Why flat earthers scare me

Continue learning more about your favorite topics with Brilliant! First 30 days are free and 20% off the annual premium subscription when you use our link ➜ brilliant.org/sabine.
The flat earther community seems to be growing, and it's beginning to worry me. It's not just a question of lacking science education, there is more going on here.
🤓 Check out my new quiz app ➜ quizwithit.com/
💌 Support me on Donorbox ➜ donorbox.org/swtg
📝 Transcripts and written news on Substack ➜ sciencewtg.substack.com/
👉 Transcript with links to references on Patreon ➜ / sabine
📩 Free weekly science newsletter ➜ sabinehossenfelder.com/newsle...
👂 Audio only podcast ➜ open.spotify.com/show/0MkNfXl...
🔗 Join this channel to get access to perks ➜
/ @sabinehossenfelder
🖼️ On instagram ➜ / sciencewtg
#science #conspiracy #flatearth

[@lipsterman1]

Social media has taught me two things. First, there are some incredibly brilliant people in the world. Second, they are vastly outnumbered.

[@DanielFealko]

vastly

[@GeorgeSmiley77]

Okay, but I learned that in school.

[@craigdavidson2977]

There is a theory that if you had an infinite number of monkeys pounding on an infinite number of keyboards then eventually just by random chance they will type all the words to the novel "war and peace". The Internet has proven this theory false.

[@duran9664]

🚩FACT🚩 Flat earthers r TOTALY right when it comes to the fact that many of space videos & photos r CGs, manipulated or fake; including the ones that get released by NASA🤏

[@voidagent]

LOL (Lack of Logic)!

[@alandenton1024]

Wikipedia says "The Flat Earth Society has members from all over the globe" Now that is what i call humour.

[@MR-MR-ud5oo]

Fake encyclopedia

[@Daniel-jm8we]

That was the original statement on FE website.

[@samrowbotham8914]

I call it a logical fallacy.

[@patrickregan3302]

ROFL😂

[@getsideways7257]

Golden :)

[@dianafarmer5445]

As an Aussie I'm worried about them too. They said Australia dosen't exist, so I'm worried about where I've been for the last 65 years.

[@smeeself]

Now you're opening your sheepy eyes to the TRUTH! Cheers from Aotearoa. 😉👍

[@stevenvarner9806]

Your country also resembles a hot dog in their flat earth models.

[@dianafarmer5445]

@@stevenvarner9806 How lovely😅

[@jagobabarron5501]

Your country is nothing but a huge tv studio in area 51.

[@Roybotski]

​@@jagobabarron5501 uh what

[@caravanlifenz]

As a New Zealander, I'm concerned by how dangerously close they've placed us next to the edge of the world where the water drops off 💧😭

[@johnkean6852]

The flat earth society model is unrepresentative of current flat earth beliefs. Do more research before you spout ignorance.

[@russell2952]

No worries. Flat earthers don't have a model. They usually take a polar projection and call that their map, but it obviously doesn't fit any real world observations. As Sabine said, they can't so much as explain a sunrise.

[@jacksonknock1833]

@@russell2952 For real. It always goes like this: - "You still don't have a map" - "Lmao, have you heard of Gleason's? Do your research!" - "None of the distances there seem to correlate with actual real life distances, what's up with that?" And then it's either "It's just a representation, not an actual map" or they just ignore you and pretend the conversation never happened. Same with model. Never seen a flerf take any conversation to its logical conclusion - they always run away.

[@cullen3624]

I have a large wall map of the world and new Zealand isn't even it.😂

[@ZlatnoPeroTV]

Wait, aren't they denying the existence of Australia?

[@Martin_Siegel]

Isaac Asimov said: "Anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that 'my ignorance is just as good as your knowledge."

[@johndonson1603]

As much as I know flat earth theory is completely ridiculous, I disagree with that statement, people have the right to hold views that are clearly wrong , it’s their right as human beings , otherwise we end up with free thought and free speech being censored and controlled by those who believe they know better .

[@puddintame7794]

God save us form the arrogance of the experts.

[@iloveitall]

Brilliant.

[@TheSulross]

that precisely defines the contemporary Woke mind virus

[@Vaeldarg]

@@puddintame7794 Actual experts have earned the right to be arrogant. Amateurs arrogantly claiming to know more than the experts have not.

[@Vohtwomax]

I recently had a....debate with a flat earther. We were proceeding with the discussion up until he told me, AND I QUOTE, “not to use science and logic” when trying to persuade him. So ended THAT conversation.

[@godfreyofbouillon966]

Well that was your first mistake. Someone honestly believing in flat earth has IQ of a chimp at best and no reasonable debate is possible.

[@MyrKnof]

Its because he wont understand it, so he asks you to not talk gibberish. You cant start at that point, because he is too dumb, you need to start at improving his fundamental knowledge of before talking "advanced" stuff like.. simplified gravity.

[@k_tell]

He may have fallen for the charlatan Samuel Rowbotham's so called "Zetetic Method". Interesting question to ask someone who actually believes in the Zetetic Method is "What is the Zetetic Method?".

[@DragonOfTheMortalKombat]

So what were you supposed to use ? Feelings ? Lol You can tell earth ain't by using very common knowledge

[@ryzikx]

there are non-scientific arguments to convince someone out of flat earth

[@whichgodofthousandsmeansno5306]

There is a VERY wide line between healthy skepticism and reality denial. Flat earthers don't see any line at all.

[@ronpapi9539]

Only Flat Lines!ha ha

[@eindbaaz3815]

@@ronpapi9539 I wish they flatlined

[@PartlyXenon]

They see a 3D line!

[@alkaholic4848]

They see the line, but don't believe it's really a line. It's nasa pretending there is a line.

[@ronpapi9539]

@@PartlyXenon No Curved line noted as usual.

[@NastarNordmire]

One thing that I've seen flat earthers do is find every reason to ignore the findings of their own experiments when they prove that the earth is a globe.

[@user-ls1qc8hg2s]

“You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)

[@shadowshatto]

I feel like flat earthers are fearful, I think they are scared of the universe and what it means and just how vast and unknowable it can be. My mom is an antivaxxer and yet she was a nurse and a pretty smart lady, but when you let your fear run away you become irrational and I think scientists laughing off and not taking it seriously will only lead to More of this that will be harder to weed out and fix

[@bob_the_bomb4508]

“Interesting…”

[@davidhollenshead4892]

One killed himself with one of his own experiments, if he was actually being honest about being a flat earther...

[@ronpapi9539]

@@user-ls1qc8hg2s is. Donald Trump!

[@janthony721]

Flat Earthers have nothing to fear but Sphere itself.

[@roberteatwell6827]

Brilliant pun. Love it. Deserves more recognition.

[@TheBreenGene]

Underrated comment for sure

[@paulg444]

That one is for the ages !!

[@vibaj16]

@@roberteatwell6827 i mean, it's a _very_ common joke

[@paulward4268]

janthony721. Magnificent.

[@Mozart4000]

I watch a lot of flat earth stuff on YT. What I've learned is that flat earthers don't want to learn anything. They just want their opinion confirmed. Anything that deviates from that is rejected.

[@knowsomething9384]

"They just want their opinion confirmed" is a common affliction among social media consumers of all kinds, unfortunately.

[@iamTheSnark]

Many are able to escape. STST (Seek Truth Speak Truth) is a notable example. Recently, Rachie 00000 escaped, and she is now a debunker. And not even a bad one. FTFE (FIght the Flat Earth) has his own story of many people who saw his videos, and after a while sent Thank You mail to FTFE, helping them escape the nonsense. There must be more.

[@Kim_YoJong]

That's everyone lol

[@VonJay]

I remember bumping into an old friend of mine from middle school who was actually in my science class. Really cool guy as we got along really well. We went to Highschool together but didn’t hang out much maybe because we never had any classes together. Years later I bump into him and for some reason we talk about the earth being flat. And we argue for hours and hours and it’s crazy to me think that he’d take such a position. He even used “math” and “science” to try to prove his point. I asked him about the astronaut photos and he said fish eye lens to which I said that’s not how a fish eye lens works. It got to the point where I just said “everything you’re saying is irreproducible in the real world. Nothing you’re saying can lead to any type of invention or (like Sabine said) real world prediction. It can only satisfy your paranoia.”

[@ptrinch]

Flat earthers are more interested in the argument than the science. If you ignore them, they won't get what they are looking for and will eventually go away. Alternatively, in the immortal words of the half dozen people attributed to this quote.... "Never argue with stupid people, they will drag you down to their level and then beat you with experience."

[@nikl.astrophoto]

As someone into astrophotography, even we get accused of lying for simply posting images of our hobby. I've been called a CIA asset by some guys on TikTok. Flat earth is like a collective paranoid schizophrenia.

