You know what defeats strong full disk encryption? $5 wrench hitting you until you unlock it.
@rajasekharareddy45842 жыл бұрын
Classic and effective 👏👏👏. 😂😂😂
@YerBrwnDogAteMyRabit2 жыл бұрын
Rocks are free. Save the $5 for a latte.
@ireallyreallyreallylikethisimg2 жыл бұрын
A hotkey to zero write ;)
@spamlogs27012 жыл бұрын
Killswitch big brain play
@ArthursHD2 жыл бұрын
If it automatically boots like Windows you can deprive it from updates and reverse shell into it with a known exploit. Completely bypassing encryption :D In that way LVS and VeraCrypt is better than BitLocker standard implantation. Quickest wipe is to blow up NAND chip in seconds. Could also modify the package and fry it with an electric ⚡ arc 😄
@sethh95502 жыл бұрын
Mental Outlaw please never stop making videos, im going to college for comp sci next you and you are a HUGE inspiration. Keep up all the content even workout/meal vids all amazing.
@MentalOutlaw2 жыл бұрын
Thanks, good luck with your classes and remember to network!
@bubbleboy8212 жыл бұрын
The real value of college
@J43rv12 жыл бұрын
Stay woke, avoid college, get certs and xp instead - it's the MO way
@newtonbomb2 жыл бұрын
@@phillipanselmo8540 I'll tell you what, my local state university comp sci/engineering department sure was a pretty garbage experience...
@J43rv12 жыл бұрын
@@phillipanselmo8540 I'm not saying I agree but Mental Outlaw made a video about this exact problem, in case OP hasn't seen it
@Action2me2 жыл бұрын
“And it’s really popular on dread” 7 upvotes
@animepussy83562 жыл бұрын
Meow
@user-el4su7tl6f2 жыл бұрын
That's like 700 upvotes on read-it
@someweeb36502 жыл бұрын
@@user-el4su7tl6f that's still not much
@vladaguljas42582 жыл бұрын
@@someweeb3650 Hi still, whos much?
@xd-mw4kx2 жыл бұрын
Mass majority of people don't sign in or have an account
@WarLordN1k2 жыл бұрын
USPS tracking normal packages with tor sounds like my kind of trolling.
@nothing_2 жыл бұрын
It sure does.
@pseudoluxurynight2 жыл бұрын
ikr
@eac-ox2ly2 жыл бұрын
Imagine if someone made a bot to somehow retrieve tens of thousands of USPS tracking numbers and then automatically looked them up with tor. That would be some fancy obfuscation.
@WarLordN1k2 жыл бұрын
@@eac-ox2ly I think you have a wonderful idea right there.
@eac-ox2ly2 жыл бұрын
@@WarLordN1k 😈
@midimusicforever2 жыл бұрын
What's needed and what's not depends on the threat model. Always start there!
@quiteafancyemerald2 жыл бұрын
I just love how informative this is. Not like I would do anything ever related to this but keep making unique interesting content :)
@vsnusv75552 жыл бұрын
surely
@TheSuperBoyProject2 жыл бұрын
Oh, I would never *wink* *wink*
@hanabiilesley2 жыл бұрын
i mean, either you initially create really informative recourse, or don't even attempt since even smallest mistake could cause smb huge problems
@yallugly43172 жыл бұрын
I certainly do lol gotta love the vendors
@Riftio6172 жыл бұрын
thats what they all say
@crabbyboi91272 жыл бұрын
i feel like just watching these vids have put me on a government watch-list
@andybuscus383 Жыл бұрын
Guess you just gotta follow these steps so the government can't watch you anymore.
@jer1776 Жыл бұрын
Same lol, Im just an IT Networking/Cybersecurity major who finds this stuff fascinating. Wouldnt pass up working for the Feds if I had the chance.
@crabbyboi9127 Жыл бұрын
@@jer1776 ha ha yes me too ha ha (are the feds gone yet?)
@Conorscorner6 ай бұрын
@@jer1776uh huh, Sounds like a carefully crafted alibi that a Super Dark Net Hacker Lord would say.
@Conorscorner6 ай бұрын
@@crabbyboi9127Of course, we're too busy going after politicians, the mega wealthy and corporations to pay attention to unimportant stuff on here.
