Why Britain's Brexit Trade Deal with the US is Stalling - TLDR News

TLDR Store: tldrnews.co.uk/store
Brexit the Colouring Book: tldrnews.co.uk/product/brexit...
This week Johnson's been in America trying to build bonds with Biden and arrange the UK/US trade deal that Brexiteers have been talking about for years. However, things don't seem to be going well with trade talks stalling before ever really getting going. So in this video we're unpacking what's going on in America and why a deal isn't forthcoming.
Follow TLDR on Facebook: / tldrnewsuk
Follow TLDR on Twitter: / tldrnewsuk
Follow TLDR on Instagram: / tldrnewsuk
Discord: / discord
Submit Your Topic Ideas: forms.gle/MWKppx9J5eKLAMPX6
TLDR Store: tldrnews.co.uk/store
TLDR TeeSpring Store: teespring.com/stores/tldr-sum...
Support TLDR on Patreon: / tldrnews
Donate by PayPal: tldrnews.co.uk/funding
TLDR is all about getting you up to date with the news of today, without bias and without filter. We want to give you the information you need, so you can make your own decision.
TLDR is a super small company, run by a few people with the help of some amazing volunteers. We are primarily fan sourced with most of our funding coming from donations and ad revenue. No shady corporations, no one telling us what to say. We can't wait to grow further and help more people get informed. Help support us by subscribing, following and backing on Patreon. Thanks!

[@TLDRnews]

CAST YOUR VOTE IN THE TWITTER POLL: twitter.com/TLDRNewsUK/status/1441052354468585473

[@leodouskyron5671]

The problem is not that we can’t do a free trade agreement - the issue is that anyone could tell you it was not happening and the Brexit ‘Boys’ said it was easy lying about it. But they knew they could lie to the Queen (sweet old lady even if the Royals are you know)!

[@the_forbinproject2777]

don't support twitter , its for kids

[@lesserspottedmugwump.363]

Nice comment section that you’ve garnered here Jack, very balanced and non toxic. Reminds me of Xbox live.

[@ArifKhan-rd3vo]

Canzuk is the only option we have now...

[@lesserspottedmugwump.363]

@@ArifKhan-rd3vo A fan of CANZUK Arif? My guy. Even with their flapping heads and beady eyes buddy?

[@winj3r]

Soon enough, Boris will try to join the Klingon empire, despite geography.

[@jamesleon4883]

Brilliant

[@SwabianWookie]

🤣🤣🤣🤣🤣

[@ashleyberkowitz8772]

Oh god, imagine Klingon in Boris’s voice

[@jwatson154]

Hahaha 🤣 I think you mean the Imperial Interplanetary Free Trade Agreement (IIFTA) 😂

[@willmoore505]

Chinese goods don't have a geographical issue being bought or sold. The EU doesn't even have a trade deal with China. What's your point ?

[@FuriousImp]

Lesson learned: Don't throw away your old shoes until you have new ones.

[@samueleveleigh2767]

The issue is the EU wouldn't allow us to go shoe shopping to continue your analogy

[@Me-vx5gc]

The good news: now that the UK is free from the EU plantation, it can shop for shoes wherever it likes. The bad news: no shoe shops want to sell shoes to the UK.

[@aidancollins1591]

@@samueleveleigh2767 How is that an issue? If you're in the EU, you follow their rules and receive their benefits (rules made with a large amount of input from the UK). To extend the analogy further though. It would be like getting together with your friends to bulk buy shoes, getting a better deal from the shoemaker. Then, you start insisting that it would be better, somehow, if you could buy shoes from the shoemaker by yourself without the purchasing power of your friends due to flexibility. Now you've got worse shoes that cost more money than the shoes you had previously.

[@stephenconway2468]

@@samueleveleigh2767 Funny thing is that we had the best selection of shoes already available. 759 trade/trading agreements and more happening or being planned.

[@sweepingtime]

The UK had 4 fucking years to make new shoes, even clown shoes.

[@peterbrown6392]

UK doesn't have much leverage on the US. It needs the deal far more than the US needs trade with the the UK

[@theoneandonlydetraebean8286]

@Kieran Kelly yeah, we remember how we beat the same nation that invented the language we speak. We also remember when we and the Soviet union had to bail them out when Germany was on the warpath against Europe.

[@theoneandonlydetraebean8286]

@Kieran Kelly further more after said revolution, we had a vote to select what language we would speak nation wide, with English only edging out German by one vote due to England still being geopolitically relevant.

[@tombee9785]

@@theoneandonlydetraebean8286 the soviet union was bailed out by the US, the soviets did fuck all for the UK except throw bodies at the german lines

[@shammydammy2610]

@Kieran Kelly We 'need to remember' why we speak English? Nope.

[@whyarewehere3893]

@@theoneandonlydetraebean8286 blind faith in a country that really doesn't care about its people

[@vilena5308]

This presentation creates an image of the UK leaving its group of friends from the neighborhood and now desperately looking around the city who will take them into their clique. It's embarrassing.

[@Oldmanplum]

Yes it is indeed embarrassing to view countries like kids wandering through a neighbourhood in cliques rather than the complex socio-political-economic constructs that they are

[@vilena5308]

@@Oldmanplum Not at all. It's called having an imagination and a sense of humour.

[@Oldmanplum]

@@vilena5308 Oh that was supposed to be a joke? Yikes.......If only you couldve imagined something funnier I didnt even vote for brexit either but its just not a good analogy and this sort of tripe shite makes my eyes roll out of my skull. If you don't like your friends then you shouldn't continue being friends with them, too many kids stay in cliques made of people they don't even like because they're afraid of being laughed at for not having any pals

[@TheMixCurator]

@@Oldmanplum You charade the OP for making comparisons "kids wandering through a neighbourhood in cliques " and then drop your own analogy based on the exact same thing? You've perfectly encapsulated the current Government over the past few years. Bravo!

[@Oldmanplum]

@@TheMixCurator You perhaps shouldve reread my comment a few times before you replied to it. I was explaining why I didn't like that analogy and why I didn't think it makes sense in context. I wasn't just using the exact same analogy for no reason lol.

[@TenOrbital]

Boris enjoyed his trip though. That’s nice.

[@pierre976]

😂😂😂👍👍👍

[@wayneford2481]

It's a shame Boris didn't stay there as he is an American immigrant.

[@umka7536]

Next time in the new yacht build for budget money, people's money. But no worries, poor brexiters are happy to empty their pockets for "sovereignty" and "no foreigners get our jobs".

[@Scriptedviolince]

@@wayneford2481 the term is "expat"

[@yohaneschristianp]

@@wayneford2481 cool one with British accent 🤣

[@Oliver-gb3ds]

The UK should join the United Arab Emirates

[@eamonnculliton100]

😂😂😂

[@yohaneschristianp]

You mean invade perhaps :X

[@Oliver-gb3ds]

@@yohaneschristianp probably

[@jokinmanjila170]

😂😂😂😂

[@dc99yt]

Nope UK should join China (or start lifting the ban on Huawei) and then that will make Biden wake up.

[@sweepingtime]

The US is stalling for better deals. Why wouldn't it? The US knows that the UK is in a tough spot and they can extract more concessions.

[@mukamuka0]

That's just a nature of any deal. We have to look out for our own interest, too.