[@johnkean6852]

ASTROPHOTOGRAPHY: Connecting to Nasa CGI images of space and convincing yourself they're REAL. Keep taking the pills.

[@whichgodofthousandsmeansno5306]

I am in the satellite radio technologies industry. According to flat earthers I am in on the vast conspiracy to hide the shape literally 99.9999% of people don't care about, or I am also a sheeple being fooled.

[@whichgodofthousandsmeansno5306]

[@lobban2]

What I want to know is why they believe what they believe. What is the point of lying about the shape of the earth?

[@mkx9095]

kzbin.info/www/bejne/p3bEeZ2Ge5lqlacsi=CkC3Hh1CvfdJm9z1

[@Teeb2023]

I am fed up qualifying my concern about flat Earthism / science denialism. So often I'm told while combatting their idiocy, "Just ignore it, they're trolls", "Why does it bother you so much?". The rise in anti-intellectualism is both worrying and increasing, more than anyone might be willing to admit. It is a creeping malady that will have a lasting effect on the human race if we do not staunch the haemorrhage sooner rather than later.

[@mana3735]

It's led to anti-vaxxers.

[@TeaParty1776]

>staunch the haemorrhage remember the alamo

[@randus7053]

Not worried about this because the 20th century showed that rapid technological progress isn't inherently good. I think anti-intellectualism stems from the fact that as people get smarter they get more depressed as people realize no individual can change much of anything, so people reject the words of intellectuals and scientists as a way to assert control. After all the old saying is ignorance is bliss. For the most part I see slow change in technology being an opportunity for people to not be left behind. In any case there has always been culture and counter-culture and I don't see anything unique here, just people being irrational as usual. Some minds can be influenced to change some can't, but one can hope that by abiding by truth the world will get better.

[@yourfavoritefrog]

I understand what you mean and I agree this amount of stupidity is scary . But it is also true that a good amount of them are just trolls, in fact some of them don't really believe in a flat earth to begin with ! They just want to be different , like outrageous teenagers.They want to rock the boat, because it's fun.They want to oppose the mainstream so they feel they exist and they are important, and they want to be heard most of all ! So in the end we don't know how to approach them, do we ? Because arguing , explaining is just pointless. So what is left to us ? Ignore them till this trend passes. Because eventually , it will. Like baggy pants.

[@TeaParty1776]

​@@randus7053 Modern intellectuals are nihilist.

[@mintonmiller]

Maybe we can get them to compromise. First get them to settle on the idea on Earth being a cube. Then we can gradually round off the edges over time.

[@raminagrobis6112]

😂😂

[@johnhough7738]

Genius! I love it ...

[@paulkolodner2445]

I think you're on to something here.

[@goodtouch459]

This or add polygons 😂

[@johnjeffreys6440]

Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.

[@johnmaynard869]

“Those who can make you believe absurdities, can make you commit atrocities.” Voltaire

[@johnmaynard869]

@@GoldIsSilent0 Games without frontiers.

[@AngryGroceries]

funny thing about that... on some level, everything is absurd

[@johnmaynard869]

@@AngryGroceries that’s absurd. 😜

[@travcollier]

@@AngryGroceries The original quote is longer, more nuanced, and in French.

[@justincase4812]

The US government apparatus, most governments likely.

[@sieglindedeutersbotter1251]

I'm sorry, but the flat Earth being hit a meteor, tilting and thus tossing the dinosaurs into space was just hilarious! 🤣

[@gamingcreatesworlddd2425]

😂😂😂😂😂

[@whichgodofthousandsmeansno5306]

I thought flat earthers don't believe in space even though that's all we see for pretty much infinity.

[@lettersquash]

That's why they evolved into birds.

[@StormsparkPegasus]

That was actually from a parody video making fun of flat earthers. But yeah.

[@brawdygordii]

The one thing I know about Flat Earthers is that they don't WANT to know the truth.

[@MrCheswickMusic]

Keep taking those jabs kid

[@bsadewitz]

That's what they "know" about us, lol.

[@777dragonborn]

Most arrogant truthers there is . They are just as bad as the globalist Pfizer Bill Gates people they talk about themselves. Hypocrites. What they call truth is far from it

[@passais]

I think part of the attraction is also being part of a select club and feeling smarter than the "sheeple" because you "figured something out" that others haven't.

[@betaorionis2164]

I think this is the main reason to be a flatearther. It's like a drug which (like all drugs) gives you a pleasurable sensation (to be smarter than the rest), but detaches you from the reality (that the Earth is not flat). Also, most flatearthers seem to have had very poor school records and it may have made them resentful against knowledge.

[@LoneHorizons]

That’s it exactly. Who wants to be successful and accepted in society if society is all based on a lie? So they become a flerfer and feel superior.

[@robvanderwell5695]

In the same fashion the masses feel superior because they belong to the 'true knowledge incrowd'.

[@passais]

@@robvanderwell5695 no actually, I was convinced when I made my trip to IO.

[@ophero108]

@@robvanderwell5695 But they don't though, do they. For the vast, vast, vast majority of people who know the earth is a globe or that 5G isn't mind control or that lizard people don't exist, it's not a big deal. They don't all gather on online forums to discuss the latest in globe-earth evidence - it's a total non-issue that barely ever gets thought about or brought up. The problem that causes flat earthers is the same problem that causes incels and pulls some people into religious cults: it's people with not a whole lot else going on in their life for whom "the earth is secretly flat" fills that void and forms the keystone of their identity. Normal well adjusted folk can weather individual beliefs or traits being scrutinised because it's only a small part of their overall personality. For flat earthers it's all they've got, so they take it much harder and are more likely to double-down and get defensive to protect such a core part of their life. It's why flat earthers need to in many cases be deprogrammed like incels and cult members by supporting them to build confidence in other areas of their life so they can safely tackle the lies they were fed from within the flat earth community.

[@MrDominex]

Flat Earthers don't really care what shape the Earth is, they just want to play a game of one-upmanship by adopting an absurd opinion and then defending it against all reason like a passive-aggressive jackass.

[@rivershen8199]

Flat Earthers are the type of people who won debating competitions in school no matter how ridiculous the position they had to defend.

[@miloszforman6270]

@MrDominex Most probably you're right, but what on Earth drives Hossenfelder to seriously engage with such hoaxes?

[@uNiels_Heart]

@@miloszforman6270 Because flat earthers have an impact on society, especially if their number is on the rise

[@TesterAnimal1]

Some. Not all. Many vehemently believe it.

[@mikeguilmette776]

@@miloszforman6270 Right now, many schools are teaching that boys can be girls, so it's not much of a stretch to think that flat earth "science" could end up in the curriculum soon . . .

[@eighteenin78]

Never could I ever get an FEer to explain how the stars rotate in a clockwise direction around the South Celestial Pole.

[@Globeisahoax]

Is south celestial pole located at the bottom of the globe?

[@eighteenin78]

@@Globeisahoax No it is not.

[@seanmchugh2709]

Depends on what you arbitrarily call 'up'. In any case, your question is a red herring. The opposite rotation, with respect to the observer, cannot occur with a space pizza and star dome, regardless of observer location.

[@mleise8292]

@@Globeisahoax How does the sun rise to the South of Perth, Australia in December if it cannot go beyond the tropics? Now you may think, "ha ha, as if it was so easy to debunk flat earth", but it is. Grifters like David Weiss or Witsit Gets It and all the others would just withhold such knowledge from you so they can continuously bank on your support.

[@kevin7410]

Easy, the stars are just little holes poked through the firmament!!!1!

[@Rogelio_007]

I am pretty convinced Flat Earthers used to be avid gardeners, who stepped on a multitude of rakes and got hit in the head by the handles.

[@seanemery6019]

I met an actual flat earther in 2018 at, of all places, the Grand Canyon. He didn’t even believe in gravity. It was a completely bizarre experience. I was left completely stupefied by the crazy, to be honest.

[@subject8332]

You have been Gish Galloped, my friend!

[@SabineHossenfelder]

I once met a creationist who believed the earth is less than 10000 years old. At first I thought he was joking. Similarly bizarre experience!

[@drgetwrekt869]

and he was floating at the top of the canyon.

[@ploppyploppy]

Let me guess - they used the word 'theory' completely in opposite to its actual meaning? If I hear 'gravity is only a theory' suggesting it doesn't exist I just stop all communication and move away. These people have *nothing* to add to the world.

[@SoloRenegade]

did you ask him to try jumping across the canyon?

[@RichardNeill01]

I always assumed that the flat-earth movement was a very extended joke, where one of the rules was "you aren't supposed to admit it".

[@acu01136]

I am pretty certain that this is the case.

[@herbertshallcross9775]

"First Rule of Fight Club" kind of thing.

[@brianfox771]

I think it started off this way, but then it became a situation where you should never underestimate the human capacity for stupidity.