@yb78752 жыл бұрын
Im glad this channel is getting more views. The more viewers this channel has, the less suspicious a person is for watching it, people are increasingly more likely to be normies instead of privacy nuts. Keep it up, been here for a while, and yours is better than the rest.
@yb78752 жыл бұрын
I know its not the sort of thing you usually do, but I looked up tutorials on yagi antennae wifi extension and its very lacking. It sure would be good if there was one on youtube, made by a reliable guy..
@mathisblair27982 жыл бұрын
I have to give Denshi an honorable mention too now and again, perhaps for more recreational knowledge.
@s4ms3piol302 жыл бұрын
Hey Mental, I just wanted to say that I'm studying computer science at university and want to pursue a career in security, And your videos have been a tremendous help! Especially the way you simplify complex attacks in layman's terms, I'm surely going to credit you in my Graduation speech! Love ❤️
@fahimp32 жыл бұрын
Or Mental could be a CIA honeypot... Just saying. Also I found "A Graduate Course in Applied Cryptography " by Dan Boneh and Victor Shoup very helpful in understanding the computer science side of things. It is available as a free pdf online.
@s4ms3piol302 жыл бұрын
@@fahimp3 thx
@Sombre____2 жыл бұрын
Advice : Don't buy Hak5 device. :)
@s4ms3piol302 жыл бұрын
@@Sombre____ i hate em anyways
@Sombre____2 жыл бұрын
@@s4ms3piol30 Good. Because it's script kiddies stuff or the best way to get caught. They resell opensource stuff in a shiny box with their name. They will be the first to snitch you if the feds ask them question.
@fancywaifu98212 жыл бұрын
I’m going into college next year for computer science and cybersecurity. I’ve already been studying in these fields for a while now. The more I learn about cybersecurity, the more I want to take more action in my life to make my life private and secure. Your a big inspiration mental outlaw!
@mineis3andhalfinches8652 жыл бұрын
I hope you succeed, cybersecurity is cool as hell. Im currently saving to take courses for networking and kali linux. mental outlaw got me into this after watching his vid about mcafee getting shwacked a year ago
@fancywaifu98212 жыл бұрын
@@mineis3andhalfinches865 Definitely a good field to get into!
@w花b2 жыл бұрын
My man's gotta get big money
@Concise_Parakeet2 жыл бұрын
@@w花b lmao
@imonjenkem Жыл бұрын
going into college but cant use the proper youre form kek
@olivialambert41242 жыл бұрын
I think its incredibly interesting to learn about. But personally I just eat my bugs and live in my pod. I can't deal with the hassle this entails. But god bless you guys fighting the good fight to avoid mass surveillance and huge governmental overreach.
@eac-ox2ly2 жыл бұрын
This made me cackle. Thanks.
@olivialambert41242 жыл бұрын
@Zero One I'd like to hope so too. Perhaps if I search some naughty words I might get my own NSA friend. I do wish he reached out for a chat over covid though, it might have made both me and my agent a little less lonely over that year. Hopefully he likes computer games. I can get my very own government mandated stream viewer without even paying for big follows.
@damazywlodarczyk Жыл бұрын
@@olivialambert4124 what kind of bullshit is this
@catcatcatcatcatcatcatcatcatca2 жыл бұрын
Wrapping packages in tinfoil in public bathrooms seems disturbing enough to make people notice and possibly call the police. It’s kind of like wearing a mask when picking up the package: sure it inconveniences any law enforcement tracking the package, but it also alerts the normal law enforcement of possible robbery…
@julianbinder23712 жыл бұрын
luckily there's covid masks now, just make sure to look like a liberal If you live in a very conservative area where a mask would be unusual
@ArthursHD2 жыл бұрын
There are silicon masks 😷 that look like $ex doll faces 😄 Pretty realistic if you ask me. :)
@pseudoluxurynight2 жыл бұрын
Wearing a mask is normal nowadays because of the pandemic, actually.
@a_wild_Kirillian2 жыл бұрын
There are cabins in public bathrooms, you know.
@pseudoluxurynight2 жыл бұрын
@@a_wild_Kirillian what do you mean?
