This is Sweden's JFK Mystery.

The murder of Olof Palme remains one of the most intriguing mysteries in Europe. Who did it?
-
Support us on Patreon: / spectaclesmedia
Check out our sources: www.spectacles.news/Olof-Palm...
Hang out on our Discord: / discord
-
Spectacles is a love letter to democracy, its values, its caretakers, and its ideas. Around the world, individual rights and representative government are facing unprecedented attacks from the forces of reaction and revisionism. But despite liberal democracy’s real shortcomings and today’s all-too-fashionable cynicism, we remain committed to its preservation and improvement. Join us as we explore just what liberal democracy is, how it comes about, and how it can best be maintained in a changing world.
-
00:00 Intro
05:30 Who is Olof Palme?
10:15 Police Blunders
12:21 I - The South African
15:51 II - The Grand Man
21:58 III - The Skandia Man
30:55 Conclusion
-
JJJreact

[@spectacles-dm]

❓Who do you think committed the crime? 🗣Discord: discord.gg/VWcpybH683 😃Patreon: patreon.com/spectaclesmedia - CORRECTIONS - 👻 (for now…)

[@Gracinda80]

Checkout PM Sá Carneiro's death in 1980. Swedish wife.

[@MrAlsachti]

I have no idea, but based on the information given in this video, I don't see Engström as a good suspect. A guy leaves his work, bumps into Olof Palme, happens to have a gun - a gun that he brought with him at work for some reason (in Sweden, not in the USA) - a gun borrowed from an acquaintance, presumably without their knowledge - , decides in less than a minute to kill him for vague reasons, then flees, then comes back, at the risk of being identified as the killer? I have seen better JFK theories. I hope the police had better reasons to name him prime suspect.

[@hex2637]

NATO and the CIA through Gladio, just like they killed Aldo Moro

[@HenrySimple]

A German documentary from approx. the early 2000 pointed at right wing police within the Swedish force. In conjunction with US intelligence.

[@hex2637]

@@HenrySimple seems legit and would make sense as a part of Gladio

[@jekanyika]

It's ironic that a Swedish guy did a JFK video and now an American is doing the Swedish JFK.

[@greengrinch007]

Love Lemino both these guys r great

[@ap-mr3st]

@@greengrinch007 is Lemino from Sweden

[@Zekseed]

@@ap-mr3styes

[@SeaCubeSeal]

@@ap-mr3styes

[@Gustis40g]

@@ap-mr3st yes

[@coola567]

Lizbeth Palme did not say "It is clear, who it is" in response to identifying the killer. She had been informed beforehand, that the police had a suspect, and that the suspect was an alcoholic. What she said was "It is clear who is the alcoholic" before identifying Pettersson. This was the base for Petterssons acquittal on appeal. The police basically nudged the key witness towards a conclusion and thus a conviction, that, ultimately, would not stand.

[@johano-go]

Exactly. Which is one of many blunders the police did.

[@ismJoboi]

This is one of the things that I hate so much of society now

[@ipadista]

@@ismJoboi That Swedish police failed utterly to handle the assassination?

[@ismJoboi]

@@ipadista it’s one of them, but it’s also: Inherited or Acquired Corruption, Less than Effective Reforms, Other things that I cannot list down but are almost for others that anger them

[@suomiprkle]

@@Njordin2010 Whats that?

[@gzell5556]

how in the world do just two people make such high quality videos? this is literally so much better, higher quality, and more interesting than tv documentaries

[@krisstopher8259]

it's like BBC quality but without thousands of employees and a budget of millions, lol

[@xixi560]

​@@krisstopher8259and without all the decades of CSA being harboured/swept under the rug ✌️

[@MikeYork-bn1mt]

I love all of my White brothers and sisters. May God bless us all.

[@fakeskyler2305]

@@MikeYork-bn1mt Ayo?

[@TitaniumTurbine]

@@fakeskyler2305 It’s a bot.

[@ShikiTWEWY]

It really feels like the last guy, Engström, is a prime example why police need training in how memory works and not to trust eye witnesses. The fact that the story closest to the incident was the one that gave him an alibi and exonerated him points strongly to him not being the killer. Him accidentally incriminating himself with very small details is not strange especially when viewing it in the perspective of trying to make himself more important. Because what were those details? Walking slowly vs briskly walking. Looking at his watch vs knowing the time from the punch card. Those are very small details and I wonder how far apart the interviews were. Our memory changes like a wikipedia page, when we tell a story to someone that person might suggest something that changes our memories. You can easily imagine how he told his wife the story and she said "what you couldnt tell if it was a gunshot or burst tire? They sound totally different", so Engström in his mind thought "hm thats true, there must be a reason for it?" aaand now we get "Oh yeah I couldnt tell because I was in a hurry". And then, even further away from the incident, he thinks "yeah i have this dark watch, that must have added to my distraction!". When in reality none of those things happened. What about other proof? How is it proof that he had this specific gun, because his friend was a gun nut and had a crap ton of different guns? Did he say he sold it to him? Do we know Engström even knew how to use guns? This all seems to be "ah yes poetic justice" without any proof. The motive seems more like something out of a movie than real life. It's one thing to say "I was the hero in this case when the prime minister was shot" when you were a by-stander, it's another to have enough drive to shoot someone. The police pinning it on him (ive seen some rebuttals of that in the comments, but assuming thats what they did) after he killed himself is honestly insulting. Witnesses often change their stories. Thats just what our brains do. But hey he was kinda weird and its a good story, right?

[@spectacles-dm]

Well said, and great points!

[@jakubhulanicki7101]

I would argue that the whole idea of him being a genuine suspect is mistaken, and based solely on what you describe as innate to memory. Honestly I'm disappointed to say that what @spectacles-dm says is "plausible motive" is mostly (at best) thin abductive pseudopsychology. Motive for murder carries a heavy burden of proof in a functioning court. Otherwise, fantastic video, and great job especially with the animating visuals.

[@scallopohare9431]

Speak for your brain, not mine. I can accurately details of events from decades ago.

[@TheJonathanNewton]

The whole problem with the Stig Engström theory is that it requires such a massive coincidence to the point of absurdity. Here’s a disgruntled nobody, who only happens to step out from his office and more or less stumble across the Prime Minister, and who conveniently enough also happens to have a handgun with him - in a country with very, very strict gun laws, mind you - and no ordinary gun either, but one that’s the size of a small Christmas turkey. Then, the said gun also happens to be loaded with metal piercing ammo (perfect if you suspect your victim to be wearing a bullet-proof vest by the way). And then he runs up a long flight of stairs, which is quite exhausting (I’ve climbed them and had to stop half-way), and disappears into the night. Sorry, that’s just ridiculous.

[@DIREWOLFx75]

"Witnesses often change their stories. Thats just what our brains do." You don't even need that. Try telling the same story every sunday, for a year. Record them. And then compare them. Chances are that you will not use the same wording unless you're a professional storyteller or something who memorises exactly, because for normal people, we express things differently even just based on tiny things. It's entirely possible that Engström did not even intentionally attempt to change anything, but just "told the same story again and again", in different words and reacting to different questions about it which made him give statements that to him were just different ways of saying the same thing. "Our memory changes like a wikipedia page, when we tell a story to someone that person might suggest something that changes our memories." For some people.