[@noumenon6923]

That's what I've always thought as well,... just a really committed dry humour.

[@815TypeSirius]

First rule of humans: all jokes become real.

[@rastanz]

A flat earther told me when the tide goes out it's because the ocean's water is being recycled. Somewhere on flat earth there is a giant water recycling plant.

[@PsychoMuffinSDM]

Tide goes in. Tide goes out. You can’t explain that! /s

[@jamesmnguyen]

As long as my water is clean, I'm ok.....(sarcasm)

[@Slartyfartblarst]

The land surface also moves, to a much lesser extent. Water is recycled, by the hydrosphere.

[@partymantis3421]

lol i have yet to hear that one, these flearth models are a riot, the one i hear to explain the sea involves the famed ice wall melting in the summer & reforming in the winter, also theres ofcourse an armada guarding it that the UN protect (man i WiSH we could work that well together on something like that)

[@bspiken]

The sympathy is what I struggle with. Im actually pretty convinced that they are not interested in discovering how the world works, they are interested in the conspiracy, on proving other people wrong. Their motivation seem to be grievance rather than curiosity.

[@BondiAV]

It looks like you made the leap from "Wrong but Not Stupid" to "Not Just Dumb, but Dangerous". I interacted a few times with flat earthers and learned in the process that they refuse to hear or see anything that does not match their belief. Trying to explain science to one of them is like trying to play chess with a pigeon: no matter what you do, the bird will knock over all the pieces, poop all over the board and walk around with its head held high, as if it won.

[@ddegn]

Most the flat earthers I've interacted with behaved in a similar way however every so often there is one who is really willing to learn. For example, one said "if we travel around the sun once a year, then six months later the sun should be in the sky at night." I then explained sidereal and they actually seemed to understand.

[@BondiAV]

@@ddegn I agree that there are exceptions to the "general rule" I described above. Thank you for pointing it out. It is in fact the very reason why, every now and then, I try reasoning with some of them. Didn't lose the hope of finding one who is willing to learn (although I haven't been that lucky yet).

[@Mechulus]

I remembered those previous titles too. The only concern I have is not with 'Flat-Earthers', but with how Sabine is starting to gravitate into the realm of click bait in order to stay relevant / goose the algorithm. There's been a spate of influencers putting out similarly worded click bait lately, which I find intellectually insulting: "Why XXXXX is not just wrong, but DANGEROUS!". Just fill in the thing you dislike with XXXXX and wait for the clicks to roll in - even though there's nothing truly dangerous going on. Is it ignorant to believe the Earth is flat? Yeah. Is it dangerous? Nah.

[@odd-arnedahle2173]

@@ddegn And that explanation is just bonkers. Why? Because the Sun can not overhead of everyone at the same line at the same time. Like you can be in Spain and feel the Sun straight overhead, then at the same time, someone in Sweden could have the same feeling of the Sun straight overhead. You would never have that if the Earth was tilted and Sun always ran over the Equator. It is a lie, a bad lie, and the worst part is that you have no clue what I told you.

[@MrScrofulous]

Pretty sure you just described #45

[@Scinquisitor]

I really recommend the documentary called "behind the curve" about flat-earthers. The funniest moment is when a flat-earth blogger rants about her collegues, who claim she is part of a conspiracy to discredit the flat-earth movement. She talks about how it's unfair when people claim that you are part of conspiracy when you are not, and when they make things up about you. Then for a moment she considers "what if all those scientists I accuse of conspiracy feel the same way"... just then to add "but those guys are in fact conspirators!"

[@User-yy6xt]

It’s made by people who’s goal is to make you think it’s too stoppid to look at and you fell for it.

[@johnqpublic7608]

@@User-yy6xt because it's stupid.

[@mynamemylastname7179]

You should watch "the martian" documetry when Nasa sent matt damon to grow potatoes on mars back in 2015. Much better then that Apollo 11 💩 from 1969 😂😂😂😂😂😂😂😂😂😂

[@User-yy6xt]

@@johnqpublic7608 Yeah it was. It was totally stupid. It had not one thing that was true about the flat earth or flat earthers in there. It was made up garbage designed to keep you all ignorant to what people who see the flat earth see and where they look to see it. They won’t v show you what we see because then you would see it too.

[@Matuse]

@@User-yy6xt By all means, dazzle us with how smart you are. Prove anything about flat earth.

[@waskus]

When I try to have a diskussion with flat earthers, none of them can explain it to me. They all type: do your researche😂😂😂

[@Raptor302]

I will empty my bank account to any flat earther who can find and view Polaris through their telescope while standing in Australia.

[@mkx9095]

How much you got ?

[@Raptor302]

@@mkx9095 Couple hundred thousand. Do it.

[@mkx9095]

@@Raptor302 I can’t find the moon neither , I asked to know if you was worth an hack 😅

[@mkx9095]

@@Raptor302 I’m joking , don’t worry

[@alexg4462]

@@mkx9095 Ha! I was all ready to fire off a post asking you how you can stand on a continent that doesn't exist. hehe. I used to have a telescope and could find most things relatively easily. It was amazing to see Jupiter with my own eyes, then I bought a refractor and for some reason couldn't find anything. Even the moon took me forever to get a bead on.

[@bitphr3ak]

The first rule of The Dunning-Kruger Club: You don't know you're in The Dunning-Kruger Club!

[@Hudoi-1]

At this point anyone trying to find the truth should assume by default they're in the club, even if all evidence points to otherwise.

[@bitphr3ak]

@Hudoi-1 humm, you might want to read up on the Dunning-Kruger effect...because it's not as helpful as you might think, as a truth finding flex.

[@t16205]

@@Hudoi-1 LOL

[@Rdlprmpf12]

If you don't know whether you're in The Dunning-Kruger Club, you're not in The Dunning-Kruger Club.

[@mormatus]

This is hilarious 🤣

[@theronwolf3296]

I got verbally attacked and blocked after asking a FE how it could be midnight in Tokyo and mid day in NY at the same time.

[@GusOfTheDorks]

I asked someone who believed in the round earth about how we know a vaccine is safe and effective if it hasnt been given the time for proper clinical trials. They started yelling at me that I was trying to kill people. I left after they started telling me I should be put against a wall and shot with a gun.

[@rodmehta5356]

Time is fake 😂

[@rickinielsen1]

Tokyo is obviously fake! Japanese people are all in on it!

[@GusOfTheDorks]

Oh fun, looks like they deleted my comment.

[@bjornfeuerbacher5514]

@@shortgamingmovies2685 How could the sunshine be "local"? If the sun if above NY, why can't its light reach Tokyo?

[@alainbellemare2168]

How many flat earthers does it take to change a light bulb in the southern hemisphere .

[@robertsmith262]

As long as you understand, the sun would never set on a flat earth, you just can’t believe it’s flat. One and one make two, it is that simple.

[@mkx9095]

Sun is little. It doesn’t set , it goes away on a circle and create darkness in the part that the light doesn’t reach . Didn’t watch the video ?

[@robertsmith262]

@@mkx9095 don’t know what reality you live in, but the sunsets every day.

[@mkx9095]

@@robertsmith262 it goes away and it looks like going down but it doesn’t

[@robertsmith262]

@@mkx9095 find a better hobby. Not going to debate with someone who thinks the Earth is flat. Do you know why? Because there is nothing to debate.

[@andysmith1996]

@@mkx9095 We both know that your explanation makes no sense and you're just here to troll.

[@eunomiac]

The scariest part of this video is the graph showing how much of an impact KZbin's "algorithm" has on how our civilization thinks.

[@getsideways7257]

And if that wasn't scary enough, you need to also remember that the favor is shifting towards TikTok these days...

[@ASlickNamedPimpback]

its just google graphs

[@volkerengels5298]

The algorithm is aligned with: "'needs' of modern society" It doesn't cause those 'needs'

[@mementomori29231]

The movie Idiocracy is becoming real

[@zyeborm]

​@@volkerengels5298nah it's aligned with making Google more money, they changed it because they realised they can make more money in the long term if they allow a long term to exist and don't bring about a new dark age.

[@Muritaipet]

Bob the Science Guy summarised it - "There are two types of Flat Earthers. The ones who believe, and the ones selling them T-shirts"

[@MyName-tb9oz]

No, there are also the trolls doing it for the, "lols." Years ago when I was on Fecesbook there was a girl on my friends list who I later discovered was a flat-earther. I saw people commenting on her page and I swear some of them were just egging her on to be nasty. I really felt bad for her. It was quite sad and cruel.

[@richardalvarez2390]

There are also those that were always attacking flat earthers with our NASA facts and as we saw through the many lies, we became flat earthers.

[@AnirudhTammireddy]

@@MyName-tb9oz I'm confused who are the 3rd type of flat earthers? the girl in your story? But she wasn't a troll in your story?