@TIOLIOfficial Жыл бұрын
6:25 - As far as the Ross Ulbricht library situation, it wasn't that he was "trying to he a hero", as you once said". Here's what actually happened: two officers created a fight. When Ross was sitting in the library with his laptop, the agents knew they could not just rush him, cause he most likely would have just hit the kill switch. So what happened was that the 2 agents started a fake fight and when at one point when of them raised their voice, Ross turned around to look. Unfortunately, that split second of our natural reaction was all it took for a third one to grab the computer, while the others grabbed Ross himself. Ross didn't walk over to anyone, he didn't try to "play the hero", as you once said.
@donovantheghost4179 Жыл бұрын
Use a laptop with out a charger. 😅
@stigcc9 ай бұрын
If you have Tails with a string attached to your wrist and the usb drive, it would be a physical kill switch.
@guardsmanharvey47603 ай бұрын
@@stigcc best thing to do is utilize clear fishing line as well, preferably high enough test to pull the thumbdrive out but not thick enough to be noticeable.
@honor9lite1337Ай бұрын
Please, elaborate @@guardsmanharvey4760
@delchodimitrov94392 жыл бұрын
"Don't talk about Dark Web in public!" -- Mental Outlaw :~70% of his vids - talking about things related to the dark web -- Mental Again :D
@blackninja94002 жыл бұрын
We suspecting this channel is some honeypot for feds. Why? Why Google allow this on KZbin?
@kim-hendrikmerk41632 жыл бұрын
Means he probably isn't using it. Or he has some mind boggling strategy that we are too simple to understand.
@wontcreep2 жыл бұрын
the technique is to only talk about things you don't REALLY do :))) and shutting up about the spice
@egarcia13602 жыл бұрын
As in, don't talk about your dark web activities in public because you could incriminate yourself. His content is just for educational purposes ;)
@e3.14c42 жыл бұрын
Not what that's supposed to mean. Like if you go watch an illegal boxing match (if those still exist, or ever existed on the internet, just pulling an example out of fiction to stay pg), and then tell all of your buddies you saw someone get their face tore open by brass knuckles. Every piece of information you emit, is a liability.
@KristophM2 жыл бұрын
You're a legend, Kenny! Over a decade ago I tried Ubuntu just for the hell of it and I hated it. But after finding your channel, you're the sole reason I ditched Windows and got into GNU/Linux again. And I've gone down the rabbit hole. Currently BTW I use Arch, lol 😎
@sirzorg57282 жыл бұрын
How do you know who uses arch? They will tell you within 5 minutes of meeting you.
@mathisblair27982 жыл бұрын
@@sirzorg5728 It's true, for you see, tis I, who also is an user of thee arch, verily.
@JamesWilson012 жыл бұрын
@@sirzorg5728 Vegans too. They should do a study on the correlation of Arch usage to veganism. It would be a good use of public money.
@0xC47P1C32 жыл бұрын
Kung Fu Kenny at it again
@Gilbert29882 жыл бұрын
how much do you weigh?
@4erepX2 жыл бұрын
Good guide, but the thing is , you can achieve decent security from any device if you just SSH to a dedicated server (rented using monero or any other anonymous method) and by using some tor/proxychains . You can change this servers like once in a week or month (depending on your business). And to avoid being compromised u can just setup your own VPN server that will act like a bridge between your PC and Wi-Fi router. So your PC won’t connect to the Wi-fi manually, traffic will always go through some Raspberry PI with VPN on it. Plus you can just carry it around with you and use it with Public Wi-fi which will make really hard for anyone to identify your activity.
@jakdamkatnia53352 жыл бұрын
Always happy to see a mental outlaw post, i'm working on my cybersecurity certs, and you help keep me up to date on the latest security news and tips :)
@bluegizmo19832 жыл бұрын
if your gonna take the package somewhere else to open it, write "return to sender" on the outside of the package immediately upon receiving it, so if they grab you as soon as you leave the house, your just taking it to the post office to return it as you didn't order anything.
@Sthrl1882 жыл бұрын
thats actually genius
@Tor010 Жыл бұрын
They never do that, they will just get you too sign on delivery and then let themselves be known,
@thegamefanaticshow2 жыл бұрын
A fantastic method of physical security is to get a usb drive that can securely connect to a lanyard. Find a lanyard that can securely STAY wrapped around your wrist. Make sure lanyards long enough to use the laptop while securely connected to your person and USB drive. Tada now you got a dead man’s switch, at any time that machine is separated from you instawipe!
@honor9lite1337Ай бұрын
Ok, make sense.