[@JohnSmith-uy7sv]

Not the US. The Biden administration and their pack of thieves. They want everyone's money.

[@joemann2178]

I think so, probably want better deals in carving up the NHS for private US based companies.

[@JohnSmith-uy7sv]

@@freko106 I'm american. How would I know what the Monarch does with all your money. 🤣

[@KeithBab]

I don't think they are stailling for that reason. The UK would already roll over and given them whatever they want. The UK just doesn't have anything the US wants.

[@liamdayetti]

If any phrase summed up brexit it would be, "undeterred be geography"

[@davidevans3223]

We have a huge digital economy far bigger than the eu and distance doesnt matter we also sell car's in Australia so it's not a big deal either the eu was great for its free trade we still have that only with a growing free trade market why invest in France when the U.K. has a bigger free trade market France is in recession and very angry right now lol

[@lookingforsomething]

@@davidevans3223 As an economist I can tell you that geography is still a big issue. Distances create costs. No matter how much one tries to square this round hole, Brexit is impacting the UK economy negatively. This was known by Johnson et al. before. Their argument after all was that "despite negative impacts to economy we will gain back sovereignty, and that is more valuable in itself." The argument rings a bit hollow, as any trade deal, by definition means also testamenting a part of sovereignty in the process. It's inarguable that the short term impacts of Brexit have been negative for the economy, it's extremely likely that the future impact will be negative for the economy, and then there's the sovereignty argument, for which people's perspective varies immensely.

[@neodym5809]

@@davidevans3223 You of course have numbers to prove that, and sources. Especially as digital economy means services, and services are not covered by WTO and most FTAs.

[@user-td9th8vr4f]

@@lookingforsomething So allowing the EU to impose increasing regulations on the UK would have provided us with more sovereignty? Possibly a better economic outlook to begin whilst trade deals are being struck which was always going to be the case but most of Europe don't seem to have benefited from being within the EU with most countries declining in prosperity since joining, Greece has gone no where. If Nordic countries can achieve sovereignty and favourable trade deals outside the EU, why can't England? In essence Biden is pro EU so would prefer to frustrate matters for Boris, whether as Trump would have made a quick deal with the UK as he is anti-EU.

[@davidevans3223]

@@neodym5809 we've only just left the eu and we are working on deals everywhere the Asian trade block where the real growth is India that will overtake the eu eventually it's clearly going to take year's for some and for now WTO will do it's already paying off as for the figures it's far more than just financial services

[@jameshoopes6467]

One small disagreement. The issue of Ireland isn’t just important to Biden, it’s important to enough of Congress to make passing any trade deal with the UK difficult to say the least.

[@tiago7720]

lol either way the US house didnt want the trade deal. Overall US likes its dependency on china. UK doesn't bring much

[@sonegreat]

Well he is pretty proud of his Irish ancestry and was a prominant member of US Senate when GFA was negotiated and signed.

[@markshirley01]

Democrats and Republicans know if they let the UK piss about with the protocol because a trade deal lets them it'll bite them in the bum.

[@Duck-wc9de]

biden doenst care, but lots of people in the US do. and those people are voters, and some of them live in swing states

[@internationalarmy3984]

As a person living in the US the government collapsed because of the infrastructure bills

[@PerryUK]

Bozo being slapped around on the International stage has been comedy gold

[@lesserspottedmugwump.363]

He hasn’t though has he.

[@indogoUI]

@@lesserspottedmugwump.363 oh boy but he has

[@lesserspottedmugwump.363]

@@indogoUI oh no he hasn’t.

[@PerryUK]

@@lesserspottedmugwump.363 And apart from being slapped around, he's embarrassed himself with the nonsensical utter drivel & out and out lies he's been spouting.😂😂

[@jonathanbowen3640]

He really hasn't been slapped around. he's done pretty well of late, with COP, AUKUS etc

[@augustus331]

I wouldn't jump into a trade deal with the UK currently, as the UK has broken many deals made with the EU in the last two years. They've become an unreliable partner.

[@shaky2004]

But surely it's a little different in this regard? The UK didn't just wake up one day and break all the deals. It was a two year process of a country choosing to leave the EU, and the protocols for doing so were followed. I don't think this alone should make the UK look unreliable. In fact, I would argue the opposite, in that it shows at least that the UK honours proceedings and protocols that it previously subscribed to.

[@danielnascimento6482]

@@Gary-bz1rf EU never actually blocked the vaccines unlike the UK which hogged all Astrozeneca vaccines and not allowing EU contracts to be fulfilled and then shooting itself on the foot when Astrozeneca became obsolete in the fight against Covid...Insert Vernon Dursley "Justice!" GIF

[@lesserspottedmugwump.363]

@@danielnascimento6482 Tell yourself that, it’s got bells on.

[@edwardbernthal160]

@@Gary-bz1rf hahahahaaa, you really should really think about a career change, stand up comedians have far more than trolls and tw@ts,

[@danielnascimento6482]

@@lesserspottedmugwump.363 of course, you are totally right! that's why since April that EU has exported more vaccines abroad than it has actually used within the bloc with the second main receiver of said doses being the UK, because EU is nothing but a big bad meanie...you are so right

[@christopherg2347]

"We would be deal makers" translation: "We will beg to get into existing trade agreements between countries that are 1-2 oceans away."

[@Doso777]

UK trade deals: Copy/paste, copy/paste.....

[@christopherg2347]

@@Doso777 "Would you like to continue the deal we have with the EU?"

[@simonrodgers2375]

Obviously you've got a problem with the EU trading with countries that are oceans apart then huh, or are you going to be a typical thick AF hugely hypocritical rejoiniac and claim that that's *'different'* ? Also business isn't begging, name me one business that doesn't put itself out there to generate trade. - it's just simple business 101 you clown.

[@christopherg2347]

@@simonrodgers2375 Maybe stop using your Russian bot account when doing Brexiteer trolling?

[@simonrodgers2375]

@@christopherg2347 Claiming that I'm trolling is always the goto when you're faced with facts isn't it. It's as though you're all that brainwashed and unable to accept reality that you need to somehow invalidate my comments. Straight up have you got an issue with the EU trading with countries on the other side of the globe, yes or no ?

[@C.J.M..]

Oh well, the UK still has “all the cards it held” during negotiations. They’ve still gotta be worth something, right? Collector’s items? Limited edition. Mint condition. Remember when Brexiteers thought the UK could keep all the benefits of being in the EU without the regulations and costs? Ah, nostalgia.

[@lesserspottedmugwump.363]

Yeah, we’re out. We got what we wanted, the cards have been played and that game is over???? Have you been in a coma and just woken up, negotiations are over. Hahahaha, I bet you thought you were smart writing that. Go back to bed.

[@indogoUI]

Problem is those cards were the joker cards

[@C.J.M..]

@@lesserspottedmugwump.363 that game was lost, mate, never got to play the cards.

[@lesserspottedmugwump.363]

@@C.J.M.. We are out, we lost the fish and had to pay a bill. Not a bad trade off. The fishermen are pretty mad though.

[@johnpotts8308]

It's a bit like a man leaving a 20 year old marriage and claiming he's now free to see younger, hotter women. Technically it's true, but they may not see a balding, middle aged guy as much of a catch!