[@Vingul]

This case is so well known in Scandinavia that it's sort of interesting to see comments from people who have never heard about it, even though it isn't actually surprising. I understand we're not all that significant on the world stage.

[@JohnGeorgeBauerBuis]

I’ve read about it before, but I’m interested in history so it’s not so surprising that I found out about this.

[@alfredfreedomjones5105]

The title doesn’t even mention the name of the actual person that was killed. It mentions JFK, which is effective in capturing interest because everyone’s heard of JFK, but not effective in communicating actual information

[@Vingul]

​@@alfredfreedomjones5105 I agree, I suppose the title is worded that way to make you intrigued and click on the video. I thought of Palme at once, but since it didn't even mention Sweden I clicked to see if I was right, hah.

[@wittiza2102]

When the "real killer" was revealed some years ago i did check in American news agencys and no one did have anything about it.

[@flamingspinach]

@@alfredfreedomjones5105 There is a browser extension called DeArrow which replaces video titles and thumbnails with user-sourced versions that are less clickbaity. For this video, DeArrow renamed it to "The murder of Olof Palme remains one of the most intriguing mysteries in Europe", which is much more effective in communicating what the video is about.

[@Sam_Roberts]

as the first commenter here I just wanted to say this channel has very quickly become one of my absolute favourites, the storytelling and animation is just so slick and always keeps my attention glued to the screen

[@spectacles-dm]

Thanks so much! We hope you enjoy this one even more :)

[@134343]

@@spectacles-dm I am a recent joiner and think of your content as another brand of Lemmino'esque style videos. Great work and topics!

[@user-yh1nm1vy3i]

@@134343 I just realized that LEMMiNO means “let me know”

[@erdngtn9942]

Lemmino COPY. Just produce more and you’ll skate with the unoriginal like all bottom feeders. It’s survival so I’m not judging. The opposite but don’t expect kindness

[@NoSaysJo]

​@@erdngtn9942and leemino copied other creators. What's your point champ

[@christerprestberg3973]

Really cool to see the Palme murder from an "outsiders" perspective. My mother keeps a sort of diary, every christmas since she was 20-ish she writes a short entry about the world/family/friends/etc and general stuff that has happend during the year, naturally theres alot of interesting stuff in there but I've allways been draw to her entrys regarding the murder and the years following it where she documents the general happenings about the Palme murder, until eventually there is no more entries about it as the years go on.

[@The_ZeroLine]

You should make her journal into a video.

[@tytlersbicycle]

A short while after having moved to Sweden in the early 2000’s, I was on my way into Stockholm with a friend one afternoon and we stopped off at Sollentuna centrum to buy some beer at Systembolaget (the state-operated liquor store). After buying our beer we were heading back to the train when we were approached by a man who asked if he could bum a beer. I had no idea who he was but my friend acted like he had seen a ghost. A few minutes later when we were back on the train, he asked if I knew who the person who had approached us was. I replied in the negative. It was Krister Petersson (affectionately known as Krille P). After that, I would see him milling about the area from time to time until his death in 2004.

[@ErinnBastias]

I remember seeing him in Sollentuna Centrum from time to time when i was a kid. My mom pointed out him as Palme's alleged killer, but she didn't believe it.

[@tytlersbicycle]

@@ErinnBastias Supposedly, he admitted something to one of Palme’s children on his deathbed. I don’t know the validity of that though. There was definitely something off about him but I doubt he was any sort of assassin such is the claim.

[@ErinnBastias]

@@tytlersbicycle mom always said he was paid to take the blame so the real killer wouldn't be found. I'm inclined to trust her opinion because she was never much of a conspirationist otherwise, but who knows.

[@DanielKling]

@@tytlersbicycle He asked to talk to Palme's son before dying, but he died before he had the chance.

[@tytlersbicycle]

@@DanielKling Maybe that’s what it was then. It was long ago.

[@johano-go]

Well, the investigator said that "there is no way around Engström" and "there is enough to go on to arrest him, if he was still alive." He didn't claim that Engström is the killer. That, nobody knows. The only thing that is clear, is that he is the only person we know who had been there with the ability to shoot Palme, and that he kept changing his story as media gave him more info. On a sidenote, Petterson lived a few kilometres away from where I grew up, so I saw him a few times on the bus. No bus driver dared to ask the "Palme killer" for a ticket.

[@billywiththebulgingbaloonb5105]

Which kinda sort of make you wonder why they CLOSED THE CASE if it was simply a matter of Engström being a suspect. Either he killed Palme or he didn't and if he didn't, the investigation should continue.

[@johnbeans2000]

Christer Petterson was a saint.

[@FenNick1994]

@@johnbeans2000 Christer Petterson bayoneted a drunk person to death in central Stockholm for having dirtied his teddybear. (I am not making this up.)

[@almerindaromeira8352]

Ok, but if he came from Sveavägen and the killer escaped through Tunnelgatan, how did he loop around the blick that fast?

[@johano-go]

@@almerindaromeira8352 He returned to his workplace about 20 minutes after he left. That's enough time to go around a block or two.

[@KC-Mitch]

This is very well done. A lot of the graphics and presentation of the individuals involved remind me of LEMMiNO's JFK video a couple months back. I love the crime-noir documentary style you do where you come out of the shadows in person too! Hope to see more like this in the future, as you clearly have a knack for it.

[@thebronywiking]

Considering LEMMiNO is Sweden this is quite poetic. A Swede makes a video about an American assassination, and then an American makes a video about a Swedish assassination.

[@jackwood594]

I mean it’s pretty obvious he took inspiration from Lemmino

[@scoopsmcgoops]

@@jackwood594Agreed, I was gonna say 😂 there is a 0% chance that he never saw the JFK vid before making this one. Not saying that this one is bad by any means, but it would probably be a good idea to at least acknowledge that the inspiration was there…

[@therider990]

@@jackwood594’Took inspiration’

[@CantTellYou]

I feel like all these guys who make these kind of great polished mini-documentaries on KZbin use the same software for the 3D modeling. Some more recently, others that have been for a long while now. But yeah I would say, at least personally, the first I ever saw to use that style... was LEMMiNO

[@avgeek-and-fashion]

I once experimented with running the trail of the murderer. There are some very steep stairs there and you have to be fit to sprint those in the allotted time. The man aquitted for the crime, Christer Petterson could NOT have done that sprint in any reasonable time to fit the police theories, there just is no possibility of that. Engström could have been a plotter but unlikely he committed the crime himself. Many Swedes suspect police involvment since the security detail was cancelled just a few hours before Palme's cinema visit and only a few persons knew Palme would be around with no security that evening. Palme was intensely hated in selected circles of the police and military establishment.

[@TheJonathanNewton]

I’ve climbed those stairs and had to stop half way. Running, forget it.