@gregbagel7912 жыл бұрын
As a brand new cyber security masters student, I will watch this channel’s career with great interest
@SearedBite2 жыл бұрын
"at this point we've entered tinfoil territory" bruh as if everything before that wasn't?
@lightyagami17522 жыл бұрын
From that point on it was *literal* tinfoil territory.
@bruh-db8by2 жыл бұрын
it isnt tho bro
@alreaud2 жыл бұрын
@@lightyagami1752 Maxwell's 2nd law. Go buy an AirTag and try it out. I used to run a lab at a company that made data conversion products. We had a real Faraday cage, big. We didn't use tin foil, we used a copper mesh. Two layers, separated by a 2x4 and grounded to earth ground. The test was tune the strongest local FM radio station and shut the door. Static...
@laststand6420 Жыл бұрын
@@alreaud Would that still work without grounding?
@JamesWilson012 жыл бұрын
Ah, Dread. Always a good wholesome read! Everything from security gods to insanely paranoid dudes trying to score their first gram to kids making death threats against hardcore criminals 🤣 This "guide" went from some James Bond sh*t to the most stupidly obvious way to get phished. Nice job on pointing out the flaws 👍 Btw Tails doesn't come with a Monero wallet which made me think that could be the glow boys target no.1 for trojanizing the OS. Keep up the good work man!
@s4ms3piol302 жыл бұрын
the security gods on dread are really gods
@JamesWilson012 жыл бұрын
@@s4ms3piol30 Worshipped daily by many tens of people 🤪
@KManAbout Жыл бұрын
Carcano > monaro
@KB-nt7eg Жыл бұрын
@@KManAbout you mean cardano and monero? How broke are you? Lol
@KManAbout Жыл бұрын
@@KB-nt7eg smartphone keyboard broke
@benneilsen29152 жыл бұрын
He makes a lot of points of not using your home WiFi, but if you want to protect your other devices, just segment it. If you're firewall-savvy you can make a separate subnet for risky devices and install strict host firewalls on them.
@S_Roach2 жыл бұрын
There is a saying, "Don't S* where you eat." That's why you don't want to use your own WiFi. Turning logs off on your router won't matter if they already know your address was involved.
@yourlocalcyborg2 жыл бұрын
10/10 tutorial as always, my good man! Keep up the fantastic work
@thekeyboard112 жыл бұрын
Yeah, 10/10 tutorial about getting darknet goods shipped to your house
@ArthursHD2 жыл бұрын
Tried to post a few things not mentioned, but KZbin keeps detting my comments :( Too sensitive :D Base64 encoded comment for the algorithm (: V2h5IHdvdWxkIFlvdXR1YmUgcmVtb3ZlIG15IGNvbW1lbnQ/CkJpcXVhZCB5YWdpIGlzIGEgbmljZSBoaWdoIGdhaW4gYW50ZW5uYS4KVXNlIHVuaXF1ZSBlbWFpbCBhZGRyZXNzZXMsIEFjY291bnQgbmFtZXMgZm9yIGVhY2ggYWNjb3VudC4gd2lsbHdoaXRlIC8gZnJlZW1haWwgb24gR2l0aHViIGhhcyBhIGxpc3Qgb2YgZnJlZSBlbWFpbCBzZXJ2ZXJzCklmIHlvdSBwb3N0IGNyeXB0byBhZGRyZXNzZXMgZG9uJ3QgcmV1c2UgdGhlbS4KSWYgeW91IHVwbG9hZCBwaG90b3Mgb3Igb3RoZXIgY29udGVudC4gUmVtb3ZlIHNlbnNpdGl2ZSBpbmZvIGFuZCByZW1vdmUgRVhJRiBkYXRhIGxvY2FsbHkgb24geW91ciBkZXZpY2UuCkRvbid0IGdldCB0b28gYmlnLiBDaGFuZ2UgbmFtZXMuCkNvdWxkIG1lbHQgTkFORCBjaGlwcyB3aXRoIHB5cm90ZWNobmljcy4gRGFya25ldCBEaWFyaWVzIEUgMzkgaXMgYWJvdXQgdGhhdA==
@axelaxel31562 жыл бұрын
@@thekeyboard11 huh?
@maximilian2000572 жыл бұрын
Who is that girl in your pfp?
@Laurens1152 жыл бұрын
Why is your content always SO good and SO consistent??
