nicer feel. Sure you dont get random lucky meatshots, but when you get used to a fixed pattern shotgun it feels fair.

[@choty7066]

You almost perfectly describe the model 1887 from The Finals here. It cannot one shot, no headshot bonus, has tight spread and is good up to mid range, spread pattern is always exact (no randomeness) as well as a very long reload time. It also has a super satisfying *POP* 👍

[@Ozzykan]

I agree I thought it was odd at first that it did not get a headshot bonus at all (none of the shotguns do in the finals except i think the slug) although there is no benefit to ADS and in most cases its detrimental since it slows down your rotation speed. Bad habit i had to unlearn from Destiny was ADS all the time since that game makes many guns very inaccurate when hip-firing.

[@kookbook4399]

wait this isnt ahoy

[@nexus8824]

honestly, i still love this type of video.

[@Clazzette]

this comment made me realize that

[@ChristopherMB87]

Waiting for the crossover

[@yourcanadianbuddy3024]

That's exactly what I thought when I clicked on the video

[@MaxKulik]

Walmart Version

[@eye9359]

This is a really interesting and I think a well informed process of trying to balance shotguns. I guess the next step is to implement these ideas into different games to understand what works, what doesn't and how there can be a fix for these issues in the specific game. It'd be pretty interesting seeing all of these ideas combined into a video too.

[@danielhale1]

This is about multiplayer, but in single player the game feel and ammo economy can matter a lot. I grew up on games like Quake and Half Life where the shotgun was a staple, if not frightening, short-range weapon you loved to use when you had the shells and could justify using them (close range against foes that needed firm negotiation).

[@hikermrsblood1]

0:05 shotguns are actually pretty good for learning how guns work irl (due to it just yeeting pellets and not worrying about accuracy) so a shotgun being used to let “youngins” learn the basics of firearms would be accurate as “baby’s first gun”

[@Hyperlaser_Merc]

While also having a decently high skill floor to master it. (In some games)

[@hikermrsblood1]

@@Hyperlaser_Merc meh, good point I guess

[@Z3R0NU11]

In real life shotguns are some of the hardest to master. Good luck shooting half the ammo you do from any other gun without your hands cramping

[@hikermrsblood1]

@@Z3R0NU11 I meant it in terms of teaching folks gun safety and basic gun knowledge, also DANG this comment is old

[@Checkpoint_King]

@@Z3R0NU11semi auto shotguns have entered the chat. Drum fed high capacity semi auto shotguns like the Daewoo USAS 12 or the more modern AA12 have entered the chat.

[@AdamSchadow]

This is certainly one of the best videos about shotguns in games. I would say you got the shotgun categories a bit wrong. There are actually only 3 options: 1. Double barrel so two shots quickly in a row with long reload either needs one or two shots to kill. 2. Pump action this one has plenty ammo but fires so slowly that it needs to oneshot unless your game has some absurd time to kills or is ok with the animations being comically fast. 3. Auto it does not matter if its semi or full in most cases since shotguns dont fire fast enough and also dont require pin point precision where it being semi would be a significant downside. These again either two shot and fire fast or oneshot but at much lower ranges than the pumps to be balanced. To reduce the randomness you dont need to force a fixed pattern you just need to make the shotgun fire enough pellets since the more pellets it fires the more balanced out the spread will be. The peaking strategy is only really a problem if you kill each other slowly or you move incredibly quickly so you can just bring that down or even simpler just make the normal peeking slow but make it so that if you run and jump around a corner you peek much faster but wont be able to go back very quickly. (ofc this is all relative to the time to kill of guns) Headshot damage on shotguns is not the best thing because it increases the randomness and makes them disproportionally weaker at range where you cant force the pellets to go towards the head.