[@robertregan637]

Also during Trump being President both houses said they would not pass and trade deal it was and still is dead on the water.

[@DM-rp9ik]

Yeah I'd said it here before but the UK and UK media seem to have a fundamental mis understanding of the US.

[@huskytail]

@@DM-rp9ik it's just wishful thinking

[@lesserspottedmugwump.363]

@@DM-rp9ik Sajid Javid and JP Morgan say otherwise. We are not trading corn syrup for tea bags. Murica.

[@archvaldor]

Thank God. Why would you make a deal with Trump-a man who brags about how he screws people over in business deals?

[@jamesberry5578]

Not true, amigo. You are being flippant with the facts. If the GFA was put into jeopardy is the bit you missed out,buddy. All the Yanks need to realise is that it's already in jeopardy through the actions of the EU and its Vassals in Dublin. This is gradually getting through. Slainte.

[@Gillemear]

Shocking that a US President knew more about US trade deals back in 2016 than the Brexiteers, past and present

[@baristurkmen2342]

Is it though? :'D

[@pilgrim....]

No .

[@Gillemear]

@@baristurkmen2342 I know, sarcasm is hard to get in text form 😕

[@cookiecola5852]

The Brexit movement and Trump movement was sorta a match made in hell, both backing each others up on issues neither of them have any clues about or any interest in...

[@cutestbear3327]

"would you be interested in a trade agreement with England?" -Elizabeth I, Civ5

[@swaggerc4921]

@Jinx Vanderz You can see that both ways to be honest. We brought technological and industrial institutions to third world countries that would've otherwise been severely behind Europe and North America.

[@neodym5809]

@@swaggerc4921 Ok, name them.

[@davidpeterson5647]

@@Letme_Speak Only to be told to get the hell out because they're not sufficiently "English" enough, AKA pasty-white and/or dour enough to live in England.

[@ConstructiveMinds100]

@@swaggerc4921 are you talking about gold and other precious minerals legitimately being stolen for few centuries. First under colonies names then when it became unconvinient you change the name for the COMMON WEALTH. PURE MARKETING GIMMICK FOR THE NAIVE PEOPLE. ANYBODY WHO supports monarchs in 21century is spitting on metaphorically on any old and modern colony and its people.

[@clovebeans713]

@@swaggerc4921 You dont have to be colonized to get technology and industry, ever heard of japan?

[@hurri7720]

I have a feeling, and I really hope, people in Britain has to start to take things seriously. The country is now run by clowns.

[@danguee1]

Sadly, those who voted Brexit and then voted Johnson an outright majority are still in denial. The papers they read - Mail, Sun, Express, Telegraph, Times - are still telling the same lies that the ignorant readers lap up. Poll's show there is currently a slim majority for vote remain 'if you could vote again' - but vote Brexit is only just behind. Mind-boggling....

[@criticalmoistrat6556]

@@danguee1 would you know a site/paper/program that isnt bias? Asking cause I'm interested in what's going on without the, well, biasism

[@davidr9991]

@@danguee1 One man behind all those papers . Murdoch's views are infiltrating every household now .

[@ketugrahagraha3673]

One of which apparently has no money to pay for his haircut. :-)))

[@tituscassiusseverus6303]

Jobs from immigrants NO Fishing rights from our waters NO Cheaper imports NO Screwed again by the rich YES!

[@gorebello]

Who is surprised? Looks like giving up on leverage makes it harder to negotiate anything

[@Obscurai]

Loved the clip of Obama warning the UK that would be the result. Another case of emotion overruling reality.

[@0w784g]

@@Obscurai You're obviously not aware that was a position he was encouraged to take by the former UK PM.

[@Obscurai]

@@0w784g Encouraged or not, that reality has come to pass and is irrelevant.

[@keepyourselfsafe1386]

@@0w784g It doesn't really change the fact that everything he said was spot on and it all came true.

[@kristJ25]

True, "Many a truth has been spoken in jest" William Shakespeare. Obama said the UK will be last in the que as if jesting now we know what he meant. Boris thinks he can go on a charm offensive in the US🤪🤔

[@wrekin]

The U.K. still hasn’t learned that it is now a small bit player on the world stage. Yes Mr Johnson, time to grow up.

[@lesserspottedmugwump.363]

Cope.

[@lorrainelane6583]

Rubbish 🇬🇧

[@thomasowen2585]

We are not a small player, but it’s true we are smaller than we used to be. British values don’t always align with the continent and it can be more effective to negotiate as a smaller, but more unanimous block.

[@willmoore505]

6th largest economy in the world. You're not making sense.

[@dairallan]

@@willmoore505 It makes perfect sense. As Obama said in his answer, its all about Blocs. Being the 6th largest economy in the world is pretty meaningless when only the US, Japan and China are considered worth dealing with as an individual economy. After those three exceptions, its all about aligning with blocs, deals wit the EU (haha), ASEAN, CONMEBOL, ACTFA, etc. The UK is not a meaningful player in this arena. And this is ALL BEFORE YOU CONSIDER THE UK RELIANCE ON SERVICES which literally NO COUNTRY IS INTERESTED IN PROVIDED ACCESS FOR. They all want to develop their own knowledge economies. The focus of all trade deals is on goods, which, short sightedly, the UK gave up being a signficant player in long ago.

[@JimRFF]

"As you might have seen, Boris Johnson's been in the US this week..." Me, an American: ... um... yep... I, uh, definitely knew that... was happening... *ahem*

[@evilgenius919]

It was as part of the UN general assembly not a personal state visit. He hasn't been that important so it didn't hit headlines.

[@barleysixseventwo6665]

Which I think says a lot about British standing in the world.

[@lesserspottedmugwump.363]

@@barleysixseventwo6665 What is it with all you weirdos, “standing in the world, a larger voice in Europe ”. You criticise the Brexit guys about Empire but you seem to be obsessed. I voted Brexit, we are a small island and we want to be left alone. That’s it, no interference. Bye.

[@zylnexxd842]

@@barleysixseventwo6665 No it doesn't. Most people probably don't know about China's leader's visits to a lot of countries. Doesn't make them irrelevant. Your logic and u are dumb

[@lesserspottedmugwump.363]

@@xunqianbaidu6917 What, it wasn’t grovelling they are our biggest investor. We are theirs. 5 Mill Brits work in US companies (I’m one), 5 million Americans work in U.K. companies. It was all standard, the only thing of note was that Biden didn’t take questions.

[@thetowerfantasymusic]

We're over here talking about Biden like he's the only one that matters. the US has 2 chambers, neither of them would be keen on this deal

[@DM-rp9ik]

The UK seems the have a fundamental mis understanding of the USA and its people. They seem to say special relationship then walk off out of the conversation.

[@RK-zf1jm]

Yes lots of Americans like to pre tend they are Irish they arent at most they have Irish ancestory but your not actually irish. If it worked like that I could claim to be Norweigan Dutch Swedish.French ,Italian or Finnish as the area where i was born was settled and raided by Romans Britons Celts Vikings and finally the french. But since i was born in England i am going to say am English because anything else is ridiculous same as the yanks you were born the states your American end of.Not a surprise though given the IRA were allowed to fund raise for guns like they were a charity openly in the states until bill clinton put a stop to that apparently seeing a 4 year old girl get blown up on live tv was too much and people in the states realised that funding bombers for your oldest and only real ally was actually a pretty shitty thing to do.