@KrisAkaVenno2 жыл бұрын
Shrigma grindset ofc
@animepussy83562 жыл бұрын
Meow
@rbda89212 жыл бұрын
@@KrisAkaVenno Shredded sys admin that uses gentoo in personal laptop, literal gigachad sigma based. My guy IS the steryotype
@spamlogs27012 жыл бұрын
Unlike network chuck he isnt a sensationalist i like it
@animepussy83562 жыл бұрын
@@spamlogs2701 Cat Man vs Network Chud
@aZebruh2 жыл бұрын
“Yes officer unfortunately that $100k in bitcoin was lost in a boating accident :(“ Edit: If you liked my comment, also like the video, cause its really his joke not mine😉
@chrishears2 жыл бұрын
Catfish got it bruh.
@mrbanana64642 жыл бұрын
You can have the greatest opsec in the world but mysterious crypto transactions, especially in large amounts, won't be getting past the IRS. Always pay your taxes.
@Cookiekeks2 жыл бұрын
@@mrbanana6464 Not even the IRS can track monero transactions
@joey1994122 жыл бұрын
@@mrbanana6464 IRS put a seething bounty on cracking Monero because they actually can't track it.
@mathisblair27982 жыл бұрын
@GENDER EQUALITY IS A MYTH tis why I never set foot in the ocean. We evolved from sea to land not vice versa I say.
@tommyshaw2420 Жыл бұрын
Rule 11. - "Dont tell anyone about your darknet activity".............This is a must, I had a DEA agent tell me one time that if you sell or deal in drugs, every single person who you tell what you are up to( like a friend etc) you are 20% more likely to get caught, therefore if you told 5 people you are 100% guaranteed to get caught.
@SouthPeter98 Жыл бұрын
5 sequential increments of 20% is 67%, but good adage
@michaelangelo0305 Жыл бұрын
@@SouthPeter98 hows that
@stigcc9 ай бұрын
@@michaelangelo0305The probability that none of the five rats you out is 0.8^5=0.33. The probability that at least one of them do is 1-0.33=0.67
@michael-33896 ай бұрын
@@michaelangelo0305 idk how they got 67% but the probably after telling 5 people in that circumstance would entirely depend on how likely it was to happen before the first person you told. In truth, following the DEA officers logic, then after telling 5 people it would be 2.48832 times more likely than it was before you told anyone at all.
@Jango19892 жыл бұрын
"We're not going to discuss rugs" this took me a long minute😅🤣🤣
@rogainegaming69242 жыл бұрын
i dont get it.
@rogainegaming69242 жыл бұрын
@@MrZZ-py4pq Now I get it.
@axebeard60852 жыл бұрын
I have no idea if it is possible, but it seems to me it would be a fun FU to set up a biometric lock that wipes the machine instead of unlocking it.
@cleitonfelipe20922 жыл бұрын
That's a good idea if you can implement.
@axebeard60852 жыл бұрын
@Boy George if you're going to the trouble of setting up a finger-scanner wipe, then chances are opsec is more important to you than accidental data loss. And you could probably mitigate that problem by making a bi- or tri-fold wallet/checkbook case so that you don't accidentally touch that scanner while handling the phone. Or some kind of metal slipcase.
@cleitonfelipe20922 жыл бұрын
@Boy George Just don't accidentally scan your thumb
@Griimnak2 жыл бұрын
Having a separate laptop is good because it isolates your main hardware fingerprint from your deepweb hardware fingerprint. Example, if you're on windows cmd: wmic baseboard get product,Manufacturer This fingerprint of your board is traceable cross OS. If you only use one device and it is confiscated on basis of suspicion, they can confirm you are the person of interest via hardware fingerprint. Changing mac and etc wouldn't matter.
@Shuroii2 жыл бұрын
KVM doesn't set those by default and it becomes "generic vendor" across the board
@GaryCameron7802 жыл бұрын
Should law enforcement start asking questions your best option is, "I'm not going to answer that" or "I wish to remain silent." If you're in a jurisdiction where the 5th Amendment or equivalent exists I suggest using it.
@tygecafe90702 жыл бұрын
kinda makes you suspicous, i suggest do both lying and remaining silent.
@njpme2 жыл бұрын
@@tygecafe9070 innocent until proven guilty.