[@avgeek-and-fashion]

@@TheJonathanNewton That's the main reason I think a police/military involvment is very likely... those guys can be really fit.

[@alanywalany6460]

@@avgeek-and-fashion Most likely. The assassin knew precisely where to shoot to not only do the most damage to internals but also to sever the spine and make him fall down. The reason Lisbeth survived is because she leaned forward just before he shot and he thought he had hit her since she went down to help her husband.

[@avgeek-and-fashion]

@@alanywalany6460 This too. Absolutely mindboggingly insane that they tried to frame a drunk for this.

[@edyslavico3761]

CIA did it with the complicity of some far-right policemen, easy to figure out

[@alexanderm2702]

Memories can change completely, ask someone you experienced a memorable event with 10 years ago and compare to your recollection, they will be different. Especially if they've turned it over in their heads, each time you remember something the memory changes slightly. There have been studies where someone pretends to snatch a purse from a lecture hall, and a few minutes later the person is put in a line up and most witnesses can't ID the person. It's completely insane that eyewitness testimony is valued so much. There have been many false convictions overturned based on DNA evidence, but despite that the victim still remembers the person as being the perpetrator, because they saw the defendant in court every day and their memory changed to include his face.

[@DeadCamper]

Yeah. Our eyes aren't cameras and our brain isn't a hard drive. Memories are basically our brains telling us a story, that's all it is, and it changes each time until it's unrecognizable.

[@jamesknapp64]

Agreed so much. Nothing in the 3rd "suspects" testimony shows anything abnormal. I dont view him as a viable suspect.

[@scallopohare9431]

Not everyone has such deficits. I can recall events from decades ago, and when I search on-line, the info matches. Blanket statements about human abilities are garbage.

[@kray3883]

Yeah, this idea is SO flimsy. The witness description is 1. wearing a dark coat, 2. wearing a cap, 3. heavyset, 4. middle-aged. Since basically everyone is going to wear a coat in the middle of the night in Sweden in February, and "dark" coat is a very basic item, 1 is nothing. For 2, it was the 80s, a lot of people still wore caps as a regular clothing item, nothing there. 3, heavy-set...hard to tell under a coat, but slightly more useful as a description that doesn't apply to everyone at least. 4, middle aged...the witness saw the suspect running away, at night, wearing heavy clothing...middle aged here basically only means not a child and not using a walker. So...a huge percentage of the population, honestly could have been a large woman wearing men's-style clothes, good luck. The motive is...just nothing. The guy wanted attention so he randomly took his friend's weird gun to work (which no one noticed all day, and his friend the gun collector either never noticed missing or never thought to mention to the police), happened to leave work at the exact time to bump into a politician whom he disliked (which, btw, the people who went to help him didn't recognize him, so he probably had to see him pretty clearly), and is so enraged that he decides on the spur of the moment to shoot him and run? What? And then all this talk of the timecard being fast or slow by a minute...people obviously don't remember how bad time was before cell phones. Even a timecard system, if the hours were flexible anyway then only the interval between in and out really matters. Train times were actually accurate (have to be) but you showed up early because you were never sure that your own time was accurate. And he even stopped to talk to the security guard on the way out for an unknown length of time. So this crazy minute-by-minute discrepancy analysis is just not realistic. Here's my theory. He punches out on his time card. He stops to talk to the security guard (for "a minute or two", but really who knows). He maybe hears something, maybe a gunshot but also maybe a car or something else or maybe even nothing. He finds people standing around, something has happened, it's exciting. He's one of the earlier people there, but only relative to the crowd later. He's very focused on what's happening and it feels very personal in his mind: right outside his workplace as he was going home, he sort of has a memory of hearing something which to him now was obviously a gun shot, he feels very involved in the action without necessarily actually being involved in the action. And then later he starts talking to the media, but no one seems to find his part in the story very important because frankly it wasn't. So his story starts growing. He starts conflating things he actually experienced with things he heard about later. He assumes that his recollection is accurate and applies that filter to everything else and then presents things as facts because they seem that way to him...if he was one of the first people there (which is what it felt like to him), then he must have left the office at X time, and he presents that as established fact instead of saying he actually doesn't remember particularly the exact time he left. He exaggerates his role because it feels harmless and people reward him with attention when he does, he tells things so often that they start to feel real to him. No need for the crazy coincidence of a person carrying a gun to work and then randomly bumping into Palme that night. Inflating his own importance and involvement in events was already a normal thing for this guy, so it's just a continuation of his normal behavior.

[@TheGhostOfFredZeppelin]

Memories are some of the most unreliable things in existence, every time you remember something you basically just remember the last time you remembered it and things can change drastically and easily, while it still feels like 100% reality.

[@nocturne7371]

I can definitely say that in Sweden, everone knows where they were when this news hit the air waves. Me personally were 12 years old and woke up on Saturday morning to watch the kids morning programs, but istead me, my sister and my parents ended up eating breakfast to the news of this . After that, the speculations, conspiracies and works of SÄPO (mostly botched work) seemed to be never ending in the press.

[@Elora445]

Not everyone. I was 4. Kind of hard to remember such details at that age. I have very vague memories of it happening because my family reacted so strongly to it. That's all I can say. (Edited for I cannot count correctly.)

[@jackarkel2051]

I wasn't born yet but my mom was! Her dad was working very close by the murder place AND he was very anti Palme. He also looked like the description of the shooter. It was a joke my whole life that he was the murderer. Though he worked as a dentist and had no way to get a gun and he is no killer at all. Just funny imo

[@jimmieakesson8816]

säpo fanns inte 86.

[@marchill4851]

It sounds like the most critical element to this case is the inability of the police. Why was that? Were they poorly trained? Underfunded/manned? Incompetent? That would be an important question in reviewing the case as a matter of governance/national security. Are Swedish PMs now required to have a guard at all times because of this incident?

[@fds7476]

Sounds like a typical case of police saying, "Nothing ever happens here anyway".

[@koen8826]

That's why there are also plenty of theories about policemen being involved in the murder.

[@RelativelyBest]

The PM (and parts of their family) now have a permanent Security Service detail, which was indeed implemented as a direct result of Palme's murder. Other members of the government are only assigned bodyguards if a threat is deemed plausible. Notably, the eerily similar 2003 fatal stabbing of Anna Lindh, the Minister of Foreign Affairs, basically gave everyone 'Nam flashbacks of the Palme case and the police was very keen on not bungling it again. Fortunately they were actually able to catch the killer that time.

[@kungfreddie]

In the 80s it was almost unheard of to have shootings in sweden.. very uncommon. Now there are like 1-2 a day. I think the anc trail is most probable. Or some other international thing that has not come to light. As they said, neither ussr or usa was that fond of him. But I doubt they would risk shooting him themself.. mayb nudge some bananarepublic to do it. It can also be turkey... even though they claimed pkk had done it at first.. swedish social democrats.. palmes party.. had very close ties to pkk! And still have, that's why turkey want sweden to extradite kurds to accept them into nato.

