The Case of Mark Twitchell | HasanAbi reacts to Filmmaker Directing His Own Confession

[@gratianray2]

the worst serial killer meets his match, the worst interrogators

[@jingbot1071]

Thumb war

[@thelonewolfie34]

Canada is just an iron lobby for detectives and criminals

[@bigroncoleman11]

He’s not a serial killer though....

[@deadlykitten3004]

@@bigroncoleman11 he’s a self-proclaimed serial killer

[@Sophia-vk5bq]

@@bigroncoleman11 The garaedj tells a different story eh?

[@dakotaloven1362]

Whenever hasan talks about thumb people I think about the thumb thumbs from spy kids just those dudes that were like 100% thumb for some odd reason

[@cctomcat321]

Someone shared an image of one during one of his thumb comments. Indistinguishable from the real cop's photo.

[@dakotaloven1362]

@@cctomcat321 well yea man most cops are literally thumb thumbs from the movie they weren’t cgi they were hired cops bro you didn’t know that?

[@n1t_]

True Crime is back on the menu. Nice

[@limelightcapital7958]

Been waiting for this tbh

[@ChardeeMacdennis339]

Was just thinking the same!

[@MarshallArtsDesign]

I hope he reacts to the Chandler Halderson case!

[@NecroMancer84]

And I'm here for it!

[@skatenec]

Yummy

[@Jutilaje]

The cop started folding because - as everyone knows - it's been scientifically proven that Canadians can only handle 7 seconds of confrontation at a time before apologizing, but he's trying to suppress the "sorey"

[@flowersinawasteland]

they’re pretty good at gen0c1ding natives for longer than 7 seconds….

[@Jutilaje]

@@flowersinawasteland they just got peer pressured into it by the US.

[@CyberK4]

If that's your view of Canadians, clearly you've never been to Saskatchewan.

[@zachtooill]

I can’t believe the “Garage Technique” failed for the first time since 1916 (when the first garage was invented).

[@camelorcaramel5732]

“This is called the admitting everything technique” *they let him go* it’s very effective.

[@ianianianianian]

Hasan confronting his hypothetical wife Nancy about her thumb uncle really cracked me up. and then the cop said garaedj and that really took it to another level. good shit

[@Cussyzera]

Sorry chatter, your thumb son is going to say garaedj

[@jheisz19]

As a Canadian I saw nothing wrong with the cops pronunciation and now I’m reconsidering my entire life.

[@ianianianianian]

@@jheisz19 I mean, at least you can be sure that you’ll always improve the mood of anyone who hears you say garage! it’s hilarious

[@bacicinvatteneaca]

@@Cussyzera he didn't say that. There was no e. And he didn't pronounce the first a.

[@Jordan-kq3qw]

This dude wrote his confession, walked into the police station and thought, "You know what, changed my mind, I bet I can get away with this murder"

[@TheSneakyDuck]

It's awful to see the authorities ga-radgelighting a suspect.

[@BenjyF563]

I usually use this genre of content to fall asleep (JCS, Matt Orchard and co) and prefer Hasan’s reactions because all the pauses and stuff stretches the already long runtime out so I can just stick it on and check out thank you for the upload :)

[@j.s.7894]

Are we living the same life wtf

[@Goodenough_media]

Lmaoo either Hassan’s true crime reactions or attack on titan nothing else puts me to sleep quite like these🤣🤣

[@chav2002]

@@Goodenough_media aot I feel like I'd be too into the show to fall asleep

[@rikititi1848]

Yess me too!!

[@Goodenough_media]

@@chav2002 even the first season ??? I’ve seen it like 10 times so it’s easy for me to knock out

[@helena4863]

omg is hasan doing true crime reactions again? im so excited, theyre what got me into his stuff, i missed these so much!

[@notbrody6113]

“Reaction”

[@Justhppy2behere]

@@notbrody6113 shut up?? no one cares??

[@argosfe7445]

Innocent or not, if your answer is not "I want to talk to my lawyer", you are making a big mistake.

[@chav2002]

Cops aren't interested in charging the correct person if they can coerce a confession out of an innocent person they'll be ecstatic. You're 100% correct the number one rule of dealing the police is to shut the fuck up

[@stefaniedanchak2526]

Yess

[@ararepotato1420]

No, the proper answer is: "Get me my lawyer." Wanting means you have a desire for your lawyer. You want them to know that this is a demand. Then shut up.