[@Scriptedviolince]

@@RK-zf1jmthe consensus in Ireland is that they're "Irish enough" to count. They keep in touch with their cultural roots and cultural heritage. They cook the same foods. They celebrate the same holidays. Venerate the same histories. They're all Papists. I also say they're Irish enough. I'd also remind you that even without official support, the donations and guns never stopped. The guy who orchestrated the largest such operation spent like a year in jail and was released with his fortunes and reputation intact.

[@malahammer]

@@RK-zf1jm This is why they call themselves Irish Americans. Same is Italy Americans, African American and so on. It's what Americans do.

[@Hrafnskald]

Because the President has the power to persue, delay, or sabotage any potential trade deal with ease. Congressional approval is one of the final steps, but it will never even come to a vote, or exist as an agreement, unless the President is on board. See: US leaving TPP negotiations without any Congressional action.

[@majormoolah5056]

"Nothing was agreed in Trump's four years." That should be his official presidential biography.

[@benwilson6145]

"The Art of the Deal"

[@yohaneschristianp]

Art of saying yes and no in the same time

[@mxjaz82]

Signed 3 middle East peace treaties but legacy media didn't report on it

[@cookiecola5852]

No Fire and Fury is by far the best, but Chaos and Madness would fit him more:)

[@istandout321]

Soon he will join china & Russia because that’s his last option it seems 😂🤦🏻‍♀️

[@abbersj2935]

That's where the grubby money to be laundered comes from, so why not go the whole hog..

[@gerrycastlemanwarde5933]

He will follow in the steps of Donald Dump sucking up to Russia!

[@abbersj2935]

@@gerrycastlemanwarde5933 True, after all, there are only two options left, reese moog has already done that too.

[@westay4924]

@@gerrycastlemanwarde5933 at least he was better than Biden

[@Knightvzla]

I've heard that ASEAN has an open sit, maybe Borin would like to apply for it

[@meneither3834]

The UK is reaching Cuban level of ignoring geography.

[@willmoore505]

China doesn't sell anything, due to geography. Does it.

[@benghazi4216]

@@gorebello Sure, but if even the Soviets keeps you at arms length because you are bat sh*t crazy, it does say something.

[@svenNL]

@@willmoore505 true, I suggest making mimimum wage £1/hour, get rid of these pesky services and focus on goods instead. We can become the China of Europe.

[@the80386]

Cuba was forced to be in that position, but UK brought it to themselves.

[@willmoore505]

@@svenNL that's Rumanias job.

[@JayJay5244]

The UK just sounds desperate to be a part of a club… Any club will do… no matter where lol… except for Europe of course

[@anirbanbandyopadhyay3553]

😂🤣😂🤣😂🤣👍👍👍

[@weeguy52]

Clearly you don't know how trade deals work(I'm no expert) but we need trade deals everyone does expect everyone wants to make a pack and trade only in those packs,until they want something exclusive

[@JayJay5244]

@@weeguy52 Clearly you can’t get a joke when you see one… I’m very familiar with trade deals thank you though

[@weeguy52]

@@JayJay5244 yeah joke..sure mate😏..it never came across that if it was a joke you can't be certain because this the internet after all🤔 and everyone see takes in things separately?

[@paulcronin3626]

@@JayJay5244 I think weeguy might be in a Siberian basement

[@DaDunge]

If Biden wanted a trade deal there would be a trade deal, countries are capable of multitasking.

[@morairskosana]

Exactly. It could have been announced at the same time as the AUKUS deal. Trade deals are a lot less stressful and tense compared to military ones

[@neodym5809]

@@morairskosana No, they arent.

[@Javadamutt]

You would think tho Biden does struggle to remember na. I wouldn`t hold much hope for him having the capacity to multitask

[@neodym5809]

@@Javadamutt Because he runs the whole country by himself and does not literally have a whole trade department to take care...

[@user-td9th8vr4f]

Biden is pro EU that's why he wants to frustrate Brexit, there is no explanation why he won't make one unsurprisingly

[@Bolsonaro_em_Haia]

Some form of UK-US trade deal is of course possible. It is however preposterous to expect it to be in any way, shape or form a significant compensation for the losses that came with Brexit. Geography alone is by itself a pretty good deterrent for any great significance of such a trade deal... but even if the UK and the US shared a land border it would be very unrealistic to expect much benefit from renouncing a very active voice in one of the most influential bodies in existence in exchange for becoming the junior partner in a rival arrangement that may not even be larger or more significant than the EU overall. And the UK would very much be the junior partner. There is no comparison between the ability to produce either goods or services of the US and those of the UK. Being the sole producer of scotch whisky only buys so much leverage. All in all, the trade deal with the US looks a lot like CANZUK to me. While it is certainly possible to materialize _something_ to call by those names, both are in truth mirages with no substance and that is hardly a surprise to anyone who cares about facts.

[@abbersj2935]

I really don't think any person now sees brexshit as a good thing, I even noticed that farages finance advert has been reworded to now say "brexit is done, other than a couple of issues" Or such wording which I don't think it did previously. It's only now the embarrassment of reality and pig headed mindsets that preserve their straw clutching actions.

[@niweshlekhak9646]

@@abbersj2935 Parliament indirectly asking Prince Charles for help is as embarrassing as it gets. Prince Charles is great at nailing private business deals done of the Royal Family but that won't necessarily translate to UK deals, he has helped with car deals because he owns a large share in BMW and he had a Ludacris idea of trying to make Zimbabwe part of the UK which might work if cards are played the right way.

[@abbersj2935]

@@niweshlekhak9646 I had not seen that, if it's true, it really is desperate. The tories and their acolytes truly don't understand that the days of subservience are over. They cannot get their heads around the idea that it's (other than their corrupt actions) just performance today that matters. Any rushed (as all of ours have been) deal with the U.S. will be disastrous for the U.K. It's putting children in the ring with pro boxers. Our negotiators aren't even in long trousers yet!

[@niweshlekhak9646]

@@abbersj2935 Tories if actually acted like Tories than we might have some good deals, they are acting Centerist. In Canada when conservatives got a proper right wing leader instead of centrist party leader in 2006 in Stephen Harper, Canada went from having 6 trade deals to 45 trade deals in span of 9 years, Harper made Canada the richest country in G7 with 0 debt and 10 billion dollar profit.

[@abbersj2935]

@@niweshlekhak9646 Are they? To me, they are acting as far right fascists. They are nothing like the tory party of 40 years ago. They are not interested at all in the good of the nation where it deviates from their own selfish interests. The corruption, nepotism and lies are now carried out on an industrial scale in a completely bare faced way, never seen before in the UK. Where are the likes of Heseltine and Clarke who where in the middle so to speak. Even Thatcher would throw this lot out! The world has changed, we are too small to go it alone unless one has an edge in some way. We have but they have been neglected for a long time.