[@groglas]

Swedish police was well trained, funded, and manned, what they lacked was experience in working a case of this magnitude, the fact that it was the prime minister lead to established procedures not being followed, something that might have been salvageable if it hadn't been for their greatest weakness, the god awful leadership, some of their mistakes are covered in the video, like writing off Engström in favor of the implausible PKK theory, but rest assured there are many more.

[@TheJonathanNewton]

Having followed this case since it happened, I must commend you for an excellently made documentary which managed to cut through the maze of theories and summarise the important bits accurately. (There was the odd minor mistake, but nothing to write home about.) Even the translations from the Swedish police interview protocols were spot on. Your research into this vast and complicated matter was impeccable. You even identified the ”ordinary citizen” theme correctly and brought it out into its logical conclusion. The way you used it as a recurring motif really carried the story. Hats off!

[@JH-lo9ut]

I was five years old when Olof Palme was killed. It remains my first vivid memory. I grew up just a couple of blocks from the spot where it happened. My whole childhood, I passed by that brass plaque in the sidewalk, almost every day. The mystery has haunted me, as so many other Swedes, for my entire life. There have been so many theories about who did it, credible theories, incredible theories and fictional ones too. The 2020 reveal by the police was such an anticlimax. I don't have the investigative expertise to reliably evaluate their conclusion but it seems to me that they closed down the investigation on a legal loophole: the suspect has died, therefore he can't be prosecuted, so case closed. I don't know. I guess they couldn't keep doing it anymore. The investigation unit had been a joke for decades at that point, and the joke wasn't even funny anymore.

[@FlexBeanbag]

kzbin.infoBmc9NFfhx74?si=rrs6HJIb5TbZdmmY

[@Sam1D28]

As a swede who wasn't born when it happened, I have heard many people say they remember hearing the news as clearly as when they heard about 9/11. Would you say that's true?

[@PennyAfNorberg]

Was you up early waiting for comics you too?

[@Bonkpunktexe]

@Sam1D28 compared to 9/11, most swedes who were alive to remember the Palme assassination does remember where they were and what they were doing, while most swedes dont really recall nearly as much detail as for example an american does about 9/11. My parents have talked about the Palme murder a ton and how they remember it, while they cant remember almost anything about 9/11 other than having no real idea why it was a huge deal at the time.

[@Sam1D28]

@Bonkpunktexe I am Swedish, and my parents, teachers, and family friends all remember clearly what they did when they heard of 9/11.

[@jfournerat1274]

Fun fact. Olof Palme was related to several prominent Swedish families including the Wallenbergs meaning that he was related to Raoul Wallenberg who was famous for his role in saving the lives of thousands of Hungarian Jewish people during the Holocaust and who was recognized by Yad Yashem as righteous among the nations.

[@lizroberts1569]

Another man seized by the Soviets who died in detention!

[@mase747]

You’ve grown a lot as a story teller in such a short time. I saw the title knew it was about Olof Palme and got so excited

[@Xob_Driesestig]

Did Engstrom even have the time to double back? I checked on google maps and it would have been a 11 minute walk if the stairs go over the road, not enough time to double back. Even if he jumped off the stairs that still would've been a 5 minute walk, which he could have theoretically made in time if he sprinted, but then he would've been terribly out of breath. Engstrom doesn't seem plausible to me. EDIT: I checked google streetview, he couldn't have jumped off the stairs, so unless the building layout was radically different at that time he couldn't have had the time to double back.

[@xseros7954]

What do you mean with "double back"? If you mean to be the guy trying to help Palme with his legs, that could just as well be another person.

[@Xob_Driesestig]

@@xseros7954 Yes that's the point, the guy helping with the legs (Engstrom) is another person than the killer.

[@xseros7954]

@@Xob_Driesestig yes indeed, though Engström claimed to be that guy, probably falsely.

[@DerpsWithWolves]

​@@xseros7954 The police could only interview Engstrom because he was *there* when they showed up... Even if Engstrom went to the police station the next day claiming he was there, the killer had already fled, and wouldn't have known what the other people around the body did or said afterwards. His story never wouldn't have fit with the others. He couldn't have known some random guy wanted to put the PM in the recovery position if he was already a block and a half away and still running unless he waited however many days it took for an inane detail like that to make its way into the newspaper. Not to mention, if he had lied, the 'real' leg guy would have existed... And would have been the one the police spoke to when they arrived anyway, so what would have been the point claiming to be them? They police would have gotten that guy's information instead, and known he was full of shit.

[@xseros7954]

@@DerpsWithWolves i remember the Police had an explanation for this in the broadcast in 2020, but cant remember what. You do make a fairly point though. I think Lisbeth said they never saw Engström on the crime scene, even if Engström testified to have talked to her.

[@of6594]

Engström as a "lone killer" is impossible. Even as a a member of a conspiration he is highly unlikely. What is not mentioned in this video (among other things) is that two of the guards in the place he worked stated that Engström chatted with them (about his upcoming ski vacation) for a couple of minutes AFTER checking out at approximately 23:19 - 23:20

[@user-tg9wh4vq2t]

Agreed. Engström is as far from a modus candidate that we (almost) possible may get... The claim of him being the killer is absolutely ridiculous. He did carry a personality disorder - but he did not carry a gun. Imo, there´s absolutely no doubt that Christer Pettersson was the killer. The killer ran away, observed by eyewitnesses, including Lisbet Palme - with his very characteristic way of moving. Lisbet Palme also looked right into his eyes on close range, and she recognized Pettersson. She was a professional observer (psychologist) and well known for her outstanding memory capabilities. But she was ´ignored´ (i.e. not sufficiently believed) through the (scandalous) swedish police investigations.

[@solutanbrun]

I appreciate that attention is brought to this national trauma. The death of Palme changed Sweden profoundly and I often wonder what we would have been should things have ended differently.

[@Zabadev]

Not better or much different😂

[@scallopohare9431]

Aren't you seeing his vision come to life lately? And not for the better.

[@Njordin2010]

Well you see whats happening now because of similar policies

[@DIREWOLFx75]

@@scallopohare9431 "Aren't you seeing his vision come to life lately?" Uh? No? The absolute OPPOSITE of what he wanted is what has happened since his murder. Sweden has become commercialised and privatized, while our foreign policy is whatever Washington or Brussels orders, where once Sweden was highly praised and loved in many nations for standing up for "the little guys" around the world, today we're known as USAs sockpuppet, and just as hated.

[@DIREWOLFx75]

@@Njordin2010 "Well you see whats happening now because of similar policies" Do you have even the slightest knowledge about Palme's ACTUAL politics? No. Were you even alive when he was killed? Me, i've at least said hello to him in person. As he used to walk past my family's house while he walked home from Spånga commuter train station when he wanted exercise instead of taking the subway directly to Vällingby, and stop to talk with my father. When Palme was murdered, Sweden was the most economically equal nation you could find. TODAY, Sweden is one of the most economically UNEQUAL nations in the world. Sweden used to stand up for the people around the world who needed someone doing it, nowadays, we're USAs obedient little puppets. We instantly shut up about Northstream even when Biden publically stated how USA would "end it".