[@jjmitch1411]

Yep. The first things should be “why am I here?” “What charges am I being tried against” and “I will not speak without a lawyer”

[@trashm.1426]

I know this is an old comment but this is terrible advice. Guilty or innocent you get a lawyer and then you shut the f up.

[@storkksoundmedia7778]

My favorite garage is the British one.. “Garriage” *rhymes with marriage

[@Hemogoblin127]

I love hasans crime reactions. I love the long content while doing other stuff

[@jazzyg6298]

These are my favorite videos to watch while doing dishes

[@slowloris2894]

I love when he isnt speaking about how Crimea is justifiably Russian lol. As long as he isnt speaking about the war or the broader left, I love Hasan. However some of the leftists he's been calling nazis(Adam something) or the trans woman (Jay Exci) is kind of disappointing tbh.

[@bacicinvatteneaca]

@@slowloris2894 Adam Something is a nazi

[@londonyes1380]

@@jazzyg6298 Good choice. I watched today while I changed my bedsheets 👍

[@uyentran1234]

same

[@carysfaerie]

Zoned out at the beginning because I was thinking about the sauce the pizza delivery didn’t include..snapped back in the room when hasan said THE SAUCES ARE IN! weird

[@BeTheAeroplane]

In the book he changed "John" to "Jim" and thought he'd get away with it 😂

[@Maxisamo1]

If you played a drinking game to take a shot every time the cop (and only the cop) says "Geraj", you'd be dead halfway through

[@bexkroezen5995]

I’m sorry but “backseat driving his own assault” is the best part of the whole video.

[@Spencer481]

The police had a T ball of a case and still nearly fumbled it at every step.

[@bingusenjoyer197]

fr, the interrogator didn’t even try to sympathize with him to draw the confession out of him or try to lock him into his original story to catch him in a lie, he just went straight to saying “i know you committed the murder, just admit it you pussy!!!” and mocking him in the car like thats gonna do anything. he’s literally just like that other cop from the JCS video that hasan watched that just said “STEVEN!! I KNOW YOU KILLED THAT PRETTY LIL LADY!! STEVEN COME ON MAN!!” except less hilarious to watch and more infuriating

[@ZERO_O7X]

Narrator: "Anyone who was innocent would instantly become confrontational" is the most bullsh!t statement I've ever heard. Some innocent people become immediately enraged when accused, some shut down in disbelief of their situation. I'm so sick of these "armchair psychological interrogation scholars" channels.

[@CChissel]

This may just be me reaching, but I took it to mean confrontational as proclaiming their innocence and taking a stand, aggressively or passively. Confronting the interrogator by saying something like “what evidence do you have.” Or “that’s bullshit, I didn’t do a fucking thing.” But yeah idk.

[@yee2urhaw246]

i think the point is not refuting direct accusations. if you're innocent and accused of something you didnt do, not everyone will fly off at the mouth, but most people would AT LEAST refute it pretty immediately

[@auberry8613]

It completely ignores traumatized/neurodivergent people who may shut down or even become agreeable with the accusations

[@cats1970]

Meanwhile when I feel threatened I try to follow the conversation and hear out enough info as possible so I can find a way out. “I’m 100% convinced you killed that man.” “Yeah.” “People saw you two come in, only you came out.” “Sure.” “You have the exact same Ikea knives as the one used to stab him.” “I do have those yes.” “Since you just confessed, add your signature here please.” “.... ok so I’m gonna need a lawyer since everything you just said was bullshit.” My plan is to just never get suspected bro I’d be done for

[@bobbobsled8843]

Lol isn’t confrontational and enraged the same thing buddy

[@cats1970]

4:19 “tf kinda name is twitchel lmao” completely took me out dude. was just sitting here spacing out and nearly choked

[@Jettmingin]

Only oldheads would remember but Jim Smith is the only good cop ever

[@AtulPYadav]

Calm, cool, collected. Broke the Rapist Killer Colonel apart in about half hour. It was one of the only moments where Copaganda actually worked one me.

[@zyyps]

Jim one of the coldest to ever do it fr

[@slowloris2894]

It scares me to think about sociopaths like Ed Kemper who totally could of gotten out of this horrible interrogation.

[@FrshChees91]

I wonder if he ever would have been caught had he not turned himself in.

[@mursuka80]

@@FrshChees91 He would. He killed his mother, so it was just a matter of time. He knew that, so he turned himself in. It had nothing to do with remorse or other BS he said in those interviews.