[@ollyje9667]

Britain ended up being comprehensively out-negotiated over Brexit and saddled with a flawed withdrawal agreement and a deeply disadvantageous future relationship, both of which will cause us major problems for decades to come. The EU’s success and the UK’s failure can give us valuable lessons. First, the EU side was professional and properly prepared, whereas the UK was not. When negotiations opened, there was a photo of Barnier sitting with a file full of papers on the table in front of him while David Davis had nothing at all. The reality was far worse. Barnier was apparently astounded by Davis’s nonchalant approach There unity of the 27 member states, even when the likes of Farage said otherwise to help his own cause. This was unexpected for the British, that forced them to finally agree to pay their full share of the withdrawal agreement bill. The British side repeatedly tried to negotiate with individual member states rather than the Commission, but kept being sent back to Barnier. Even at the last moment, Boris Johnson's "oven ready deal" had cause for concern and he tried to phone Angela Merkel and Emmanuel Macron, but both leaders refused to take his call. The EU knew what it wanted and stuck to it. The British government spent a year negotiating rancorously and publicly with itself, which allowed the EU to take the initiative, set the agenda and frame the negotiations as it wished. It decided from the beginning that it would separate the divorce agreement from discussions on the future relationship, so the British could not use paying the leaving bill to buy access to parts of the single market. Britain tilted hopelessly at trying to change that sequence and tied its hands early on by setting out its red lines. Listening to Mrs May's Lancaster House speech, The EU watched with amusement and horror as the British tore themselves apart closing so many doors.The British failed because Johnson made the disastrous tactical decision to try to provoke the EU in the hope it would be shaken. The British approach backfired spectacularly. In October 2020, David Frost cancelled negotiations and refused to resume them unless the EU publicly changed its position and recognised UK “sovereignty”. A week later he had to humiliatingly crawl back to the table. The EU used deadlines effectively to get its way, whereas the UK walked into a series of traps. May unnecessarily triggered Article 50, which started a two-year stopwatch, without a clear vision of what she wanted. The British set a time limit that worked against themselves.Sadly, Northern Ireland became collateral damage in this. Boris knew absolutely what he was agreeing to when he signed up to a border in the Irish Sea, then Boris told the press shortly after that there would be no controls on goods between Britain and Northern Ireland which is not what the withdrawal agreement said. The fact is, The EU set the framework and the UK was unable to escape. It is insane that a great country like the UK is conducting such a negotiation and taking such a decision without having any clear vision of it or a majority to support it. There is definitely something wrong with the British system, every passing day shows that the UK has not realised the consequences of what is truly at stake.

[@mikefish8226]

Some of the above is true, some not. The main problem was always that the political classes and the civil service didn't want to leave the EU hence initial negotiations that were comical. The UK was badly letdown by post referendum Remainers, and they haven't yet (and probably never will) admit what they did to undermine the country.

[@rainerzufall42]

@@mikefish8226 Don't you blame the remainers, when the whole idea was rubbish!

[@mikefish8226]

@@rainerzufall42 Why is the whole idea rubbish? The Bank of England (a very pro-EU organisation) brought out a report in which it stated that membership of the EU had suppressed wages for a quarter of workers, mostly those who could least afford it. The EU has massive youth unemployment which would have been much worse without the UK. On the Remainers, of course they should be held responsible for their undemocratic actions. They acted terribly after the referendum.

[@Marcusjnmc]

@@rainerzufall42 he's not blaming the remainers when he says he's blaming the remainers, he's blaming the politicians who he's calling the remainers , it's a fairly common outlook on the political situation around brexit in the uk amoung brexit supporters

[@ausbrum]

@@mikefish8226 The PM of Malta,which is in the Commonwealth and the EU, said at the time (of negotiation) that the EU negotiators were always two steps ahead.Sorry to burst your bubble but it is GOVERNMENT not the Civil Service which runs the show, and, since Britain at least pretends to be a democracy you could hardly expect those opposed not to be opposed

[@TheDrexxus]

Brexit was basically some kid who didn't like the rules of baseball decided instead of playing with anyone else, would be better off playing by himself to make up his own rules. Then after burning all his bridges with his old friends, realized you can't play baseball without a team. WHOOPS. And like anyone whose pride exceeds their intellect, he goes home to his mother and brags about how much better it is for him to be playing alone even though he is dying inside.

[@user-hp5fz3qs1u]

At least we are free of the EU (thank god) your still a Prisoner of the EU . Thank god for Brexit . You better ask The EU what you can and can't eat today

[@TheGamingSyndrom]

@@user-hp5fz3qs1u is your comment satire? you are pointing out PRECISELY the point the person tried to make

[@damienreilly4347]

Baseball is a boring game, not even in a metaphor would anyone want to play it haha

[@mr.coolmug3181]

Yep, and that's how cricket was born. Played in 106 countries around the world 👍

[@mr.coolmug3181]

@PatchesRips touché

[@francesco8000]

The simple reality is that the UK didn't join the european union because they were crazy but because it is the most logical trade partner. You can do all the referendum you want but you can't change geography.

[@neodym5809]

The UK joined the EU because they were broke and desperate.

[@arrgghh1555]

@@neodym5809 So they left to become broke and desperate again? It's not my preferred state if affairs, but you do you UK.

[@lesserspottedmugwump.363]

@@arrgghh1555 How are the Germans enjoying their new tax bill? Must sting a bit.

[@XLEECHIX]

@@neodym5809 Had nothing to do with spending billions to save Europe though right and desperate is waving the white flag. Us brits don't give up so easily, we will be fine.

[@neodym5809]

@@lesserspottedmugwump.363 taxes are the same in Germany to my knowledge. It is the UK increasing taxation.

[@LemonGingerHoney]

I heard that Martian Republic and Jovian Empire are looking for new trade routes. Might be a nice idea to apply. SpaceX could lift the goods to space.

[@psikogeek]

..and the Kessel Run can be no worse than an economy transatlantic flight.

[@simonrodgers2375]

Yet you're okay with your beloved EU trading with countries on the other side of the planet. You lot are trying to normalise hypocrisy, it's pretty crazy to see.

[@nikosoikonomidis3324]

@@simonrodgers2375 Kremlin bots are now commenting under videos in English, which are not related to Russia 🤣

[@cyclometre]

NAH! Too many unicorns in the flight paths!

[@Paul_Davies]

A little disappointed there wasn't a Kermit the Frog reference

[@Spirit451]

It's right to be green!

[@davidevans3223]

The whole world is talking about that commet isn't that the point of a speech

[@gareth6326]

@@davidevans3223 wouldn't it be better if people were talking about the important content of the speech, rather than an unoriginal joke

[@gerrabath]

@@davidevans3223 The whole world? You wish. LoL!

[@therealrobertbirchall]

@@gareth6326 because every other word of the clowns speech was a lie.

[@augustus331]

So the UK left the EU to forge new trade treaties with other countries, but will either have to compromise on their health-standards (chlorinated chicken), or join agreements that the UK was never meant to join. How is this preferable from enjoying the dozens of trade agreements the EU has with countries of the Mercosur to ASEAN or the US?

[@NightBlado]

Well Scots do understand this!

[@ark_ryl9384]

Because the EU is shifting away from the US as a trade partner and more towards China, which is something that went surprisingly under-represented in the Brexit debate.

[@bogdanmeoff2399]

@@NightBlado England is your biggest trade partner by a landmile SCOTIP fool.