[@Muritaipet]

@@MyName-tb9oz LOL @ "fecesbook." I agree there's likely a lot of trolls, pretending to be flat earthers.

[@Muritaipet]

@@richardalvarez2390 Oh absolutely. I live in New Zealand, and we all have to pretend about Antarctica, and take turns guarding the ice wall.

[@danielroncaioli6882]

If the earth was flat, cats would have knocked everything over the edge by now.

[@iggi3985]

Flerfs suffer from Dunning Kruger and confirmation bias. Truly sad state

[@MrCheswickMusic]

Keep taking those jabs kid

[@iggi3985]

@@MrCheswickMusic it’s funny, because you literally have no argument a part from an assumption that not only is incorrect, but has nothing to do with the topic at hand. I will give you a bit of a history lesson as a freebie. Humanity has known the world was round well before vaccines were invented 😉

[@terrancat]

The one flat earther I talked to believed every planet was spherical EXCEPT Earth. I was done. I can't even.

[@smeeself]

And you'll never get that time back again...

[@saldownik]

It seems like the lady has jus started to discover the truth.

[@ThomasKundera]

@@saldownik : That flerfs are dumb?

[@spiderprime]

Some don't even believe there is space and other planets and that we're the only thing to exist.

[@ronpapi9539]

@@spiderprime That's me.

[@mikekilpatrick5686]

Like the saying goes, arguing with a flat earther is like playing chess with a pigeon. it knocks the pieces over, craps on the board, and flies back to its flock to claim victory

[@scotttaylor9133]

Ahh, the unwashed masses, they are so disgusting, aren't they?

[@teacherella1338]

Sounds like playing chess with Trump 😂

[@User-yy6xt]

We don’t argue with people like you.

[@ThatBonsaipanda]

One variation that I like goes ".. and strut around like they won the game."

[@User-yy6xt]

@@ThatBonsaipanda you people are worthless

[@capitalb5889]

It’s not just the science aspect, it’s the fact that they are mostly religious fanatics as well who take a literal interpretation of the Old Testament.

[@AusSkiller]

I cannot understand flat earthers. I see evidence of a globe earth every time I look out my window. Simulations of a globe that I program on my computer look just like what I see in reality, whereas simulations of a flat earth look quite different. And while the globe earth model has highly accurate maps and calculations to reasonably accurately predict what will happen, flat earthers don't even have a map that that can acurately tell me how far it is to a nearby city let alone be able to predict anything. I cannot understand how any reasonable person could believe the earth is flat.

[@willbrink]

Flat earthers make moon landing deniers look like geniuses...

[@magilviamax8346]

I was under the impression that flat earthers were just a bunch of people in search of attention, cause none should be that incompetent. But if Sabine feels the need to talk about it, it really must be worrisome. My faith in humanity is dwindling.

[@SabineHossenfelder]

I guess you are right that search for attention is part of it for the people who you see on social media. But there's a larger group of quiet people behind them, the ones who share, lurk, and like. It's also really hard to make headlines with flat earth theories. I think that the attention-seekers are more of the sort who come up with a proof of the Riemann hypothesis or a theory of everything etc, something that plausibly would be front page news.

[@marcinnawrocki1437]

Nah arguing about silly stuff on FE forums is amusment.

[@sababaratashvili8629]

@@SabineHossenfelder You underestimate amount of attention seekers. It is combination of attention seekers, stupid people and people who just do it for fun. I worry much more about politics and activism in science, which only feeds such "sceptics".

[@pablov.viteri9345]

@@SabineHossenfelder Follow the money who founded

[@donm5354]

Sometimes I go on Flat Earth Society forums just to mess with heads of people literally angry that people CLAIM the Earth is FLAT.

[@keithdaniels5918]

Still waiting for pics from the edge.

[@b.chuchlucious5471]

You can try to go to the edge but the military will stop you. The governments know, but will keep you in the dark. 60° latitude is your limit.

[@Greenmarty]

Scary is that similar intellectual decline did happen multiple times in history and was followed by dark age kind of periods.

[@baarni]

The big misconception is that flat earthers are honestly trying to figure out whether the earth is flat or not. They are not and will dismiss any evidence that shows anything that contradicts their beliefs…

[@yad-thaddag]

Not very different from creationists.

[@2bfrank657]

This. She pointed out the lack of scientific education, but flat earthers can be explained even more simply than that - confirmation bias.

[@Raphael4722]

Honestly who cares? By the law of large numbers, you are never going get 100% people to accept something. It's not a lack of education, it's a matter of parts of science being counterintuitive and many people have a limit on how much they are willing to oppose their intuition. Flat Earth is the most extreme case of this. Evolution deniers exist because it's hard to have intuition for something that takes millions of years. Vaccine deniers exist because of the intuition that injecting an unknown substance into your body is dangerous. Viewers of this channel will ridicule all of these. However let's not forget that there is no scientific evidence for free will, while there is plenty evidence for determinism, yet there are most likely people in this comment section who consider themselves "scientifically minded" but cannot go against their intuition when it comes to free will.

[@Ben-pd2bx]

Right. It's not remotely about what's true. This stuff meets a psychological need. Whether it's flat earth, QAnon, creationism, Scientology, or gender ideology, arriving at the facts is not the point. Such belief systems are not information that "out there" that these people have considered, perceived and understood - they are ideologies that they have adopted and *identified with*, and that's a big difference. The truth doesn't confer an identity. Ideology does. These kinds of beliefs give people membership in a core group of believers who know the Ordained Truth, while everyone outside that group is thought a fool, a sinner, a bigot, an infidel, a sheeple, etcetera. It's tribal and evolutionary. The people I know who go for this stuff are always insecure, and often have very deep traumatic wounds from early life. They want to belong. They want to be special. They want to feel empowered. The want to feel they have an enemy to oppose. They want to define themselves in relation to all these things. To present them with evidence that their claims are false is not to dissuade them. It is to further radicalise them. The reason is two fold: 1. All criticism of their ideas is perceived as an attack on their identity and personhood. 2. All criticism of their ideas is evidence their ideas are correct, because the "sheeple" or whoever, are trying to defeat the truth. The reason to confront these people and their ideas is not to dissuade them, unless you're able to actually involve them in long term deprogramming. The reason to confront these ideas is so that others who are yet to be indoctrinated and may be watching may be spared the same fate. Meanwhile, if you really do want to help someone who has fallen prey to these kinds of ideologies, the only thing that will do it isn't to confront them with facts, but to engage them in relationship. Rarely, this will work. Remember, it's all about identification. If they start identifying with people who believe things that are true, they are likely to change their beliefs. People believe what their tribe believes more often than not.

[@jtjames79]

Flat Earth debunkers will never admit it's just a big troll. Sufficiently advanced incompetence is indistinguishable from malice. It's ridiculous how many people will accept incompetence as an excuse just because it makes them feel smarter for themselves.

[@unmoored7414]

These people are not essentially crazy, but they were left behind during the critical mental development during childhood which left their ability to reason and conceptionally represent reality with sufficient fidelity as to participate constructively within society. This creates a profound sense of incompetency and compromised social identity which motivates them to join groups which are susceptible to harmful conspiracy theories.

[@duanecarroll8255]

Otherwise known as HOME SCHOOLED!

[@Nefville]

While I assume I would agree with the intent of what you are attempting to say, I'll take ranch on my word salad.

[@juimymary9951]

@@duanecarroll8255 Well...considering what the public school system is like in places such as the US...

[@eh1702]

There is some research to show that people who believe a lot of conspiracy theories are more fearful than general. And also not generally of high educational attainment. The feeling of being bewildered by a fast changing world, by social and technological change, being clobbered by scary phenomena that seem to come out of nowhere (like economic recession) - all of this resolves once you are “in” on the secret of the lizard people or whatever. It is a more inchoate, ad hoc way of dealing with Big-Scary-Hard-To-Get-A-Grip Reality than the more conscious religious injunction to accept the will of God whether or not you understand it. It has the comforting advantage of feeling like you do understand it. Plus it gives you the fantastic feeling of at last being smart- smarter than the smart kids you went to high-school with.

[@jflaplaylistchannelunoffic3951]

@@duanecarroll8255 I would argue that home schoolers are less prone to become flat earthers, since during home schooling one has far more opportunity to think things through.

[@user-ls1qc8hg2s]

I think this quote sums up flat earthers nicely. “You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)

[@Yes-gz9qs]

I asked a flatearth women if she'd like to dance. She said no because she refused to believe we were at the ball 🤷

[@alexg4462]

hehe, good one.

[@SomeMorganSomewhere]

The irony is that I've some vague recollection that Flat Earth Society was originally created by people who weren't ACTUALLY flat-earthers, it was more like the Society for Creative Anachronism, little did they know they'd get overtaken by the actual flat-earthers...