[@PhilipADitko]

No surprise Hassan thinks this detective is doing a poor job interviewing him, when he doesn't know the first thing about police interrogations. Detective Clark did a phenomenal job in the interview. He's only looking at one clip of it. You actually look at the transcript as well as the full video of the entire interview, even before he started pressing him a little bit, he would engage in certain police techniques like asking him where he went to lunch at and what did he have, and if you couldn't remember that's the hint that he's lying, as well as checking the drive-thru footage of a nearby McDonald's if he says he went there to eat. There are other police techniques that this moron is oblivious to, like having a suspect tell their story backwards. He also looks at his mannerism and behavior. Getting a confession isn't an easy peasy thing and for this ass wipe to armchair quarterback him how to do his job is unbelievably pretentious.

[@korubi_eCSTatic]

@@PhilipADitkoacab tho

[@PhilipADitko]

@@korubi_eCSTatic ^Anime avatar

[@18booma]

My girlfriend's dad is a true thumb, but we're lesbians, so no chance of a thumb child.

[@leethax100]

Make sure it's your eggs when the IVF conversation comes around

[@solala1312]

adopt to stop the thumb lineage and own all pigs once again.

[@amarevanhook7453]

Ur lucky

[@An0nymous_L0gic]

I mean you could get a donor with thumb genes

[@An0nymous_L0gic]

​@solala1312 how can you assure you don't adopt someone with thumb heritage?

[@Gotrek-sk8rq]

“Cop Phrenology” 🤣

[@ZERO_O7X]

Human Thumbs

[@twentylush]

"You'd be surprised with what I can live with" ok dude. this was his first murder as a serial killer. he won't even get a netflix series and a weird fandom, he can't be saying stuff like that its big cringe.

[@solala1312]

serial killers talking and their inflated ego neven fail to amaze me.

[@REDlikeBERRIES]

throughout my whole life as a Canadian, the way i pronounce 'garage" (I say it like the detective in the video) is the only word I have been made fun buy others hahaha

[@AlexanderWBarrett]

to ur face

[@solace6700]

Narrator: dude disappears hasan: LETS FUCKIN GOOOOOO!!!!!

[@apfelstrudeldk5130]

I love to give my view to one of the the OG hasanabi clip channels appreciate ya

[@mechisweats4282]

didnt know skill based matchmaking had made its way to police interrogations.

[@kaedence____]

Ahhhh takes me back to last spring/summer when we watched this stuff haha missed true crime

[@playerhateroftheyear1084]

the tribute to the victim is a sweet end to a video that takes the attention away from the killer. going to subscribe to the channel

[@flbreglass]

This is one of the greatest throws of all time

[@bradennotbrendan]

Shoutout Edmonton, AB 💪 getting the kind of recognition we deserve 1:47 Those look exactly like the condos I rented in Silverberry, lol

[@tbxvividos]

55:05 how u gonna not say anything when they literally show us his license plate was "DRK JEDI"

[@amosbackstrom5366]

"I don't understand.. I don't understand how I got caught, I had the cleaning supplies, don't you remember when I told you about the cleaning supplies

[@johndey922]

It's crazy to hear that this happened right next to where I used to live...

[@meghanpoplacean2216]

As someone who grew up in Edmonton, who the fuck says garage that way?!?

[@tasman655]

People from out East who live on the north side

[@llamaczech]

Tbh, and I don't know why Hasan didn't think of it... That's exactly how I'd imagine Schlatt would say "garage."

[@Lexythegreat_]

Bro as SOON as he tells him that he has no doubt in his mind that he's involved, a normal human would be like "gimme a lawyer. I want a lawyer. Lawyer. Lawyer please" lololol especially since he JUST offered him one 🤣 😂 😅

[@no_ononono3074]

This entire video... I couldn't help but keep hearing I MISS GA RAGE over and over and over again in my head.

[@limelightcapital7958]

TRUE CRIME HAS VIDS ARE BACK LFG BOIS!!!!

[@NatalieRose-u5t]

This technique is called the Drop The Ball technique. Absolutely drop the ball, fumble it, recatch and somehow win.

[@Ldogthe1nonly]

I hate that I say garage the way I do - a person from Calgary Alberta

[@0MVR_0]

Alltinger is a Norwegian last name meaning more or less 'congressional representative' or senator.