[@MrThijmenmees]

There is one detail that doesn't add up in my head with the Angstrom-theory. That is the fact that Anna (The woman providing first aid) also talked about someone trying to help by turning the victim, exactly as Angstrom said he did. How could Angstrom have done that or have known that someone else did so if he ran away?

[@Asptuber]

I don't know about this particular detail (someone helping to turn/turn in a specific way), but it is a lamentable fact that all kinds of details from eye witnesses were publicized. Some very quickly, some in a drip over the years. Engström himself even took part in some kind of TV-production a few years (?) later, before the police had ever interviewed him properly. Due to the hopeless bungling by the police, especially the first year or so, it is very hard to say in what way various witness statements influenced each other.

[@MinedMaker]

I thought exactly this also. How could it possibly be Angstrom doing the killing, if the other witnesses saw him trying to turn the body. It is completely impossible for me to understand!?

[@raimat66]

@@MinedMaker That is one of the factors that speak against him. No other witness on the spot remembers Engström on the spot. It was another person who helped Anna with the resuscitation attempts. This does not make Engström a suspect. He may have been further back. But he was not where he claims to have been. Everything he claims about other people on the spot, he may have read in newspapers.

[@MinedMaker]

@@raimat66 Oh! Thank you for clearing that up.

[@einarbolstad8150]

@@Asptuber There are clips from Engström's participation in that tv production in this video.

[@abaker280]

I've seen the Shinzo Abe video before in my recommendations soon after it came out but thought nothing of it. Thought it was a low-effort video and brushed it aside without watching. Now I see this video, and I'm blown away by it. It was thoroughly enjoyable to watch! I'll have to watch the rest of your videos? Documentaries? The line is getting blurry as the content on this platform surpasses big-budget protections. Anyway, finally, I got to add another new channel to my subscription after so long! Thanks for the great work you put into this and everything else!

[@spectacles-dm]

Glad you gave us a second chance :)

[@Jgb8110]

This is a very good summary of the most important facts in this crime. One of the best non-swedish youtube productions I've seen actually so well done to you guys. I see that coola567 already corrected that police had informed Lisbeth that the suspect was an alcoholic (and the lineup consisted of Pettersson and random police employees) so very easy to distinguish. Another minor thing is that Pettersson's 1970 bayonette killing was not a drug dealer. Just a guy he bumped into in the christmas shopping rush in Stockholm. An act of very random violence. For someone who is a native swedish speaker the auto-subtitles are hilarious, but that's not your fault. Very good video! Will follow.

[@broke_gamer_]

i can see the influence from LEMMiNO!!! Very good content. I would love to see you do a collaboration with MyTake!

[@taytoyaddic7ed881]

Yeah, influence, referential or copy, it's a bit hard to decide tbh

[@spectacles-dm]

Of course inspired! He's an amazing creator we admire a lot. But I think we bring enough of our spin and style to make it our own :)

[@ddanenel]

@@spectacles-dmdefinitely, the only real overlap is the general topic and some of the 3d animations, you really made it your own

[@coola567]

@@spectacles-dm No shame in borrowing from the greats and i agree, you put your own spin on it. Considering, that LEMMiNO is Swedish, I wonder if he will ever do a Palme video.

[@niklasstrom8593]

A good friend of mine were doing his military service as fallskärmsjägare when they killed Palme, they were woken up at 02:00 by their commanders who were saying that the ussr were comming to invade over the baltic through Lithuania

[@bladepeterson778]

A fascinating look at an assassination I had never heard of. Palme walking down the street as an ordinary citizen reminds me a story Obama tells in his book A promised Land where he is wanting to go get ice cream with one of his daughters early in his presidency. He remarks how a simple spontaneous walk down the street was nearly impossible for him because of security concerns. The kind of story in this video is a reminder of why many politicians can't do many things ordinary citizens can.

[@sarasamaletdin4574]

Politicians in Europe still do just go to spontaneously to places like this, at least here in Northern Europe. And do things like not travel in business class in planes. But they security with them after Palme.

[@mypdf]

For example Angela Merkel has visited random restaurants, etc a lot during her time as chancellor, but there is still security around her. I think it also has to do with spontaneous visits/decisions not being as risky as planned things, as a possible assasain wouldn't have time to prepare or even know where to be@@sarasamaletdin4574

[@mencken8]

By Mr. Obama’s presidency, if his anecdote is true, it amounts to rank disingenuousness. Any president after JFK had to be well aware of the importance of security, even if it were not reinforced by the attempted assassinations of Ford and Reagan.

[@Njordin2010]

The gay bdsm president who was corrupt and had many unfortunate ties? Well...

[@raimat66]

Politicians don't move as freely anymore. But former politicians can move relatively freely. I passed the murder scene in Stockholm a few years ago, looked down at the plaque on the sidewalk. When I looked up again, I was face to face with Palme's successor Ingvar Carlsson (now a retired politician) who was walking in conversation with a friend. It was quite a strange experience, right there, just him.

[@mr.34coffeecups67]

My parents remember hearing the radio the day after: "Sveriges statsminister Olof Palme är död". And the shock people felt afterwards.

[@almighty1984]

19:15 I think Lisbeth said it's evident who the criminal is because the others were police officers.

[@johano-go]

They lined up a bunch of police officers and an alcoholic, telling Lisbet Palme that they cought an alcoholic. It's not hard to figure out which is which then.

[@Tommuli_Haudankaivaja]

Man, it's devastating to hear of a loved once's death mid KZbin documentary. I really hope I can still return to watch your videos without getting a painful memory of this moment, because your content seems great.

[@spectacles-dm]

Best wishes - sorry for your loss

[@Garrettguy5]

Oh You royal family?

[@Tommuli_Haudankaivaja]

@@Garrettguy5 It was my cat that had been part of my life for 70% of it.

[@c_p1858]

This video is very well put together and looks great but what especially gets me is just how crisp the sound effects are when discussing the details/possible theories, it’s just so clean all around

[@foerihelvete]

Interesting video, thank you very much! As a Swede it's interesting to get an outside view of it all. And you do a great work at presenting the major theories of the case. I was born later in the same year as the murder, and my parents happened to be living really close from the crime scene. They've told me how there were out seeing friends that night and got home not long after the murder. As they turned on the radio upon getting home, my mother complained about it only playing boring funeral style music, only for the music to end and the presenter saying prime minister Olof Palme had been shot at the intersection Sveavägen/Tunnelgatan. Shocked, they realized that was just around the corner and went there to have a look. As they arrived, a small crowd was starting to gather and my father told me he remembers seeing a large frozen puddle of Olof Palme's blood on the pavement, only an hour after the killing shot. (I was there too, albeit not yet born for another 5½ months!)

[@zTeaTheCoffee]

This is some really high quality production. Great video. Being Swedish, I remember when I first learned about this assassination. I was always told it was Christer Pettersson, that's what most Swedish people just accepted back when I was growing up in the late 2000s, but I really don't think we'll ever know what exactly happened. It's not exactly like most investigations, there's just such a lack of evidence (mainly due to police incompetence) that figuring out who killed him with certainty is pretty much impossible. Skandiamannen seems the most likely suspect, but it's quite sad that we'll never get to know the truth. By all accounts, Olof Palme was a good man and a good prime minister, it's a shame we lost him.