[@worsethanhitlerpt.2539]

People who just like to argue for no reason like teenagers and Woke college students

[@jal051]

Yeah. The first video Sabine made was about that. She, in fact, defended the cynical aspect of the original flat Earth movement.

[@Justwantahover]

There are a fair few poes, who just pose as flerths, for money and "fame". If any flerth who shows any hint of intelligence, most probably aren't flat earthers. And the dummies (who are genuine flerths) just follow. The poes might write a book called "Flat Earth for Dunmies". 😅

[@User-yy6xt]

Other way around DA

[@johnkean6852]

The flat earth society is unrepresentative of modern flat earth theory

[@exokitten]

I tried my best to debate a flat earther while remaining respectful. I was unsuccessful at swaying him, but here are my best, easy to digest arguments that anyone facing the same type of situation can use: • Ships and airlines use globe coordinates to navigate. Ask a pilot or a captain and they will confirm. • If the Earth were flat you would be able to see all mountain ranges with a telescope. • Light cannot shine down in an isolated location without being visible to all those on the same plane beneath it. The flat earth map does not align with how light functions. • If we were all on a flat surface we would all see the same constellations.

[@brucetucker4847]

The Sun has a lampshade. A lampshade that changes shape with the seasons. Didn't you know? (RIP Sci Strike, you are missed but never forgotten)

[@mcv2178]

I like your mountain range example.

[@BOO-ii3ni]

You are dumber than him for trying to debate about physics with someone that never tried to learn physics.

[@goodfortunetoyou]

Looks somewhat fun. 1. Using spherical coordinates does not in and of itself imply the earth is a sphere. Indeed, I believe that they can be mapped into the euclidean coordinate system. 2. There can be fog, and objects obstructing your view. Additionally, there could be an effective render distance. 3. If light is emitted as if from a flashlight, the light illuminates a cone between the source and the plane. Now, you might argue that the sun is a sphere, and is a point source. However, all we can observe is the 2D dome of the sky, where it presents as a disk. 4. The world loads in semi-continuous chunks, where each star can be seen a a puncture of the sky-dome (let's call it the firmament or something) and is only visible from chunks illuminated by the star's light cone.

[@livestock9722]

1 minute of latitude/longitude equals 1 nautical mile (slightly off in Northerly/Southerly airspace due to... well duh?). Pretty handy on aeronautical maps when trying to find coordinates. This would absolutely not work in a flat earth universe.

[@haynerbass]

IF the planet was flat cats would have knocked everything off the edge by now.

[@SuckPuppet-xv1dv]

One of my favorite 'conspiracy theories" is that cats are aliens in disguise sent to monitor humanity. Don't worry, tho', they are mostly benevolent.

[@ray_notes8170]

The big tell the flat Earth is false, is that nobody from their rather sizable community has ever created a functional map or model. This, despite the fact humans navigate the Earth every day with extreme precision.

[@ChewyChicken589]

Vibes of Cosmos has

[@hor80]

Exactly, no one could ever present a concept for FE that would work with everything we see and experience every day/every year.

[@ray_notes8170]

@@ChewyChicken589 any links to that content?

[@davidmescher2526]

​@@ChewyChicken589Looking at the links provided by the Google search vibes of cosmos flat Earth map, it's a bunch of bunk.

[@smeeself]

​@@ChewyChicken589No, they haven't

[@demidron.]

Every time I asked them why I, in the southern hemisphere, see the stars revolve clockwise around a point in the sky directly south of me, whereas they, in the northern hemisphere, see them revolve anticlockwise around a point in the sky directly north of them, they disappear.

[@hodgeyhodge8414]

Have you actually stared at the sky long enough to independently verify that that's what they do? The sky moves very slowly. I have watched the moon crawl across the sky, but never the sun or the stars. In any case, I think you'd be hard-pressed to find a flat-earther who has travelled to both hemispheres of the earth...

[@dynamicflashy]

@@hodgeyhodge8414 Turn on a camera to record the sky, and then watch it back sped up.

[@noway905]

I live in the northern hemisphere and have watched the stars at night for over 60 years and can attest that they rotate clockwise around a fixed point called the north star. The big dipper proves the stars do not "disappear."

[@w01dnick]

​​@@hodgeyhodge8414it's not that slow, actually Moon, Sun and stars rotate at almost the same speed, because it's mostly Earth rotation. As for seeing that, you don't even need a telescope. Just remember where stars are at midnight and check hour later. They'll move for about 15°, or 30 Moon's diameter, that is pretty noticeable. With telescope that rotation is a PITA, because you have constantly adjust direction to see planets, stars. P.S. 30 diameters - that is near sky equator, closer to the Polar star lesser is difference, but it's still noticeable a lot.

[@Polit_Burro]

There is no "southern hemisphere".

[@rocketscience4516]

Funny how they trust in science when they go out to buy a mobile phone, or pay for internet access. Or buy a TV. Or... (list goes on and on).

[@Thomas-gk42]

Absolutely right!

[@daniellove162]

Sometimes people will cry “TRUST IN SCIENCE” in lieu of saying “DON’T QUESTION OUR NARRATIVE”. Scientists throughout history have questioned currently held science to refine science. Also, for years people thought Newtonian physics was the final destination and the some dared to do science and discovered it was merely the surface.

[@juimymary9951]

I think it's mostly that they ignore that all branches of science are interconnected to some extent To them the shape of the planet and the function of an electronic device aren't related and therefore to them there is not even the cognitive dissonance.

[@Bill_Bo]

What they do is separate science from technology and pretend they have nothing to do with each other in order to avoid the inevitable cognitive dissonance.

[@drgetwrekt869]

its because they dont understand how these things work (well like 99.99% of people actually).

[@StevenErnest]

What scares me is that most of these people can vote. Wonderful video! 🌎

[@tonykelpie]

Conspiracy theories in general are very attractive to many people because they offer simplistic explanations to many things that are difficult to understand, and they particularly avoid the anxiety that many people feel when faced with a world, and a universe, which is really difficult to completely understand

[@Globeisahoax]

SYSTEMATIC POISONING BY THE GOVERNMENT TO PREVENT FLAT EARTH AWAKENING 1. CHEMTRAILS/ GEOENGINEERING 2. VACCINES: HEAVY METALS + GRAPHENE 3.4G + 5G RADIATION 4. PESTICIDES IN GM FOOD truth.to.the.rescue 5. GRAPHENATED PCR PINS AND MASKS 6. GRAPHENATED PERSONAL CARE PRODUCTS 1. GRAPHENATED MILK, MEAT, WATER 8. ELECTRIC CARS WITH SUPER EMF FIELDS 9. MARXISM + TOXIC IDENTITY CULTURE 10. ECONOMIC WARFARE AGENDA 2030

[@smeeself]

Sure, but sunsets aren't THAT complicated.

[@SinclairA]

"They are more confident than the average person ..." that's Dunning-Kruger for you there.

[@catcatcatcatcatcatcatcatcatca]

It’s not Dunning-Kruger. The effect is often misrepresented. In the study, the people with little knowledge still correctly identified they had less knowledge then the experts, they just wastly underestimated the information gap, as they weren’t even aware of much of the knowledge the experts knew. The experts in turn overestimated the knowledge the average people had. It’s not that they doubted themselves or weren’t aware of their position as an expert. Flat earthers aren’t just more confident in their knowledge, they flat out think the experts are wrong or lying. They aren’t just unaware of the knowledge gap, but believe its just filled with lies and deception.

[@HolyMith]

​@@catcatcatcatcatcatcatcatcatcathank you for clarifying that for me, I wasn't aware that was the study that was actually done.

[@DarkShroom]

@@catcatcatcatcatcatcatcatcatca "The experts in turn overestimated the knowledge the average people had" -i don't think you have any evidence of that claim otherwie you would have probabally said it, in my experience they are confident in their own reasoning and think the experts are duped, if this is because they are unable to grasp basic science, as most of us judge, then it's technically the Dunning-Kruger effect just i guess i'm tired of people using it when arguing with one another, which is maybe why Sabine didn't mention it

[@mikotagayuna8494]

Flat earth prophets know exactly what they are doing. It's not important whether or not they actually believe what they're preaching but it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms. When confronted, they will double down and claim conspiracy because attacking their beliefs threatens their livelihood, and thus, their perceived right to live comfortably.

[@mobilephil244]

It goes way deeper than just their living. Psychologically, conspiracy theories come from the same place as religious fanaticism

[@devthis5135]

It's so true, and at the same time, so sad...

[@thstroyur]

"it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms" Meaning that, in order to be a Flat-Earther, one is obliged to do all those things?

[@rclaws3230]

The commies want their perceived right to live comfortably upheld by everyone else's tax dollars; at least these fools are making people laugh while peddling their nonsense.