[@ElNeroDiablo]

I mean, look at DOOM II's Super Shotgun from back in 1994 - double barrel, more powerful than the Regular Shotgun, but fires both barrels each time and has a reload animation for cooldown after firing. It'll make mincemeat out of most mobs you come across short of the Boss Fight mobs, but also makes you keep in mind your ammo count to decide if you should use it on a room full of trash mobs or save your Shells for use in a boss fight. If you wanted to spit out a lot of firepower to clear a room, you had the Chaingun and Plasma Rifle as fast-firing alternatives to spray-n-pray with.

[@syphia9841]

I think an important part of shotgun balance is not just range or map design, but instead accounting for how a fight starts. Players aren't dropped into a fight knowing where everyone is, they have to find each other first and someone has to shoot first. In the case of shotguns, they allow a player who knows the map and can predict other players to outplay them, by using better positioning. In this way shotguns can be fair and skillful even when they easily kill in one shot, because getting close enough without being detected requires its own skill and game knowledge, even if it's not mechanical skill (i.e. aiming accuracy). A player can counter the shotguns by maintaining situational awareness and avoiding corners or flushing out buildings where shotgun users are likely to come from.

[@mediumplayer1]

Exactly! All of the shotguns in Counter-Strike can kill in one hit without a need to headshot. Even the semi-automatic one. And all of the kills made by shotgun net you a triple kill reward (900$ with 300$ being the default). Because it is indeed hard to approach the enemy facing you, without being seen or killed yourself. Plus, there is one thing this video never mentioned - beyond a certain, extremely close distance it becomes quite hard to hit a moving enemy.

[@CoralCopperHead]

@@mediumplayer1 It's not hard at all to land shots on moving targets in games that use hitscan weaponry like... oh, look at that, *_Counter-Strike._*

[@Goodroosters]

So in Fistful of Frags the double barrel shotgun used to be able to fire both shots at once. In that particular game, it was so insanely overpowered that it had to be patched out. There's definitely some differences since FoF is balanced around 6 shots and has very special rules, but I think it could be a problem in other genres too

[@civotamuaz5781]

I just heard about this game from you boy, gonna try it right away

[@DORMRR]

3:00 bro predicted all the Xdefiant shotguns

[@thesysop4998]

5:12 Genuinely surprised me to find a ravenfield clip in this video I've played that game for like a year-ish now and never realized how many people knew about it

[@pyroplays599]

Same here, I've got up to 1000+ hours on it 😅

[@Jessie_Helms]

I _LOVE_ seeing more Ahoy-esque editing styles. It’s a beautiful editing style and I wish more people used it. Heck, it’s deeply inspired my work too. Good video, you’ve got a new sub

[@TheGmodkilla]

I like the idea of Slugs as a minor gadget for shotguns. Slight ammo cap nerf but you grab a few slugs for unique situations that require a reload to set.

[@brycemedvin8765]

Sure, as long as we limit armor-piercing rounds as well.

[@feywinterfox9630]

christ, you blew my mind on the shells alone! I had no idea they had that kind of range!

[@swaws1577]

You should have gone over Tarkov's implementation of shotguns and their ammunition, they did a very good job at accurately representing them.

[@SpaceMissile]

tarkov is king.

[@nanksm4583]

This!

[@CaptainRasco]

yup, and it makes it so that only the best rounds (and flechettes IRL are dogshit) can actually kill a player when you're aiming for armored vitals, because buckshot plinks off of armored plates. well done, makes shotguns actually fun to use when you kneecap people

[@swaws1577]

@@CaptainRasco very true! the only inaccuracy as of now is that buckshot fires in a spread and if someone is wearing armor plates and gets unlucky a pellet could still miss a plate and do a lot of damage, wheres in game armor that covers an area covers all of fhat area, not just where the armor is on the body. Once they add true armor hitboxes (which is soon) i think it will be one of the best implementations of shotguns in any game, if it isn't already.

[@lil_lion69]

These animations are so great. Simple, colorful and most importantly informational. Seeing a behind the scenes would be so cool.

[@sourlab]

Behind the scences will be a team editing on a computer 💀

[@thewoodpeckers655]

Everybody gangsta till Arch posts. Then everybody’s even more gangsta.