[@MR-vj8dn]

But it wasn’t that weird to think that he was going to be killed, the way he in ways manipulatively forced his world view / politics onto others (in other countries).

[@Greksallad]

The production quality is fucking amazing bro. Well researched, accurate info and great graphics. Keep this up and you'll have a million subscribers in no time. Excellent work! Subscribed af.

[@JohnnyMarksVideos]

Wow I love how you presented this. Impeccable storytelling & execution

[@InSayne]

Just discovered your channel and I am impressed by the volume and quality. It’s mindblowing how this video was researched and done with such apparent quality

[@EnergeticAdvantage]

That shot walking out of the cinema and into the light at 6:10 is incredible.

[@jaysonsmalls505]

Such an underrated channel! So awesome to get in at the ground level and witness the growth of a channel that undoubtedly deserves it. Keep it up!

[@therealuncleowen2588]

Your content is a sober and thoughtful look at context and facts around historical events. Excellent and important work. Well done, sir!

[@loopooillohg]

youre gonna blow up at this rate man so well done, the graphics are incredible for your size. so well produced. you got this brother.

[@josephhennessy2978]

I really enjoy how the 2D and 3D art helped to paint a picture in the viewers mind of what happened at the scene

[@catcatcatcatcatcatcatcatcatca]

Great video. I personally have a hard time believing that the shooting wasn’t politically motivated. Especially the idea that Andersson did so out of spite. For one thing, Andersson could have shot any famous person in Sweden, almost anywhere. To me it seems very hard to believe he went through the trouble of stealing a firearm from his neighbour and carrying it to work, without having any plausible way of knowing Olof Palme would be even visiting the movie theatre. It seems like the most convoluted crime one could still conclude from the existing evidence. Something you might land on if you decided to look at the existing evidence years later, trying to find a theory nobody has considered before. It’s easy to forget that when reading about these old crimes, we limit ourselves to possibilities that left recorded evidence. That is a logical fallacy, if we don’t account for it. Any theory that doesn’t contradict with the existing evidence and shouldn’t logically have produced more of it on the record, is just as plausible as theories that can be positively supported by the evidence. It’s much more plausible at least to me that someone, with some proper motivation, simply left the crime scene and because of the slow response by police, and lackluster investigation, there is no mention of them after they turned the corner.

[@raimat66]

I don't know who you refer to as "Andersson". The two suspects mentioned are Pettersson and Engström. What is special and interesting about the cinema visit is that the killer (whoever it is) may have seen Palme enter the cinema. Then the perpetrator has a long time to prepare the murder (the film is 1 hour and 50 minutes), and the perpetrator knows exactly when Palme will appear on the open street again. Both Pettersson and Engström may have done this.

[@cubismo85]

The murder was a 33 year old named Christer Andersson. Why him? *Owned the only 357 Magnum revolver in sthlm. which has not yet been test fired. *Ignored two requests from the police to submit the weapon for test firing. *When he was confronted in 1994, he had "sold the weapon in 1992 to an unknown person in Kungsträdgården", this in itself is a violation of the Weapons Act, which he should have been aware of. *For the murder, had bought in the same type of unusual bullets that were used in the murder (though not the same isotope type) *Agrees with the witnesses' description of the perpetrator. *Agrees on 15 points in GMP. *The only suspect by a long shot that GMP expert Ulf Åsgård believes is GM. *Lost a lot of money the day before the assassination when the Palme government raised the tax on stock profits, causing the stock market to crash. *Had no alibi for the entire day of the murder. Had no job. Said he was sick that day (while his relatives said he was healthy) *Lived in Vasastan north of the grand cinema. 15 minutes to run there from the scene of the murder. *Seen at the patisserie diagonally across the scene of the murder on every anniversary of the murder. Visited the patisserie thousands of times after the murder according to staff. They were afraid of his "staring gaze" *Had previously shot without his TV when Olof Palme was shown. *Relatives could not discuss Palme, it "locked" for him. *Convicted for mistreatment of a neighbor's dog. *Convited for assaulting a teenager on a metro in 2002. *Asocial, no friends, no partner. *Killed himself when the police knocked on the door of his apartment in August 2008.

[@MM-eq4nl]

you guys did a really great job with the diagrams and general visual info - I always have trouble keeping up with who's who and what's what but this was super easy to follow

[@Susie_Floozie]

Well, I'm subscribed. I respect your style, your visuals, your fluid narration, and the level-headed way you present the evidence in this story.

[@blumhlx]

I absolutely LOVE this style of storytelling in the intro with the dynamic map illustrations, Lemmino has done a similar technique and it's captivating. What software do you use to create these sequences if you don't mind me asking? Awesome video overall, your cinematography skills are apparent. Subscribed!

[@eruno_]

Olof Palme was always an inspiring personality. His strong sense of social equality and justice is vividly remembered not only in Sweden, but across the world. 🌹

[@vignotum132]

Olof but yeah

[@RelativelyBest]

På mäster Olofs tid.

[@johantaube3022]

He also had an unfortunate ability to agitate both political opponents and the public. He wasn't always a very agreeable man, and definitely not a saint

[@JensHove]

He was an elitist egalitarian idiot, like all social democrat (and leftist) politicians. People like him are the reason we're in the mess we're in.

[@Njordin2010]

Look what sweden got for that

[@KaygeeFromNanotrasen]

The production quality is insane! How do you not have more subs? I can't wait to see more of these vids, great work!

[@mattmartell2359]

I’m only 1:12 seconds in on this video and the production quality is INSANE. I already watched one video on this channel and I’m hooked. Bravo Spectacles

[@T1hitsTheHighestNote]

One aspect missing in the video is how hated Palme was among certain Swedes of the time on the opposite of the political spectrum. That was an important part in the case for Engström.

[@beast888100]

I forgot im subscribed to you. This video was a pleasant surprise, thank you.

[@fletcher262]

This video is brilliantly executed! Easiest sub I've ever given. Excited to check out the rest of the content.

[@sandrafaith]

Learned more about this murder from this video than anywhere else. Great work!

[@mathieuleader8601]

I could see Palme becoming UN Secretary-General if he had lived

[@JH-lo9ut]

Maybe, but he was a very controversial figure, who repeatedly humiliated powerful world leaders. Palme often chose public confrontation rather than silent diplomacy. I imagine he would have been blocked from becoming SG.

[@NeostormXLMAX]

the usa wouldnt have never allowed him to, same with israel, i reckon they killed him too

[@theconqueringram5295]

As an American, I never heard of this event. This video was beautifully made, you clearly paid attention to all the details from the city layout to where everyone was at the time of the event. But my God, if you're correct, it sounds like the Swedish police did everything they could to mess up the investigation!

[@thebronywiking]

I'm no fan of what Palme did to our nation, but he didn't deserve to die. There is a conspiracy that the police were in on it.