[@ary2766]

​@@thstroyur the more you preach an idea, the more you increase the likelihood of finding someone who accepts it. Not all flat earthers will support the preachers but even if 5% of the supporters do the bare minimum of visiting their dumb seminars, or buying their books for whatever reason, (it most likely stems from a need to socialize and actually interact with someone on their level as most of society is clearly way too intellectually superior compared to them) will make them a fortune

[@kentjenkins734]

I was surprised to find out that they don't understand what a vacuum is. They (or at least many of them ) think that a vacuum is a force in its self, rather than the mere absence of a force. Many of them think that this force causes objects to move away from one another, tearing apart anything with air inside it.

[@foreverpinkf.7603]

As the great German philosopher Erwin Pelzig said: there have always been idiots, but they have known about each other since the internet came into existence. They grow and thrive on social media. P.S. love your channel; never give up, never surrender!

[@itchyomalley]

You can't reason someone out of something they didn't reason themselves into. My brother's a flat earther (among other things) He's been dismissed by his family and friends for so long, he seeks out like minded individuals and lives among them now.

[@mkx9095]

kzbin.info/www/bejne/p3bEeZ2Ge5lqlacsi=CkC3Hh1CvfdJm9z1

[@MrEW1985]

I just had the biggest laugh when the Flat Earth society claimed that it had members all around the globe.

[@gsmollin2]

Really? Now THAT is irony!

[@richardalvarez2390]

Flat earth Society is controlled opposition. Flat earthers do not take that statement seriously. As being around the world is bogus

[@acmhfmggru]

Flat Earth Society is very tongue in cheek. The entire idea is tongue in cheek, though there are also really low IQ people who don't realize that and take it completely seriously, to be fair, but the leadership is really very clear about FES being about skepticism and the scientific method (a point that is ironically lost on Sabine, who doesn't even mention the FES, just the vague idea that people think Earth is genuinely flat). It is a statement against blindly believing authorities and demanding evidence and clear explanations: any person can see that the surface of the Earth appears to be flat at a human scale, and the overwhelming vast majority of people do not have any natural experience that proves to them that the Earth is a globe. It isn't that there's some supposed big conspiracy, it is that they are skeptical and advocating skepticism. Or you can just jump on the bandwagon and say "hahaha those people are sooooooo dyum!! I'm glad I'm not those people!!!".

[@richardalvarez2390]

Let's not forget, there is a 3 hour testimony of pilots and pilot instructors admitting the earth is flat, on KZbin

[@wiredforstereo]

So effing cliche.

[@WenlongDai]

The camera they use, the internet they use, the compters they use, the equipments for their "experiment", etc. etc. are all made by science, they clearly like these things science has made. but when it comes to science saying "earth is a ball", they are like "no. you are correct in every other thing, you've made our lives so much better, but you are wrong on this particular subject". amazing.

[@User-yy6xt]

Claiming your science is the creator of everything is proclaiming your science is all powerful and therefore a religion where the religion itself is your god.

[@TylerAult]

"They're trying to figure out how nature works" (6:27) -- No, they're not. I know this is a segway to the ad but this is the whole problem. Flat Earthers begin with a conclusion and then try to justify it, much like religious people. They aren't interested in observation except to selectively prop up their pre-existing assertion.

[@MarcPagan]

Leftists, Democratic Party voters in the USA, are on par with Flat Earthers ......for their impressive immunity to facts, science, and reality.

[@michaelsommers2356]

A segway is a scooter. A segue, pronounced the same way, as two syllables, is a transition.

[@rahantr1]

Oh come on, cut them some slack. Every scientific field has some p-hacking issues.

[@deathsinger1192]

except, religious people don't necessarily ignore proof, you cannot proof that god doesn't exist, that doesn't proof his existence either, but you can disprove flat earth quite easily

[@xintophotography9848]

@@deathsinger1192religious people believe nonsense proofs and nonsense logic are actually proofs based on actual logic. Also, most atheists have concluded that religions are dumb and/or that gods are incoherent nonsense. It is rare for them to argue that gods are provably nonexistent (and indeed, religious cosmologies are so ill defined that it isn’t clear what is supposed to be disproven).

[@mr.bisley2748]

Right now, flat earthers are at the very bottom of my list of worries.

[@AxelPixel-cx4wg]

Flat earthers ARE the very bottom!

[@user-os4lj3pi4q]

they shouldn't be so low. It's like having something funny in your skin (maybe cancer) and ignoring it because it doesn't hurt in any way (YET).

[@NeroDefogger]

and am I?

[@vir00]

​@@user-os4lj3pi4q As a subgroup flat earthers are totally harmless like the crystal wearing horoscope trusting other interpretations of observable reality out there. They are the distrustful inverse of the part of population that went positively militant with trust the science without critical thinking or understanding how it actually works or what could go horribly wrong. A good part of humanity is just following groupthink and *that* is the real danger here.

[@Frenchy78ify]

@@user-os4lj3pi4q yeah ? why do you care so much ? we have proof but yall cry everytime we bring them lmao boohoo nasa didnt lie to me all my life, hundreds of times

[@angryoldcanadian3905]

I work with a flat earther and there is no amount of evidence he will accept. My theory is that these people think that they are 'special' because only they and a few others know 'the truth'. This is important because most of them have done nothing special in their lives and this makes them feel good about themselves.

[@mtbrocket]

People hate to be told they are wrong; it is humiliating. They will come up with more and more absurd work-arounds to maintain their position is “right” and save face. To change a mind they have to work it out themselves. All we can do is guide.

[@tombutler4726]

I think it's a combination of willful ignorance for some and simple trolling for others.

[@GusOfTheDorks]

They just dont trust people that have a track record of lying to them for fun and profit.

[@karlchilders8215]

A lot of it is willful ignorance but the vast majority of flerfs are too stupid to understand basic science. It's beyond their capacity. I have tried and tried to understand how an automatic transmission works but I just can't get it. I would like to know about quantum mechanics but when I read anything about it I literally get a headache. People have limitations.

[@BeyondAldebaran]

@@GusOfTheDorksThis is why I am sympathetic to flat earthers. They are like old hippies believing in crystals. Hilariously wrong, often politically charged, but not bad people. PS-also don’t worry so much, humanity was doomed from star. just have fun. If space colonization works and man survives, then what a great surprise!

[@joesterling4299]

Yes! That would be a worthwhile investigation. How many of these miscreants are in it just for the trolling, and how many actually believe.

[@Ryan-ff2db]

I found most flat earthers are argumentative in nature and not just about flat earth, about all things. They just like to argue and they are usually men.

[@nosferatu5500]

i think logic classes should be mandatory in school. Its fundamental for all subjects, mathematical formalism and later in life.

[@drgetwrekt869]

school and all is mandatory since 200 years or so (even more). its not about schools. the problem is society as a whole.

[@SoloRenegade]

Philosophy classes. The basis of all science and the rules of debate are taught in Philosophy. There is a reason PhD is the most widely know Doctoral degree (PhD = Doctorate of Philosophy).

[@edene.4870]

It *is* mandatory. Logic and critical thinking are an essential part of classes like maths, physics, chemistry, history, and most importantly literature analysis. And these classes are all pretty much core classes in most civilised countries. If you take a look, most flat earthers are either US Americans or people who are from another country but have had little education and a lot of exposure to US centric media and social media. And an even closer look will reveal that these US Americans are from states where education has been whittled down and outright butchered. This is not a coincidence.

[@juimymary9951]

Absolutely

[@joansparky4439]

not even basic economics is based on logic.. which is why flat earthers have become a phenomenon in the first place.

[@zwigoma2]

Watching Flat Earthers debate physicist is gold

[@thaddeuslangley6519]

Theres a documentary called 'behind the curve' that does a great job expounding on the points made in this video. And its free on tubi.

[@hor80]

Interesting!

[@wonderpope]

My main problem with flat earthers is that they give a bad name to skeptical people in general. The push by authorities to censor social media because of "misinformation"/"desinformation"/"malinformation" is getting stronger. This starts silencing anyone who might have good reasons to counter official narratives, because you are put in the same basket as flat earhters.

[@decafjava8565]

Very true.

[@alchobum]

The censorus work hard to create that link. Only a flat earther conspiracy theorist would even dare say higher taxes and not being allowed to drive on weekends are bad.

[@xintophotography9848]

Conspiracy theories in general have so stretched the concept of skepticism that it no longer means anything. Science should invent some new word to represent healthy and informed skepticism.

[@user-uc2qy1ff2z]

@@xintophotography9848 As if worldwide bullexcretes is sanely explainable without conspiracy theories. However, conspiracy theories could have different quality.

[@emildavidsen1404]

Im gonna second what another has already commented, flerfs are "just" one of the many conspiracy theories which has flurished over the last couple of decades. We humans have some catching up to do regarding our social and cognative abilities if we are to keep pace with our information tech. Using history as a guide, I'd say there is a decent chance/risk that many wars will need to happen before we take this seriusly enough.