[@eclairia404]

I legit put up my thumb and compared it to his face. I will never look at my thumbs the same way.

[@abbycareyyy7755]

My parents are from Nova Scotia and both say “gradge” instead of garage 😂🤢

[@noodlz_666]

I'm so happy he's cover The Dork Jedi, Mark Twitchell.

[@bryce4443]

"what kind of cleaning supplies do you have" "yeah well I make fake blood and it gets everywhere, like everywhere all the time"

[@readussalehin3736]

My man said, “Let’s go dontcha know”😅

[@Sneak222]

cant believe I was just click baited for so long

[@galexical]

brooo the ending...from the car to the reveal of the confession 💀💀💀

[@abit359]

4:10 I would like to thank Skonk190 for his wonderful Veggietales fact.

[@scoobertmcruppert2915]

🤣

[@catcatcatcatcatcatcatcatcatca]

“The first thing detective Clark did was opposing the four other digits assigned to the case”

[@garlicinthebread]

4:30 right in this little ᵍᵃʳᵃᵍᵉ

[@blondebonetglamsey]

my favorite part is him calling it a suspense thriller and then willingly describing setting up a scene of torture porn

[@LyfeIllustration]

My dad says garaRge. Just gotta put that out there cuz I’ve always wondered how the hell he decided that was correct lol

[@tiniaful]

i do want to say garage is a french word and his giving the french intonation on the a. 10/10 prenounciation

[@jerrontaylor4611]

"looks like interrogations are back on the menu boys!!!"

[@catcatcatcatcatcatcatcatcatca]

Maybe the most effective interrogation methods are so effective because there are more innocent and scared people near any given crime than the few actually guilty people?

[@ToldFate]

“Why!” That nigga panicking

[@brendandrislane4560]

What strikes me about true crime murder is how many of the murderers seem either of low intelligence, or reasonably intelligent people who made a mistake or were undisciplined. It makes me wonder about the 40,000 unidentified bodies every year in the US. It makes me wonder about the killers that are not caught. Serial killers that perhaps do not repeat their method, and select victims seemingly at random, with no common repeatable demographic. So their murders do not appear related, and so the existence of such a serial killer is unclear, allowing them to kill with impunity.

[@bingusenjoyer197]

that level of serial killer precision and expertise is usually near impossible to get away with for a long time. a serial killer like this could probably get away with 3-4 murders before being caught, but for a serial killer to pull off what you’re describing long term they would need to have an extensive knowledge of what detectives look for in murder cases, of how to find and target victims, of cybersecurity to hide their digital footprint, proficiency in all weapons, disposal of bodies, hiding all of their physical tracks, and blending into society and appearing normal all before committing their first murder. murderers will also always be behind on time compared to detectives since they only have so much time to get rid of evidence while the police have a crew with an infinite amount of time to investigate. not to mention the stress and adrenaline serial killers get killing someone which leads to a high likelihood of making mistakes in the murder and cleanup. serial killers often get off on killing and will usually taunt the police after getting away with it for a long time believing that they’re invincible and start getting sloppy with their crimes. theres also a very high chance that over a long period of murders they could be caught red handed by dumb luck alone. a serial killer like this is highly highly unrealistic, i’m basically describing agent 47 from the hitman games.

[@mandymentzer6357]

Look up Israel keys

[@llamaczech]

If you look into the vast majority of serial killer cases, they are kind of dumb as rocks and get away with it for as long as they do because of police incompetence, and often times especially with the big names, straight up negligence in the face of victims coming forward. I see no reason to think those 40,000 unidentified bodies a year are part of a different pattern.

[@Ananasboat]

My mother, from northern Maine says "gaRWARdge" with the second r and everything. I hate it

[@jare3959]

I knew I recognized that name. I fell out of my seat when he said Edmonton. That's where I live. But I kinda blocked this case out of my mind.

[@hi_im_mello]

"Ope, did I say I bought the car for $40? Ope, sorry, I meant I killed him then stole his car and took $40 from his wallet."

[@Take_Your_Time_]

I transitioned to prevent myself from becoming a thumb.