[@henriklarsson5221]

Yes, many pointed accusing fingers at high up police-men and officers, since it seemed they did EVERYTHING wrong that night and after in the investigation, and not according to procedure. Also, many officers in that area were pointed out(by other officers) as right-wing-radicals whom were sure that Palme must be an Soviet agent. The "police-track" was down-played and brushed of in the end.

[@Ossian-dr1vr]

This is part of why i think it was an inside job

[@TheJonathanNewton]

A lot of Swedes nourish conspiracy theories for that very reason.

[@nieko3038]

Bet majority of Europe doesn’t know. I didn’t. Title should mention Sweden and not Europe.

[@Yosetime]

Most excellent presentation! Well done. Enjoyed every minute! My first video on this channel. Will definitely watch another.

[@brads4449]

the quality of this😍 it’s giving spectacles ✨‼️

[@MrSpacekitteh]

Production on this vid is overwhelming for only 70k subs, keep it up!

[@Guysmith7]

Brilliant visual aids. Never actually understood the exact events of a crime scene from a documentary, just the vague order things happened and my imagination. Really informative.

[@john0ncam]

The format of this video is awesome!

[@20102010b]

First video I've seen from this channel. Great work! Reminds me of Kino Corner about history rather than movies.

[@pootnannies]

how did Engstrom commit the murder? that was never explained. did he come from behind, shoot Palme, then race down tunnelgatan, turn left, run down that street, turn left again, another street, finally turning left again and coming in just after the nurse did CPR? how is this possible? how did a chubby middle-aged man do all that with no planning? it's ridiculous unless i'm missing some kind of explaination.

[@parmesheen727]

Brilliant editing

[@rxt740]

Quality content, loved this video, keep it up!

[@swltony]

Quite glad to come across this channel. Well done 👌🏻

[@FoxMacLeod2501]

Regarding part of the closing monologue, just before the end: democracy promises a society wherein all are equal; but it's not _democracy itself_ that falls short of its own promises. It's the societies, governments, and individuals who fail to uphold the democratic values they tout in order to gain popular support and power. I just thought it'd be worth mentioning, that it'd help you avoid many of the little miscommunications that probably aren't even noticeable to you, but which can still be making life more difficult in little ways you'll only be able to discover when you learn how to communicate with enough clarity to prevent such situations in future interactions. It requires some very intentional focus and effort, to slog through the tedious, interminable final few percentage points of English-language knowledge and familiarity - where one crosses from fluency to mastery. However, if you just read a lot of modern classic writing from native English-speaking authors (circa 1940 to today), and you focus on _always_ stopping to learn the definitons of any unfamiliar words, or to clarify any grammatical or structural customs or outiliers which you realize you don't fully grasp the meaning of or proper use case for... But it requires some time spent reading while intently focusing on self-analysis, of your own thoughts as they pertain to what you're reading. After you become acclimated to regularly verifying your understanding and assumptions of common language, it becomes much easier to perpetuate... and, to make it even easier, the instances that give reason to stop and check will become fewer and farther between, as the unknowns dwindle. This may seem negative, but consider that this is essentially my sole critique in regard to these genuinely surprisingly excellent examples of historical true-crime storytelling. You're already ahead of many, particularly if considering my fellow Americans. You might be shocked at the swath of foundational basic English knowledge are misunderstood - or _not_ understood - and how unbelievably many of us have giant holes of that sort in our comprehension of _the sole language we can communicate in at all!_ It's shameful that we toss our young adults into the world with such a shoddy, inconsistent education; often, that education contains little applicable to adult professional life. Anyway. I loved the last episode, and this was a fantastic surprise to find today - I loved this one, too!

[@brianarbenz1329]

His murder was so painful for his wife and the nation. I had become interested in Swedish social democracy and in Palme’s leadership in 1980 when I did a college paper on the country’s system. Two years later, Palme made the great political comeback. Wanting to live like an average person in your hometown is admirable. It is so cruel that it enabled someone to take his life.

[@TeikonGom]

The Social Democrats are parasites.

[@christianheikkonen]

You make it sound like living among normal people is somehow irregular with politicians. It is not in Europe.

[@brianarbenz1329]

@@christianheikkonen I saw other people's comments in this said that European heads of state often do go out among the public. I'm glad they do. Here in the U.S., presidents such as Harry Truman were still living that way, with his morning walks during and after his presidency. But the assassination of JFK tightened up security for them, then the shooting of Reagan in 1981 ended the open mixing with the public.

[@chasemueller3413]

AMAZING!!! Never seen such a good video in my life, reminds me a lot of Nexpo. Please keep making videos

[@Likeomgitznich]

So the best story they got is a man just so happened to steal his neighbors gun, and just so happened to bring that gun to work with him that day, and just so happened to clock out of work around the time the PM would cross his path with no security in order to shoot him. That’s a no from me dawg

[@JH-lo9ut]

Yep. 35 years of fine police work that is.

[@OlssonDaniel]

Who shows up at 07:52 on the right? It is Fredrik Lindström. Lindström did a tv-show many years later (2010s or 2020s) and just inserted him self.

[@brucculi349]

Your production value just keeps getting better and better

[@zyplocs]

This channel is gonna be huge soon-keep it up man

[@fefferryerr1818]

The disappearance of australia's prime minister is mysterious too.

[@duane8228]

Actually an older European jfk mystery would be Michael Collins (prime minister & minister of finance) of the Irish free state he had over a dozen bodyguards yet was ambushed & assassinated with no injuries to anyone else, no autopsy, no arrests, no investigation, no record of it happening & the car he was in was found in Kenya 3 weeks later.

[@spectacles-dm]

Great idea - thanks so much!

[@duane8228]

Paddy cullivan is a great source on this he's on KZbin & twitter

[@drafmine4526]

This was such a good video! Really intriguing storytelling

[@romeister]

Another great video! Keep up the good work!

[@Angus_fO]

Fun fact: when Christer Pettersson was released he was spotted with a bottle of explorer vodka and a bottle of bailey's, giving birth to the infamous drink "Dräparen" (swedish for The Slayer) consisting of equal parts bailey's and vodka.

[@MR-vj8dn]

Never heard of that 😂

[@youlackingcake]

This is such a well made video. It reminds me of Lemino’s Jack the Ripper video, very similar style and one I highly recommend to anyone who enjoyed this video.

[@Johnduhh]

Love your art style. Well put together. Subbed

[@kaddouriboualem5267]

this is the first video I've enjoyed watching on YT in a while ❤️ such a high-quality content, yet when I checked your subs, u only got 75k follower, like you're such an underrated channel, keep it up❤

[@stallogstutterikfarstad6867]

I'm from Norway and maybe 10 years ago I met our prime minister on the streets of the city Trondheim. I'm not that shy, so I asked if he was who I thought, he confirmed, and we had a little chat before walking our separate ways. No security or anything if anyone was wondering.

[@confusedbud_yt7973]

Just commenting to boost the video. Love the work so much! Spectacles deserves way more than 70k subscribers!

[@unnamedTV]

Very nice video, great writing too.