[@doraemon402]

The thing that sets flat earthers apart is the fact anyone can prove them wrong, unlike with many other topics that require far more complex experiments.

[@drgetwrekt869]

so true. instead, there are some fields where proving some bs wrong is basically impossible or very hard (for many reasons), including one of Sabines lovers: fusion.

[@catman8770]

At this point I am starting to be convinced flat earthers exist solely as a psyop to make anyone who questions anything look absolutely stupid and insane.

[@MarcPagan]

Exactly like Dem Party voters ...Flat Earthers are fact immune.

[@KendraAndTheLaw]

Ask them how eclipses work. The answers are most hilarious.

[@user-si5ik5xf3m]

Actually, you can't use facts against them or probably even the arguments. Only one will remain eligible at the end: the problem of which model is more absurd. I've argued with the russian community back in 2018 end to beginning of 2019. They just come up with some magic always. They'll bring out any magical, absurd hypothesis that can contradict their other assumptions only for the earth to remain flat.

[@flyjet787]

I agree. Scientific illiteracy is a growing problem. I am especially concerned by leaders who make major policy decisions while not understanding even the most basic science.

[@StizzY8]

According to flat earthers, you should be thrown backwards at 570 mph when flying in a plane.

[@taWay21]

The scariest thing is there seems to be a growing reality gulf between folks with common sense and critical thinking skills, and folks who just consume everything they see on their phone screen.

[@YellowKing1986]

The population of flat earthers is utterly insignificant. It's like a certain group of people who think they are not who they've been born as. Its a tiny fraction of people and yet we are expected to accomodate it and have the one correct opinion on it. Personally I don't think they matter that much. Let people be wrong. The only reason you know they exist is because it's a click inducing topic. So dumb you just cant help but be fascinated by it. In reality its just a drop in a bucket.

[@declandougan7243]

@@YellowKing1986We are not expected to accomodate flat earthers. They are flat out wrong. We should be expected to accommodate transgender individuals, because that’s not about belief it’s about survival and wellbeing.

[@GusOfTheDorks]

You know, maybe saying this would mean something if we didnt just spend multiple years of scientists and the public regurgitating whatever their phones and TV screens said about covid.

[@YellowKing1986]

@@declandougan7243 But we are expected to accomodate other cultist believers, like transhumanist ideas. It's interesting about why is that the case with some, and not with others. Why is it that so many people who aren't part of their weird niche community are thinking about, talking about and making videos and consuming videos about it? It's a curiosity. It's weird adn bizzare thing you notice because it stands out. It doesn't tell you anything interesting about people as whole. Other than that some people are just into some weirdness. And it has no impact on your life, if you don't let it happen.

[@YellowKing1986]

@@GusOfTheDorks Exactly, the term "conspiracy theory" or "misinformation" lacks any substance. It's not saying anything about the quality or validity of information.

[@amantedar123]

If the earth was flat, cats would have thrown everything from the edge.😅

[@getsideways7257]

Ok, now that's an argument nobody can win against :))

[@johnrhodez6829]

My cat Bob spent his whole life of 19years trying to prove this

[@scotttaylor9133]

Convinced.

[@saltytate]

Why not come up with your own joke rather than stealing the joke from someone else?

[@vibaj16]

@@saltytate Why do you care? A joke is a joke.

[@kamino8240]

Yes, totally agree. When stupidity is more and more accepted and respected, that becomes dangerous

[@claytonr3573]

Not to mention promoting flat earth theory has been profitable for some on platforms like youtube and ticktoc. It would not surprise me if some are not ignorant of the fact earth is round but promote the flat earth theory because it makes them money.

[@BoBoZoBo]

I have a private pilot and space enthusiast and my father-in-law in Iowa talk about aviation and space all the time for the first 10 years of our relationship. One day he got a new smartphone and I introduced him to KZbin. Told him I had really good videos on space flight and aviation. 6 months later he became a complete flat earther. True fucking story. One day I had asked him if he had seen the SpaceX launch and then he told me it was bulshit it took me a good full hour to realize that he wasn't joking around with me and that he had seriously changed his mind about everything. Thank you internet.

[@raypeery6317]

Cool story bro. Variation 11,075 on the same story. Globetards have no imagination, just parrots and sheep.

[@ronpapi9539]

All retired Pilots come forward with FE Truth, so as not to lose their retirement benefits by exposing the Lie of a Globe

[@parody_bear_mike]

Bruce McCandless made history performing a spacewalk during STS-41B with no lifelines Bruce's rotation 1,000 mph Bruce's orbit around the sun 66,600 mph Sun's orbit around the galaxy 514,000 mph Galaxy traveing thru space 3,600,000 mph not felling any of it Priceless? or MindLess!!

[@grahvis]

@@parody_bear_mike . The human body has no mechanism for detecting constant, steady movement, only a change in speed or direction over a certain amount.

[@distortionhead37]

Much ouff!

[@scollyb]

The thing that really amazes me is that the rise in cheap drones hasn't killed flat earth. You literally have a machine where you can move the horizon back and forth at will

[@osmosisjones4912]

You can test curvature of the ground why towers get shorter before They get smaller Tower . Traffic lights behind other traffic lights are visible

[@M_SC]

You don’t understand psychology, which I don’t mean as an insult. It’s not about physical facts. It’s about emotions

[@Llortnerof]

These people will literally refuse to accept reality if it doesn't fit their preconceived notions. Not that reality gives a damn either way.

[@thorwaldjohanson2526]

It's usually people who believe in other conspiracies, have distrust of the government and anything they don't understand. Being part of a group and having an external reason why things are bad can be comforting to people.

[@matthewedwards9423]

Drones are in on it.

[@larryvanbarriger6670]

I just tell flat earthers that if the earth is flat then why has their life progressively gone down hill? 🤔

[@iggi3985]

FE isn’t growing. The grifters just grift more

[@brothergrimm9656]

The information age has revealed one thing, nothing travels faster than light except ignorance and conspiracy theories on the internet.

[@tvviewer4500]

How many covid boosters do you have in your arm, slick?

[@yeroca]

obviously wrong, but also correct for comedic purposes

[@Rhomes7]

Truth. Even the universal speed limit bends the knee for Dunning-Krueger.

[@Raphael4722]

I'm tired of people complaining about the internet. There were probably even more uneducated people with ridiculous beliefs BEFORE the internet. You just didn't know about it because they would only talk to their friends and family about it.

[@tvviewer4500]

@@Rhomes7 how many Covid boosters do you have in your arm, smart guy?

[@Funbot15th]

I like Dan Olson's explanation. Flat earth is not about finding the truth. Rather, it is about finding some comfortable explanation for chaotic nature of reality and having some power in it.

[@mithrae4525]

As with all conspiracy theories the feeling of being special, "in the know" is one of if not the main attractions; especially so for flat-earthers where other common components (eg. eliminating cognitive dissonance as with climate science deniers/Biblicist young-earthers, or narrative framing as with contrails/FEMA death camps/anti-vaxxers) don't really seem to apply.

[@citoante]

@@mithrae4525 And, so what? Who cares? All I see is a superiority complex over something stupid.

[@scotttaylor9133]

@@mithrae4525 Well, I'm certainly glad you know that you're not one that needs to feel you're in the know when others aren't.

[@scotttaylor9133]

I think this is a VERY universal and human thing you're talking about here, and I think it will continue to rear its head in all sorts of ways, areas, people and ideologies as we become increasingly specialized with our ever increasing body of human knowledge. It's not about smart or dumb, or even being right or wrong. It's about how we cope with a world far, far too large and a body of knowledge way too broad and deep for anyone to even really conceptualize. Standing and looking at that, it's very difficult to understand how we fit in or how to even approach or deal with it in my opinion. We've all just found different coping mechanisms, some more sanctioned and normalized than others.

[@tadasdovii8262]

If earth is flat cats would drop off cliff everything and everyone by that time.

[@Mart_7512]

Flat "Earthers" are so depressed, they forget that science is *AWESOME & WONDERFUL,* with *SO MANY* beauties!!!!!!!!!!!!!!!!!!!!!!!!!!! That includes planets, including our Earth.

[@richardbell7678]

My favorite counterargument for the flat earth is that, just before sunrise and shortly after sunset, you can see clouds illuminated from below, by the Sun. On a flat earth, this is impossible and, unlike most of the other proofs that the Earth is not flat, clouds being sunlit from below is something that you can easily verify with direct personal experience.

[@radiotec76]

Ah, good one! I’ll use that.

[@MelodicTurtleMetal]

It works on some models. The best part about flat earth is that they don't agree with each other, and there is a solution to every single problem - though half there models only solve a single problem

[@charredbirchguy2349]

As the sun starts going under the rim, it can illuminate the undersides of the clouds. This happens just before it passes the four elephants that are supporting the Disc. Then, iirc, it also passes beneath great A'Tuin the giant turtle that supports the elephants. But I'm a little unclear about that last part.