[@MarcelEnglmaier_1]

Ready or Not is the only gun that did shotguns justice. 0.2 splits, high recoil, but it destroys “over there”. No gun comes close to a shotgun’s power but its way harder to control after a single shot

[@flameninja_]

I absolutely love your videos man. The editing and art is amazing and I hope you continue to grow here on KZbin. I understand that you don't normally do analysis videos like this but I really like this content from you.

[@eddebrock]

Very often the main culprit is the maps. Because for some reason level designers like to use what I call "cunt-design". It's where they design maps to not have good angles or long LOS. Which is basically the how-to for making shotgun maps. The other problem is that as soon as you go indoors, you're in the shotgun's house!

[@ububububububububub1667]

that's true

[@kaden-sd6vb]

The other main issue is the majority of fps games being what I call "instakill shooters" where time-to-kill is unbelievably low(well under half a second), no matter the gun. This understandably makes balancing strange, if not impossible. I do not like instakill shooters.

[@amistrophy]

​@@kaden-sd6vb it can be made more balamced by changing the recoil, ergonomics, and control characteristics of the guns. Which are soft damage modification features. Good game for this would be deadline on roblox, but it's a milsim like insurgency/tarkov blend. Very innovative gunplay though. Best I've ever had.

[@TacticalBaguette]

@@kaden-sd6vb Insurgency does a good job at balancing this by having maps that have a good mix of engagement ranges. All of the guns may be able to kill in under 3 shots, but even with more realistic range capabilities, an SMG can't reach out far enough to take care of something a sniper can, unlike for example COD where everything is balanced around the small map size. Insurgency also has a point system for loadouts, so choosing a capable gun and kitting it out can cost you armor, carrying capacity, grenades and other useful equipment.

[@Escruonn]

​@kaden-sd6vb Back in my day, we called that insta-gib.

[@atcubaking1]

As someone who's spent a lot of time around firearms as of recently, I can say that most people greatly overestimate the amount of spread that 00 Buck will have, and the amount of felt recoil when compared to their non-shotgun counterparts. I'd honestly take a slightly different approach to balancing shotguns. Start with the break action and make the spread super tight but have the icon for it bounce around while in hipfire, so the player knows where it is but cannot easily predict unless they slow down before firing, and so they have to aim the break action at close range to ensure that they don't completely miss (to mitigate poking). From there progress to pump -> semi -> full auto. As you move along the list, increase the pellet spread (in both ads and hipfire) and decrease the recoil to compensate. Ideally the randomness introduced by the increased spread is compensated by the fire rate, and the recoil goes down slightly across these weapon types because of more components and therefore a heavier gun to help better place these wider groups. As it turns out, most semiautomatic or full auto shotguns tend to have wider groups as a design choice, so it better reflects real life.

[@devilinwilliam4121]

The quality of ur videos are just muah. Top level.

[@excuses6016]

How in the world is this channel not more popular then it is? This is literally some of the highest quality most entertaining content I’ve ever watched

[@isaacmacqueen9695]

My favorite shotguns are from insurgency sandstorm for somewhat realism and decent range. But I love the way cyberpunk shotguns blow heads apart. And MW2019 has the best animations for any shotgun. A game that would combine the 3 into one would be amazing. Cod or even Halo would really benefit from someone like you on the balance team great video you earned yourself a subscriber

[@puppypunter8316]

YES. i LOVE insurgency shotguns, they feel so good to hipfire

[@isaacmacqueen9695]

@@puppypunter8316 i think everything feels good to hipfire in that game lol

[@getthegoons]

MW2022 had some of the coolest Shotgun customization ever. It really should be the standard. Too bad literally everything else about that game sucks ass

[@puppypunter8316]

ok now im interested@@getthegoons

[@MTF-EPSILON-11-5-NULL]

@@isaacmacqueen9695pov realistic guns

[@northropi2027]