[@coolstuff7772]

Great Video and documentary ❤

[@stevenmacdonald9619]

This is the first video I've watched on the channel, and I am so very impressed by the presentation. Especially with Philip Brain's character, poise and distinctive vocal style. I would go so far as to say he heavily reminds me of a young Louis Theroux, minus his 'Spectacles', and therefore also of a very, very young Paul Theroux, father to Louis. They too always maintain that strong narrative voice for clarity, whilst having just enough gentility to put the viewer at ease at close quarters. In doing so, he does away with any wedge between presenter, and viewer. Exactly what allows Louis Theroux to get so close to his subject matter, and those he interviews in turn, putting them at ease with him, when those difficult questions inevitably arrive. Familiarity can breed contempt, but this style is very disarming when used in media this way. Before even knowing of Louis Theroux, I would have called the style Inspector Columbo's way. A fictitious police detective in a long running U.S and U.K TV show from 1968-2003 called Columbo, and played by actor Peter Falk. Forgive the details, in short Mr Brain, is of a particular talent for sure, and I'm going to enjoy this channel's content. When the conduit of information is immune from any annoying traits, other than the details that matter, and is of a kind nature. It makes for very easy listening. It's not easy making murder a relaxing watch. A mention for Harry Clennon too. Without research, a support team, and a plan, all presenters, and many journalists would simply be standing in the street raving at themselves, like many a Monty Python sketch. A very clever channel all in all.

[@octopusprobably5544]

10:13 I got an ad break right in the middle of the gunshot sound effect and it had me chuckling.

[@aquemini154]

I love that you gave us the POV of every witness instead of just telling us what they saw

[@GunnH74]

As a norwegian who was twelve years old at the time, this made a hugh impression on me at the time. I followed the case closely even at that age. The police really screwed up. I believe Christer Petterson this this.

[@freja9398]

Vila i frid Olof Palme, vi saknar dig! Sverige är inte längre sig likt sen du togs ifrån oss 😢❤

[@Atamv]

Verkligen inte sig likt. Man ser knappt en svensk på gatorna. Skjutningar, mordbränder och annat ondskefullt dagligen.

[@thebronywiking]

Han avskaffande tjänstemannansvaret, han censurerade Geijeraffären, och han valde att införa öppen immigration utan att undersöka potentiella konsekvenser. Bara för att han blev mördad betyder inte att han var en bra ledare. Dock är det förfärligt att han blev mördad för ingen förtjänar det ödet.

[@wittiza2102]

😂😂😂😂

[@MR-vj8dn]

Själv är jag tacksam för att Sverige inte är (S)ig likt längre. Vi ska långt bort från Palmes typ av politik hoppas jag under kommande år.

[@austinrichard8046]

Great video Editing so good

[@KatherineKowalski]

Thank you very much for the excellent documentary. I enjoyed it and found it very informative. One critique: as a recent immigrant to Sweden from the US, i am learning the Swedish language, so your mispronounciations of Sveavägen and Stig grated on my nerves a bit and i found myself correcting your pronunciation from my couch every time 😂. I just wanted to give you a reminder that you can look up foreign language pronunciations on google translate, and even KZbin to give your videos even more quality. Thanks for the video! 👍

[@kungfreddie]

If it was the neighbors gun they would know it... they tested every 357 in sweden.. I know bcoz my grandfather was a sportshooter and owned a .357 s&w and he had to turn it over to police for testing... and we lived 500 miles away.

[@stanchpandora3658]

First time hearing of this guy and his death (probably have heard of him before, just cant remember right now). He sounded like a really great guy and it's sad he went out this way. The fact that the police didnt really try to find the gun even though there were only 10 missing in the country makes me really mad. Not saying it would be easy, but it is a start and has high potential.

[@groglas]

The police have tested hundreds of revolvers looking for the gun that fired the bullets that killed Palme and struck Lisbeth, there may have been 10 specifically Smith & Wesson .38s missing at the time, but that does not include other manufacturers, or take into consideration that the bullets could have been fired from the "wrong" caliber revolver, something the video doesn't mention, this is literally the largest criminal investigation in the history of Policing, and no I don't mean in Swedish history. Palme might have been a great man, but he was not a great guy.

[@billywiththebulgingbaloonb5105]

@@groglas Theoretical physics can also prove that an elephant can hang off a cliff with its tail tied to a daisy.

[@urviechalex9963]

@@billywiththebulgingbaloonb5105 Definitely not in our gravitational environment. 🙂

[@billywiththebulgingbaloonb5105]

@@urviechalex9963 It's a quote from the JFK movie which basically means you're not gonna find it if you don't want to find it. Douglas Berglund doesn't want this case to be solved and he is not alone.

[@shamanschlong]

what makes him great?

[@fellekillen99]

Well narrated video.

[@thomasmccarty1746]

Wow, excellent well-made video. Crazy how few subscribers you have. Hope you blow up soon, keep it up

[@ct5625]

The consistent incompetence and unethical practices by the police in this case (as happens in so many other cases) makes it impossible to believe that Stig Engström was actually the guilty party, he was just the only one they could pin it on. It's just not plausible, and requires you to just abandon all the other witness statements and common sense itself, from the man seen running away to the fact that the wife apparently didn't notice that the man who just shot her husband was now there allegedly trying to meddle in his care. That's just ridiculous. Even if she'd had some kind of confusion about what had happened she knew someone had shot her husband and knew which way they had fled, which was also consistent with two other witnesses. The police failed, over and over and over again, and in an effort to look less incompetent or corrupt they attempted to force reality to bend to their will and make that man their criminal. They do this all the time. They're still doing it today in almost every prominent case in every country. They allow their ego and opinions to drive them, they abandon leads, they ignore evidence, and when those failures start to become evident they begin to spend more time covering up their failures than solving the crime. That's what they did here imo. They manipulated Stig Engström, or simply encouraged false statements, to make him their scapegoat.

[@iounno]

One thing I didn't see answered is how could Engstrom kill Palme, then go up the stairs to be seen by Pettersson, only to be back at the crime scene shortly thereafter? What route could he have taken to accomplish this in the short time window? Regardless, loved the video you earned a subscriber!

[@holmbjerg]

Realistically he really couldn't. Engström does not really fit a plausible scenario. That Petterson and to some extent Engström were the main suspects is close to laughable. We know that the killer took off up the stairs in sprint. Both Petterson and Engström were middle aged, overweight and had mid-to severe degrees of alcoholism. That either of them should have shot Palme and then taken off like a rocket up long and steep stairs? It is extremely implausible.

[@Overlycomplicatedswede]

As a swede, your pronunciation of Swedish words is surprisingly good! I’ve been born and raised here in Sweden and speak the language yet I’ve not heard much about this mystery before until now. It’s a very interesting case and im very interested now! All I knew before is this guys death was a very big event here in Sweden I’m a 2005 kid so I wasn’t even alive when this happened Excellent documentary Love from Sweden

[@brhettdavis7061]

Im getting some big Lemmino vibes from this! I love the color coding it makes it really easy to remember who was who.

[@christopherprice1164]

Wow nice video❤