[@0w784g]

Well, here's a few quick reasons I can think of: 1. No more net payer contributions. 2. No unelected commission. 3. No gravy-train EU parliament. 4. No gravy-train EU beaurocracy. 5. No legislative dictates that go beyond trade. 6. No ECJ usurping common law tradition. 7. No more CAP. 8. No more CFP. There's obviously many more.

[@paulcronin3626]

@@0w784g enjoy the brexit 😈

[@sunrae3971]

Since Brexit UK stands for "United Karens" in the rest of Europe.

[@weeguy52]

Nah your thinking of the french lol and that's the reason why we left Europe too many Karen's and bullsh*t policies

[@sunrae3971]

@@weeguy52 "bullsh*t policies" like introducing the imperial system or pseudo-taxes to cover brexit. Another Brexit Karen.

[@isnitjustkit]

@@sunrae3971 Murdered them

[@weeguy52]

@@sunrae3971 looks like brexit hurt your little feelings even on an emotional level🤭..we're sorry🤣..why are so upset about it anyway?..or this just random hate because you've got nothing better to do(i personally think your just hating)

[@weeguy52]

@@sunrae3971 YES bullsh*t policies..look don't get upset because we left and the EU lost one of it's biggest players..it's done so get over it..im happy we left because we get to make our decisions and at a faster pace..maybe you should look into why we left in the first place instead of crying about it

[@TheTrackRecord]

It's kind of embarrassing that a non-brit seemingly cares more about a part of the UK than we do.

[@evilgenius919]

I mean to be fair the UK hasn't ever seemed particularly sensitive to the needs of NI.

[@benjamin2149]

Well, given that UK has at least 17,4 million unpatriotic inhabitants this does not really come as a suprise...

[@tyan_ldn]

@@benjamin2149 I don't know if the number is that high

[@Bolt451]

@@tyan_ldn it’s roughly a third of the uk population

[@sheela-na-giga-byte8397]

"UK"... If this is unity I'd hate to see discord.

[@getnohappy]

It was never really made clear how a US trade deal would be beneficial for those of us without shares in US health and pharmaceutical industry

[@cykablyat6531]

US trade negotiator: "Look, Boris, it's easy: I give you tons of chlorinated chicken & hormone-fed beef and you give me your NHS. Win-win! Sign here."

[@lesserspottedmugwump.363]

The NHS doesn’t make any money, it’s a money pit. No one would buy it.

[@boribori8260]

@@lesserspottedmugwump.363 I am pretty sure that US companies find out the way how to get a lot of money from NHS.

[@cykablyat6531]

@@lesserspottedmugwump.363 Maybe the British-managed NHS doesn’t make any money.. but you can rest assured that a US-managed NHS will make a lot of money.. 2019 Per capita health spending USD: UK *4,653* US *11,072* .. Big difference, it means US healthcare is a cash machine.. And a US-managed NHS will be same..

[@lesserspottedmugwump.363]

@@cykablyat6531 The US is a strange one, they don’t allow insurance companies to compete. So you end up with a monopoly. Raises costs.

[@lesserspottedmugwump.363]

@@boribori8260 It accounts for 40% public spending, I don’t think there’s much left to squeeze. It would be political suicide anyway, even the conservatives mention the NHS every 10 seconds.

[@AlexJones-ue1ll]

Its technically true that Brexit Britain could strike unique trade deals better suited to the UK. However, in order to do that, you'd need someone actually knowing what they are doing. Not have Liz "Roll-over" Truss agree to everything put in front of her and claim it as a success when in reality, its always the other side getting what they want.

[@davidpeterson5647]

It's colloquially known as "hustlin' backwards" in the US.

[@carwyngriffiths]

Amen

[@stephenconway2468]

I agree. The first step before looking for a trade deal is to do a proper detailed assessment of what we need. This has no happened. The landscape for trade has changed dramatically over the last 5 years and yet no assessment has been done.

[@frankwalker5040]

Teresa May "You need us more than we need you" to the EU.

[@Me-vx5gc]

EU: "okay ".

[@Anonymos321]

😂🤣😂

[@rrecee2639]

It wasn't just May who mouthed that line. I met people with degrees from respectable universities in well paid jobs, great career prospects who said they had read books about the EU and their conclusion was either 'they need us' or 'they need us more than we need them'. So far it appears to not be working out.

[@MightySteve001]

There are huge markets across the Channel. What on earth did we leave the EU !. Now we got virtually no markets at all. The Americans can now set the rules when there is a trade deal.

[@BillyBob-bv1bk]

Yeah UK had the entire EU market to trade with 😬

[@billpugh58]

How did the UN cope with his extravagant Churchillian oratory concerning the Muppet Show? We will be rolling in trade deals and friends after that surely.........

[@20quid]

The real question is "Why is Britain flailing?" and the answer is "Brexit".

[@t.miller8456]

Britain started flailing when they lost their colonial empire. Brexit is just their last temper-tantrum, trying to show the world they're still a big power, becoming increasingly irrelevant the longer they're out.

[@kylekgh]

Funny to watch these leavers and the working class tory voters sweat now they realise they may have fucked it

[@alexpostma645]

They wil blame the eu most likley for there own fallings

[@NuclearSavety]

Why is UK failing? Simple answer: Eaton ....

[@PGraveDigger1]

@@Letme_Speak The UK House of Lords is unelected and has the final say on any UK laws that are passed. How is that less dictatorial than Brussels?

[@Accessless]

If only the entire of the UK would go vegetarian/pescitarian, then this all encompassing chicken problem would go away.

[@danguee1]

We could eat all those fish we can now catch but not export. Err - except there aren't any 'nasty European' lorry drivers to distribute the fish....

[@sirBrouwer]

@@danguee1 let the fish drive the lorries?

[@teetrotter2973]

Did you know plants scream when you touch them!? Look it up lol

[@Marcusjnmc]

pretty much, we still consume geofoods second hand via farmed fish & some other local meat produce anyway

[@Marcusjnmc]

@@danguee1 that and sardines aren't popular in the uk, while still being a major part of the uk fishing industry's infrastructure

[@SweSuf]

Well, it may not have appeared to all, but there is actually another trade block the UK might want to join, and closer too, it's the EU! Oh, you can't? Why?

[@sionsmedia8249]

Why would the UK want to get closer to the EU? The trade deal the UK currently has with the EU while it isn't perfect, it is good enough for now, and some people might not know this, but the UK can renegotiate the parts which could be better. The UK is on the periphery of Europe, so it would be difficult for the UK to get closer to the EU while not damaging it's external relationships outside of Europe. As an example Norway is also on the periphery of Europe and they're only in the EEA (not full EU) and they're even considering leaving that.

[@paulcronin3626]

@@sionsmedia8249 it's not easy being you

[@MrSzwarz]

It was always so obvious, that UK will NOT have any new preferential "deal" with the USA. For US Irish interests only are important. British exceptionalism, and expectations have misfired. Period. Good on the USA! Bojo is loosing all his "cards"

[@wulfeman9948]

the democrats want one world order ..when biden took over they want the brits to rejoin the eu and bow to the new rulers

[@BewareTheLilyOfTheValley]

Not watched a video in a moment and I come back to see this new style. I really like this! Nice to see your face, hello there :)

[@meneither3834]

Yeah it's as if the EU had a reason to reject the deal with the US.