[@Tachtress]

The interrogator sounds a little bit like the fitness gram pacer test at some moments

[@StanleyKubricksBeard]

Is that guy wearing a John-5 shirt? Merch from the guitarist of Rob Zombie/Marilyn Manson? 🤔

[@megshep]

Why is it always Canadians?? I swear we aren't all nutjobs! 😂

[@Cheezeblade]

cop wasnt tilted. he had spent days appealing to his better judgement maybe his humanity. Maybe getting him to at least in his own mind still needing to see himself as at least not the bad guy. WHen all else fails. the guys a killer, go after his ego. Tell him hes NOT as smart or visionary as he mighhhtt might wanna seem. Cant rule out a cold ruthlessness. but antagonizing him through telling him hes a shitty serial killer and got caught first time might hit a nerve. I dont know if the cop even beleived thats who he was dealing with. might have just wanted to fish for a reaction to have him defend his mind or skills.

[@AnnaVictrix]

I know about this loser but I’ve never seen the escaped victim’s interrogation footage and I couldn’t stop laughing at him making fun of this Dexter wannabe using movie logic in his attempted murder

[@khafaniking1230]

I want Hasan to react to more Orchard content, his video on JonBennet Ramsay case is enthralling and unsettling.

[@thendolethole2381]

That cop has strong Thumb Genes hahahaha.

[@ThatGuyGoob]

At 56:00 the detective straight up turned into Trump…

[@ashleyandchloe]

The garage technique 😹🙌

[@Maxisamo1]

I wanna see Jordan Peterson be the interrogator in these

[@rachelsummers4311]

that would be the funniest shit in the world

[@kevintipcorn6787]

More like Dork Jedi

[@LarryCalcGOAT]

the cop started sounding like me after I forgot what I was saying and am just hoping they don't notice.

[@kandykess]

JCS IS BACK JCS IS BACK JCS IS BACK JCS IS BACK

[@cctomcat321]

(inspired)

[@TheGlassAddiction]

Canada crimes time heck yeah. This time my province??? Wow

[@1f6ixwas9ine]

I remember hearing mrballen cover this story to see the interrogation of it is interesting

[@Itzskimpy]

He even knew about some tactics and was cautious of that, I have no idea how that awareness didn't tell him to shut up the minute he went in there or leave when he was told he was free to go. Obviously don't side with the murderer at all but it's amazing how these people don't understand that even if you were innocent you should never talk without a lawyer

[@najatalfahham1086]

You should have not mentioned garage (Peter griffin) and let the chat go offffff 😆

[@sayeedkizuk5822]

Damn I used to live pretty close to there

[@coderedcleaninginc.9942]

Why does nobody ever fucking ask for a lawyer in these videos I literally don’t understand 😭

[@jappyhoy]

detail geek says garage the same way

[@nyracin]

The garage thing is so stupid, the word originates from french so ofc canadians would pronounce it that way. English pronunciation is probably the most inconsistent in the world literally why is the “c” in city and cross pronounced completely different (and that’s just a random example) or the “knight” and “night” nonsense 💀

[@jennydiver100]

None of these assistants will turn out to be real.

[@azazeeel5043]

9 month old episode but i am still gonna comment because this is infuriating. After 54:00 the guy says 'on either side' and the subtitles just completely lie about 'the sun' in his words.

[@bigspice4538]

Yessssss back to the murder shit

[@danielc8329]

I ACCIDENTALLY FRAMED MYSELF LOL

[@zoosmell_egbert]

3:00 as a child of a cop, this is why I don't want kids I don't wanna pass down these fuckin thumb genes bro

[@DignanDerkin]

my grandma unironically says g'rage (no a after the g, very important) she was raised in BC her whole life as far as i know

[@Jeremo-FD]

1:00:25 "There was something about urgently exploring my dark side that greatly appalled me" - Hasan Freudian slip bc he's a normal human with empathy.

[@billbutton8468]

HOLY SHIT i thought cop was dog shit like hasan but then at the end it shows he read him like a book with those confession writings lmaoooooo

[@Hotlooksamerica]

4:18 Detective TATTLER gonna tell on YOU!!!

[@abbybozek2928]

I could be wrong but i think the interrogator is using the Reed (or Rhett idk) technique - he was obviously there and he and the cop know that. The cop is trying to get him to admit to a lower offense - i.e. accident on movie scene - because then he can pinpoint that he was lying the whole time and then can book him in prison. Then they can actually grill him into what happened.

[@jesselynds5411]

how the hell can you build suspense in 8 or 9 minutes

[@hannahcatherine4]

i can't hear garage properly now

[@d33pseacreature]

TRUE CRIME BACK YASS

[@alyssabro9092]

I never clicked a video so fast