One thing I feel kinda got overlooked that could work in the favor of the slower shotguns is all the special ammo types left out for simplicity. The reason the SPAS-12 has a pump-action mode is because that mode doesn't need to use pressure from the shell to work- which allows it to use shells that offer too little or too much pressure to cycle the action on their own. Specialty shells like batons, smoke, and flashbangs- and possibly a very generous portrayal of Dragon's Breath and more fantastical options like defense-reducing acid shells and so on- would not be able to be fired semi-automatically or fully-automatically. They'd be all but precluded on the AA-12 (IRL, you could in theory manually pull the bolt back every shot, but this would be really impractical if it was your main weapon, so we won't do it for the game), and the SPAS-12 would have to accept descending to a pump-mode to use it. You could further balance out the SPAS-12 by just a little by reflecting the factors that made it historically a little unpopular- its pump mode is really hard to use because of all the extra parts in it, which also make it heavy, hard to reload even by shotgun standards, etc. A pump shotgun could, say, put out an acid shell to boost its effective damage on a reasonably quick followup shot, or a flashbang to make a window for said followup shot, whereas a hybrid semi-auto/pump like the SPAS would be able to do the same with more DPS in a followup barrage at the expense of a longer, highly exploitable window between the opener and the finisher and a really, really slow reload if you manage to miss? And then we'd have a dedicated semi-auto (Benelli M4, Browning Auto 5) without the potential frills of a pump but somewhat better flat DPS and much handier than the SPAS, and the Full-Auto about where it was before. You could even gate slugs to pumps (and also break-actions) as a special ammo type, as a lot of them have *too much* pressure for many semi-auto shotgun platforms to cycle, fitting them into the dynamic of giving manual cycling the option for "special" attacks- I feel like this *could* be better than having a dedicated "Slugger" weapon, though the semi-auto I-Hate-Walls-Niche could be filled by the M82/M107/any of those funny big-bore AR like .50 Beowulf/.458 SOCOM if you'd like. Also, while well out of the purview of the typical team shooter format, an RPG setting could also make a lot of use of pump-actions being friendlier to Less-Lethal/Less-Than-Lethal rounds than most firearms, with the aforementioned baton (and often rock salt) shells presenting options for non-lethal takedowns and whatever story implications could come with those.

[@kirbyjoe7484]

This brings back fond memories of the KSG back in Black Ops II. You had to play when your ping was low and the net code was running smooth as butter, but if you got into the zone with it the results were hilarious. The trick was that it fired a slug and you could one-hit kill with headshots at ridiculous distances which is no easy feat since it had nothing but iron sights and just a single projectile. I got accused of cheating repeatedly when the servers were running well. People just had no clue how a shotgun was one-hitting them at like 50 meters. Although 50 meters doesn't sound like that far, it is insane compared to the standard 870 which had a max range of about 12 meters and an effective range of about 6. I used to love dual-wielding pistols in that game as well. I can't remember the last time I have used and enjoyed pistols in a CoD game other than BO2. Usually, they are just such trash.

[@MurlocScout431]

you are talking to yourself

[@Gatorade69]

The MW2 reboot actually had great pistols. The deagle could consistently 1 shot headshot if your aim was good. Probably the most fun I had using pistols in a game.

[@notNajimi]

@@MurlocScout431also known as leaving a comment

[@J2K9ine]

You achieved what every video essay-ist should strive for! You took a subject that I the viewer am not particularly invested in, and made a video so well written and produced that I BECAME invested in your vid!

[@HerMajestyVelvet]

I really want to see a mode in a fps where one player is a juggernaut with a shotgun and sniper going against 10 or so other players armed with weak pistols and items like poison gas, kinda like dead by daylight but the goal is to kill the big guy instead of avoiding him

[@tonyth9240]

I'm pretty sure that mode exists in some games, with a juggernaut, though he usually has a minigun, and the players AR's.