[@richardbell7678]

@@MelodicTurtleMetal Any flat earth model that allows the Sun to be shining upwards on the bottom of clouds does not have light travelling in straight lines, so a flat earth would seem to be a curved surface. Claiming that the earth is flat, because it looks curved is an indefensible argument.

[@MrHominid2U]

@@charredbirchguy2349 After that it's turtles all the way down

[@ernestuz]

I met a flat earther in Texas 5 or so years ago. The guy was an engineer, at the beginning I thought he was just joking, but nope, he was genuine. At the end everything came down to his religious beliefs.

[@GuardianSoulkeeper]

_"Religion Poisons Everything"_

[@johnhough7738]

If his religion involved engineering, and if his engineering involved religion; just so long as none of his bridges or buildings fell/fall down, no problem. But if he cast aside practical safety considerations and just prayed to The Lord for those to be covered; I think he should be promoted to ex-engineer. Perhaps he compartmentalised? A lot of them do, and some are brilliant at it. (And now to look up 'cognitive dissonance' again ...)

[@gibfear]

He "said" he was an engineer you mean? 🤣

[@johnjeffreys6440]

Flat earth is not biblical.

[@pvanukoff]

I've known at least one educated, professionally productive flat earther. It's weird.

[@Brugar18]

Biggest problem is that smart people lack confidence while stupid people are overconfident

[@kamukameh]

As you rightfully mention: If one is told that a dead guy walks away from his grave after 3 days, that one also will believe other insane stuff. And if Religion is taught the same way science is, like we German speaking middle-Europeans do, then some people will take that as the two topics being equal. (Pardon my french!) Important video! The problem is: A scientific thinking person doubts his/her own thoughts, a believer wouldn't ever go off from his believes (that's where religious thinking's kicking in). And that's the point they think they are right, because they aren't in doubt (a dogma used in a lot of religions by the way).

There's flat earthers all around the globe.

[@thstroyur]

As well as atheists - for God's sake...

[@causewaykayak]

😂

[@getsideways7257]

@@thstroyur Good one :)

[@GravInducedSleepTrac]

The smarter you are the dumber (smaller) you feel, The dumber you are the smarter (bigger) you feel! Self produced Dopamine is some mighty powerful stuff !😮

[@stefanbrill4165]

In earlier times, esp. in wars, this was a valuabe asset. One could send them to the front and they could be pretty useful. Of course, they were used up there. Nowadays, they accumulate.

[@MrHominid2U]

The Dunning Kruger effect in action.

[@Chris-hx3om]

The more you learn, the more you realise you don't know.

[@wesbaumguardner8829]

Oddly enough, most academics feel that they know everything.

[@kruleworld]

i feel i'm smart enough to know how dumb i am.

[@CuriousChronicles82275]

How dumb can I be. Flat earthers: YES

[@mkx9095]

kzbin.info/www/bejne/p3bEeZ2Ge5lqlacsi=CkC3Hh1CvfdJm9z1

[@CT99234]

Why would anyone worry about this. The Internet is just a way for weird idiots to meet online and feel they are part of a community. 30 years ago they would have just been the oddball you avoided in the pub. They are still that person and still as capable of actually affecting anything.

[@RocketCouch]

The issue is that the internet now allows all those village idiots to connect with each other and form large groups.

[@dannyhodorowski5847]

Because they share the same epistemic failures as other conspiracy, pseudoscience and religious groups that do wield social and political power. So, it’s not really the idea in itself that’s an issue, but how they think.

[@andysmith1996]

For the same reason that people worry about cults and scammers. People pushing flat earth are grifting the uneducated, the stupid, and the mentally unwell, and once people get sucked into paranoid conspiratorial thinking like this it can have a negative effect on their lives and relationships.

[@TimeHunter2305]

The lady is right. When a grown man comes up with the idea that our planet is a flat plane and that the governments around the world are keeping it a secret for some reason and still manages to get thousands of followers, there is definitely something wrong with our world. What is it that makes all those people gullible.

[@ronpapi9539]

Without diligent Research on FE ,you'll always be confused.Laziness and Denials aren't helping your case.Educate yourself instead of asking childish questions.

[@johnqpublic7608]

@@ronpapi9539 _"Without diligent Research on FE ,you'll always be confused."_ if you can't determine that flattardia is the stupidest hoax on the internet in an afternoon, there is something seriously broken between your ears.

[@powerpc6037]

I even had a friend who was a construction worker and builds houses become a flat earther. He should know about the curve of the earth and to include it in your calculations or your building won't stand for very long.

[@wout123100]

this is a belief that does not harm, let them.

[@scotttaylor9133]

This is just like Bill Burr said, we have so many people now and the ability for them all to communicate so quickly that you have communities or echo chambers built for every crazy thought people have. And likely large enough constituencies and communities to matter (say over about 40 to make the thought feel normal, tribe sized) where once you had lone cranks (and this goes for all manner of fringe ideas, some of which are bad and some of which may be good but outside the norm). I think this is a function of a much larger population without geographic bounds on communication. I think we have large groups that are far outside the normal part of the distribution with the ability to see all the others in this sliver and talk to them. They can form a tribe and reinforce each other socially in a way we never could do before. There have a been a number of attempted movements like this in the last 10 years that were far, far worse than believing the world is flat (which is actually extremely innocuous because to most people on earth it simply doesn't matter at all if it's flat, round or anything else because it's always flat local to them so none of this impacts their thinking or actions in any real way). The one I'm thinking of was a VERY short lived 'movement' to try and normalize older people and younger people in 'relationships' as just another form of normal sexual preference in humans. Naturally anyone with children knows how insane, predatory and disgusting this idea is. But there were enough of them out there, talking as a group that they'd convinced themselves they weren't that abnormal. I think it's a weird problem of instant communication across such large groups of people, and flat earth is far and away not the worst example of this in recent memory. Honestly I don't see why the flat earth idea even remotely matters. It makes no difference in their daily lives, it's just a crazy thought that might make things seem a little more fun for people in a world that can seem bereft of mystery or anything left to explore or discover.

[@radiobabylon]

never underestimate human stupidity. i am constantly thinking ive seen its limit, and am constantly surprised how wrong i was.

[@Llortnerof]

Two things are infinite: The universe and human stupidity. And i'm not sure about the former. - supposedly Albert Einstein

[@normangensler7380]

Makes you think that Satan himself roams the entire earth messing things up, doesn't it? Now that makes more sense.

[@szolanek]

Agree. They tried hard many times to infect a healthy person with a virus and never succeeded. They never isolated one. Still, we live in the age of viruses. Also, we went almost extint of low CO2 levels. We managed to pull it back a bit. Still needed more for healthy plant life, but they don't want undeveloped countries to develop, so they lie about climate change. Only the night temperatures riser in cities, as they developed. Also, the US has 800 military bases around the world. Russia has one, therefore they want to take over the planet. Also, Israel collected all weapons from the kibuces a month before okt 7 around Gaza, shut down the security systems, responded in 7 hours, instead of 15 minutes with chopters, and killed about 1000 of their own, but they were attacked "by surprise" and from self defense they can exploit the gas-and oilfields offshore Gaza. If you criticize them you are antisemitic, while Israelis are European and Palestinians are semitic indeed. Yeah, I have to agree with you.

[@haqvor]

@@normangensler7380 except that introducing such a being into the equation doesn't pass the test of Occams razor. The existence of supernatural beings is neither a necessary nor required condition to explain the observed phenomena, human shortcomings is more than enough. I would instead argue the opposite, the human tendency for religious believes, and with that an accepted lack of critical thinking, is at the center of all conspiracy theories. Humans are not much more than a glorified chimpanzee after all.

[@combatepistemologist8382]

"Think of how stupid the average person is, and realize half of them are stupider than that." - George Carlin

[@xavierkreiss8394]

A IMO the best argument for flat Earth was given a few years ago by an American athlete (I forget his name) who said he'd suddenly been connverted when he was lying on a beach, and explained why. He said "it seemed pretty flat to me".

[@whichgodofthousandsmeansno5306]

The problem is things like cameras and telescopes don't work on Flatardia. And things like math, scale, logic, evidence, facts and reality don't work for flat earthers. In short, trying to teach a flat earther how we determined the shape of the earth is akin to trying to reason with a bag of hammers.

[@c.augustin]

No, it's not a lack of understanding - flerfs ignore even very simple to understand things in favor of their cult. Yes, there's a lack of education and scientific "knowledge", but to me it looks more like willful ignorance to be part of a group that claims to be special. It is a cult. Oh, and lots of grifters who found that there are gullible people out there they can part from the little money they have. And trolls alot …