[@aiswaryabersan7983]

Britian : long live the queen Others : yeah keep your Granny

[@_.august4243]

so nobody’s going to talk about the face that Obama said queue rather than line-

[@MrTheBoycie]

What's the difference

[@anter176]

Think it's a British vs American vocabulary thing? Not super sure

[@_.august4243]

@@MrTheBoycie in the UK we say queue, in the usa they say line. americans don’t use the word ‘queue’. the slime ball known as david cameron made a script for obama to read out. he might be a cool dude, but all my respect for him went when he interfered with brexshit.

[@MrTheBoycie]

@@_.august4243 well I'm born and bread from Nottingham UK. We say both. As there both English words with simular but also alternative meanings. Please explain why saying line was a problem.

[@_.august4243]

@@MrTheBoycie because obama interfered with brexit. the speech was scripted because cameron didn’t want to leave the eu.

[@karimhabsi6508]

I’ve following your channel for about a year now, good content a d very useful.

[@p3u3g3poultree7]

25% of the US electorate is of Irish descent. A war of independence was fought against England. Both of these factors remain a grudge with the US electorate to this day. Where did the English think the IRA got the money from?

[@charlyvanbuuren2947]

Yes there will be a deal. The UK will become US territory a New Puerto Rico in the North Sea...

[@KeithBab]

Not happening. The US doesn't need another useless island* draining it's federal money, especially one that doesn't even have nice beaches and warm weather. (* apologies to Puerto Rico, but you are a bit of mess economically)

[@danielmota1095]

HAHAHAHA and then the US will have a garage sale with free paper towels

[@somerelativleyuninterestin4763]

I’m honestly enjoying the fact that people can’t say your videos are bias rn considering this is literally what they’re doing

[@lesserspottedmugwump.363]

They can and they will. It is a left wing Labour remain biased channel. Look at the comment section, people only listen to what they want to hear nowadays. It’s full of remainer weirdos obsessed by Brexit. I find it hilarious.

[@roryokane5907]

@@lesserspottedmugwump.363 of course it is.

[@simonrodgers2375]

@@lesserspottedmugwump.363 it is quite funny, they blame everything on brexit don't they they're obsessed. This recent oil situation which is a global issue is a fine example. When you point out that these issues are global they always fall back on the 'YeAh BuT it'S WoRSE In UK CoS BrEXit' excuse 🤣🤣🤦‍♂️

[@mariogeorgiev3085]

​@@simonrodgers2375 You got your talking points from daily express who's only material is brexit, eu blah blah blah so you are being a hypocrite about obsession over brexit. This is also the same talking point as americans asking why the world is interested in their political circumstances; maybe its because you're the most powerful country and will affect the world heavily and in this context brexit affects the UK heavily

[@fs7990]

To underestimate how greatly Brexit will affect peace in Ireland is to underestimate how greatly Ireland's future will affect Britain's economic future.

[@ruishka]

I love your videos. The way you put very complex in a chewable format, in a less than a 10 minutes long video is great. Your research folks are top notch. My request ? I would like to learn how to create animations such as you do. Would be grateful for any suggestion.

[@simonjohn9525]

If they teach geography at Eton it must be an optional subject!

[@NightBlado]

I am glad to see how much work and effort the conservative English government has put into the unification of Ireland and the Scottish independence - good job!

[@mattstevensms60]

British government

[@mattstevensms60]

Unless you wanna go down to wards counties with that logic

[@mattstevensms60]

No more large funding from government

[@FortyTwoification]

Quite funny how many tories are responding to this, believing all the garbage they read off facebook and daily mail about subsidising Scotland and NI. Most of them still think BrItAiN RuLeS tHe WaVeS

[@ark_ryl9384]

@@Gary-bz1rf Furthermore, polls have shown that views on Scottish independence haven't really changed since 2014 (within statistical significance.)

[@gene8194]

I am afraid we might be talking about the two chairs and the space between them.

[@louisleycuras8357]

Brexit, the gift that keeps on giving.

[@rocktheqasbah]

Taking you mean?

[@roryokane5907]

This was inevitable with a Biden victory. We can only hope this eventually helps oust the Tories.

[@ameyas7726]

Do you really think America First Donald Duck was ever going to give away any free deals to UK!!?....as a lame duck President, he wouldn't have give a rat's fart about anything anywhere..

[@rufioh]

I’d only be a fan of a US trade deal if we don’t get worse food standards, worse working standards, privatisation of healthcare, poor environmental standards and loss of digital privacy. If BoJo can guarantee that we will not be worse off in any of those areas, then sure

[@madcockney]

@cervellone Do I trust Kermit the Frog?

[@richy3417]

First in line, trousers down and K.Y. jelly at the ready.

[@dhfconst]

Really good video, good job! 👌

[@veselintotev1269]

We will wait for the UK to come back in the EU but this time like a real member, not a "special" one.

[@bellezayverdad]

Maybe in a generation's time. At least 30 will have passed before that happens. A cultural change will have to take place first.

[@tedcrilly46]

@@bellezayverdad Yes I think that cultural change has been happening for some years now. Its been amusing and satisfying to watch.

[@paulcronin3626]

No way, they're out and they're staying out

[@danielwebb8402]

Yeah. That'll be a no.

[@katherinew2189]

Seems fair. Happy to have the Euro instead of the pound with King Charles face

[@thetrainhopper8992]

One thing I always thought was funny conservative Brits thinking they could get into NAFTA - Mexico. Like we'd screw Mexico for the UK.

[@desertdetroiter428]

Lol…I had to laugh at that too.

[@Steve-zc9ht]

So like is the UK going to ignore geography now just to get what they want lol first the Pacific treaty next trying to get involved in North America lol

[@Masaru_kun]

What's not mentioned is how a US trade deal would signal to other EU states that they could get one too. The EU doesn't want that and the US cares more about its relation with the EU.

[@timconway2810]

Would be good if you could do a video about what the problems with chlorinated chicken actually are. There are several, but none of them are ‘you’ll ingest chlorine and get sick’.

[@colmcorbec7031]

Brexit from the Brexit. Episode 38, Season 5.

[@davidsymonds7090]

@@Letme_Speak The UK is in Europe.

[@lyampetit144]

@@Letme_Speak Actually the Uk is in Europe.

[@davidsymonds7090]

@@Letme_Speak Also, as I ask everyone who makes this claim - if the EU was so bad, why didn't you leave during the decades we we within it?

[@davidsymonds7090]

@@Letme_Speak Huh, no answer. Can't imagine why.

[@dylanhunt4303]

no worries !! After they are done messing around the globe, Bojo will say he will get the best trade deal with Pluto and Mars.

[@PropagandasaurusRex]

Rumour has it the Plutonians are not interested.

[@nickynooable]

Great colouring book. Great souvenir for this historical moment.

[@darrenholden7447]

This is one of the best channels on YT. Yes, I am a news nerd!

[@rogergreen2695]

Come on, there's a whole continent- Africa. OH dear some might remember UK 'deals' of the past!

[@MaximilianOOO491]

It’s almost like being in the EU was ALOT better for Britain in every way

[@KrzysztofBob]

It will. It will also lower food standards, employee rights and will be the end of the NHS.