[@R3TR0J4N]

@@tonyth9240 yea, bet someone along the way of custom maps made one

[@octakhan4673]

The fat-kid gametype.

[@TJdaberry]

There’s nothing I love more then a great shotty, one of my favorite eras of warzone was when the duel wield fire shotguns were meta lol.

[@Raansu]

Just means you can't aim.

[@salty1201]

8:13 or make the gauge different! 20 gauge for auto (less damage) 12 gauge for pump/semi as an all rounder shot, and finally 10 gauge or lower for double barrels. I should mention that 10 gauge fucking hurts, anything lower starts to enter man portable cannon territory.

[@DogeickBateman]

When Arch said "I am the Boomstick" and turned into a 12-gauge I knew this was the analysis of all time

[@aloedg3191]

Oh yeah

[@R3TR0J4N]

i lol'd

[@drummar_boy]

There's an exotic shotgun in Destiny 2 called Duality (people who play D2 probably see where I'm going with this), and it has a perk very similar to what you proposed around 15:36. However, the difference is when ADS, it turns into a slug shotgun, as opposed to a pellet spread when firing from the hip. It's not the most used shotgun in PvP (Conditional Finality is still dominant at time of writing), but I like the predictability and versatility of it. It really rewards actually being accurate with shots at medium range.

[@Angelzvx]

Duality’s versatility has got to be its best trait. It’s Break action reload is even great with On Black Wings only making it better. Probably the best Dual Function weapons compared to most of the others in terms of pick up and play and easy access to both functions. Skyburner’s Oath, Revision Zero, Vex Mythoclast. Kinessa’s Sniper Rifle in Paladins and the Widow’s Kiss in Overwatch also come to mind with that dual functionality between hip fire and ADS.

[@BumbleBea05]

destiny 2 mentioned

[@JoelHernandez-tz3vk]

Argus, anyone?

[@ender_z4nd3r83]

black ops 3 did it first with the argus (and probably some game did it before black ops 3)

[@RequiemL34]

​@@Angelzvx literally my shotgun, and I may have never proc on black wings like a was just reloading sometimes the first week in season of the hunt, then always transversives, and now that holster mods exist it won't be reloaded ever again.

[@ChristochatBTW]

I like what they did with the sawed off in the finals, you can one tap any class with both shells, and even one shot light with one shell, but you need to literally hit all of your pellets with heavy to do so, oh and there is no headshot multiplier so just go for center of mass

[@tagg218]

For slugs instead of making holes, I would just give them full wall penetration (only thru a single wall though). Keep the power and the other stats the same, but make the trade off your spread is 0 at all times, but shooting at medium and long range becomes an RPGfest to make up for the incredibly strong ability to penetrate thin cover

[@kuso_yaro_]

This channel surely deserve more love and views. The animation are smoot af and the script well written

[@laboon344]

is smooth*

[@MoterX]

dude i have never EVER had a problem with the tf2 shotgun, imo it's the best shotgun in all video games ever

[@DzekoZacher]

the only class has a shotgun but isn't intended to use still really kick ass with it lol, the shotgun's damage in tf2 is really low to compared to most if not all the other fps games, in exchange of sustainability and reliable damage, just... the only real problem is random crit but random crit is a problem to all other weapons anyway

[@logicproblems3654]

Valve meat rider

[@Mate_Antal_Zoltan]

incorrect the MAG-7 in CS:GO is better

[@DzekoZacher]

out of all games i doubt CS:GO has a good shotgun design

[@MoterX]

@@logicproblems3654 bro valve is just a good game company

[@rem8183]

When you talked about random spread pellets it reminded me about how the Panic Attack evolved into how it functions today in TF2.

[@droman608]

The balancing you refer to makes the shotguns more in line with semi auto rifles. Every weapon has a characteristic that makes it unique. Any alteration to one or more of these through accessories, could change a simple break action into a sawn off, to fire faster, to reduce the recoil and even making special shells. No ranged weapon can breach like a shotty.