[@aimeerivers]

7:27 nice neon sign! When do we get to see it lit up?!

[@catcatcatcatcatcatcatcatcatca]

The defining factor for UK’s unrealistic expectations for independent trade deals is either blindness to their imperialist position in the past, or lack of the role in present day. It must be super weird how things aren’t working out for those with either blind spot.

[@cardy4ever]

Thoughts on the upcoming Swedish election and new party leader of the social democrats? Would be interesting to see a video on the topic!

[@herlescraft]

there is a form for suggesting topics in the description

[@him_That_is_me]

Speaking as a swede, the impression i and those I've asked think that she is a pretty ill fit. She isn't bad at her job but she is extremely inflexible, seriously lacks charisma, and can't really debate without sounding like a grumpy, unpleasant schoolteacher. During a time of political compromises and breaks between traditional allies, i feel she is exactly the wrong kind of leader.

[@jonathonjubb6626]

Nobody wants us. I wonder why....

[@ninodino444]

"some british cows" that must be the understatement of the century

[@clytemnestra]

It’s almost like the sun has set of the British empire but no one has told BJ yet lmao

[@SuperSmashDolls]

Britain wanting to join NAFTA has severe deal-taker energy.

[@colinbrigham8253]

Thank you 😊

[@bradavon]

Because we need them much more than they need us, we cancelled a trade deal where 40% of our trade goes for a trade deal the Americans were never all that interested in. Brexit amounts to a trade deal with the Australians a load of people dislike. Wonderful vs. of a tonne of real world benefits we've lost. I don't give a frig about sovereignty, it's a meaningless soundbite. I do care about real things we had and don't any more.

[@GTFour]

No disrespect, some constructive feedback for an ADHD viewer; It’s much easier to focus when you’re not on the screen doing the narrating as it distracts from the content.

[@kimhansen8615]

Ha-ha. Joining a new smaller trade block far from home, when you just left the biggest on the planet - Just around the corner :-) Oh Dear...

[@rudynoah8627]

the USMCA is not a small trade dude

[@tpmiranda]

Sound was way to low on this video. A Bolt ad almost ruptured my ears

[@francescakray233]

Thank you.

[@bazzfromthebackground3696]

The US will be more willing to make a deal, when they figure out how to undermine it.

[@Steve-zc9ht]

The USA is in no rush for a new agreement with anyone after Afghanistan it left a nasty taste in the USA mouth and has lost its taste for new deals and new wars the UK has nothing to offer to the USA like literally nothing the USA is in no hurry especially after there scrapped deal with the EU the USA is really not in a position for another deal especially with a struggling economy the midterms coming up in a more divided country and growing usa China tensions

[@PabloTBrave]

The chlorinated chicken is nowhere near as worrying as the steroid and antibiotics beef

[@andrewemerson1613]

I'm kinda convinced that it's like the GMO "debate" in that it's absolutely fine, but sounds scary so people lose their minds over nothing. but yeah, the antibiotics thing is a real problem. not for food safety, but for epidemiology

[@PabloTBrave]

@@andrewemerson1613If I'm not mistaken the EU didn't ban it because of safety , they concluded it was , just it could be used to cover up bad practices in abatoires. A logical solution would be to allow it but force shops and restaurants to declare that it's chlorinated on labels and menus , let the people decide if they want it or. It I suspect many wouldn't eat in restaurant selling it thus forcing restaurant s to go bankrupt or buy normal chicken .

[@lesserspottedmugwump.363]

@@andrewemerson1613 Hormone grown beef contains a lot of Oestrogen, it is cancer causing. I would give it a miss.

[@philipols]

As a Canadian who feels betrayed by the Americans who cancel free trade, I say : why would anyone trust England on a deal now if they could not honor there past deals?

[@dave8599]

seeing as America has defended weak canada for decades, you should shove it.

[@philipols]

@@dave8599 if you defeated us only to betray us then what was the point?

[@philipols]

@@dave8599 Also, did you defend us because we were friends or to make us your slaves? And if it’s the last one tell me again what is the difference between USA, the Soviet Union and China?

[@paulcronin3626]

@@philipols wasting your time, English nationalists are nazis

[@BobBinghamNZ]

The difficulty of trade deals was pointed out by the remainers as they take many years to negotiate. The Trans Pacific Partnership took over ten years.

[@patami2222]

A comprehensive trade deal with the US would be great for the financial industry in London. It would on the other hand destroy several industries in the rest of the country, and it would force the UK to decrease its standards (those who believe the UK can force the US, Canada & Mexico to adopt their higher standards are naive or dreaming). The government could of course still force British producers to keep high standards though this would mean unfair competition (higher standards imply higher costs, and unfortunately most consumers usually go for cheaper products). It's funny because in the end those who voted for Brexit would be the most negatively impacted, while those who voted remain (e.g. Londoners) would benefit the most.

[@madcockney]

The problem is that Boris doesn't really understand how business, trade and the World works. He doesn't even understand how each part of the UK's business, society, etc interact with each other.

[@Ellipsis115]

Obama: 1:23 Trump: 1:53 Pretty much sums it up lol

[@thewingedhussar4188]

Yep, trump mad a promise (he never planned to keep). An people in brexit believed because they felt they had to. An now they will pay the price. Now the real question is when will the uk 🇬🇧 rejoin the EU.

[@anggasurbakti8269]

@@thewingedhussar4188 I think you will become 51st state faster than rejoin EU😂

[@paulhabasescu7602]

@@thewingedhussar4188 we dont want UK back!

[@maxharbig1167]

Not just or even Biden. This from months ago has been notable for its absence in UK media. .“On 17 May 2021 the US Senate passed a resolution reaffirming support for the Good Friday Agreement and the Northern Ireland Protocol. The motion was advanced by Democratic Senator Bob Menendez, the Chairman of the Senate Foreign Relations Committee, and Republican Senator Susan Collins. The resolution calls for support for the full implementation of the Good Friday Agreement, as well as subsequent agreements including the Stormont House Agreement and Northern Ireland Protocol.” If the UK does not honours its obligations regarding the NIP there'snot a snowball's chance in hell of a trade deal with the US.

[@jankeroolz]

Meng Wanzhou's and the two Michaels' release will certainly help smooth things over.

[@Infinitystar225]

Once again Brexit Britain has to face reality, when are the Tories going to realise this was a mistake?

[@augustus331]

When their constituents agree.

[@benjamin2149]

There is a lot more reality in the queue....^^

[@andrewemerson1613]

@@Letme_Speak yup, total socialist dictatorship, what with the conservative majority in the elected parliament

[@lesserspottedmugwump.363]

@@andrewemerson1613 “Conservative” majority, sure buddy. You can call a fork a spoon, it’s still a fork.

[@andrewemerson1613]

@@lesserspottedmugwump.363 oh, then we're to go with the specifically Anglo/American interpretation of "conservative" meaning "specifically going out of ones way to make people's lives worse" I mean, you can just look at the party makeup in the European parliament. heck, even the given example of Germany specifically. conservative government for like 15 years straight

[@ryltair]

"Biden has a lot on his plate" OOOF

[@paulcronin3626]

Bacon and cabbage 💚👍

[@charlesmair26]

Stalling, WTF it hasn't even started yet.