@d3stinYwOw2 жыл бұрын
@@njpme Not in this world dude ;)
@KManAbout Жыл бұрын
You shouldn't lie because that's a crime. Don't lie and there's nothing they can do. Being suspicious ain't a crime. There's too many suspicious people out there
@cipsone3595 Жыл бұрын
@@KManAboutThat's true! Being suspicious only leads to assumptions not hard proven evidence. So don't lie (if you don't want extra in court) and don't talk to pigs
@foxtailedcritter2 жыл бұрын
I
@truerandomchannel2 жыл бұрын
he is on odysee
@amogus72 жыл бұрын
odysee
@jtreg Жыл бұрын
use a spelling checker
@beagleonvodka Жыл бұрын
Am getting really tired of YT censorship, it's like Googles little bitch caught up in a polygamous love triangle with Zucks metaverse.
@dogfacezombie Жыл бұрын
Fr
@lavavex2 жыл бұрын
I love watching these videos that put me on the fbi watch list, lol. But great vid man, I love cyber security and opsec stuff!
@diogosequeira59262 жыл бұрын
Even as a law student I absolutely love your videos, don’t ever stop making those
@azatecas2 жыл бұрын
i love your opsec videos, great balance of comedy and good advice.
@dht73772 жыл бұрын
Love these type of videos. Huge inspiration for doing drugs and creditcard scams
@yourmomgay8742 жыл бұрын
His videos inspire me to go boating.
@truerandomchannel2 жыл бұрын
@@yourmomgay874 don't forget your thumb-drive with your crypto wallet on it!
@Gabriel-_-2452 жыл бұрын
Is it only me who watches this content without any intention whatsoever to do anything remotely illegal now or in the future?
@holthuizenoemoet5912 жыл бұрын
nope, its just facinating. I think its a bit like the seccond amendment for americans (im from the EU) where they feel that guns help protect them from the goverment
@nunyabiznes33 Жыл бұрын
I know 0 shit about tech but I still watch his vids every now and then.
@carl6825 Жыл бұрын
You're not alone, to me it's kind of like watching a true crime documentary, tinfoil stuff is always funny too like "wrap your package in tinfoil broOo0!!1!"
@ekremaslan8068 Жыл бұрын
of course, sir, I'm also a law abiding citizen just like you, I'd never do anything of the sort.
@dinky82920 Жыл бұрын
@@ekremaslan8068 Me too!
@ericm85022 жыл бұрын
Great video as always! Teaching valuable cyber security knowledge to this generation of zoomers!
@misty2k6452 жыл бұрын
im not in this field at all, im an accountant lmao, but i love just listening to you speak all these words hahah keep up the greats vids man
@theITGuy-no3nt2 жыл бұрын
I think TAILS is the best solution for the vast majority of use cases. No new hardware to buy, it generally warns you if you attempt to do anything stupid, has TOR baked right in, will let you you set up a bridge, never writes to local storage, yadda, yadda, yadda. It just wins. 🥇
@stigcc9 ай бұрын
Yes.
@trapOrdoom2 жыл бұрын
One of the smartest and most informed, arguably most important KZbin channel.
@nexusyang48322 жыл бұрын
You can also password bind the hard drive or ssd through the bios. Once that is done, you can encrypt the drive with hardware/software encryption. To get even nuttier, you can keep a separate encrypted volume that is stored within said volume. I think truecrypt (not sure if that is still around) but they used to offer a false encrypted volume that “looks” real but there is a hidden encrypted partition within it. Kinda trippy.
@uniquegod1997 Жыл бұрын
veracrypt, best encryption Software out there, yep
@YitzharVered2 жыл бұрын
I'm currently being sucked into the world of computers and programming all at once it it's quite jarring. I'm trying to learn everything from computer and cpu architecture, selenium web scraping, computer science basics as well as all this tor stuff. This is probably not the best approach I know, but there's so much to learn!
@dumkastriker2 жыл бұрын
okay my dude, your thumbnail game is lvling up with all them waifus, I can't stop CLICKING
@Lemonz1989 Жыл бұрын
Great video ☺️ I’m not a vendor, by the way, I just worked at a package sorting center for my national postal company. I just want to point out one thing people might not be aware of. I don’t know if it’s similar in other countries, but I wouldn’t have a return address at all on the packages if I was a vendor. I’d rather the package go to waste than it leading back to me, because you are guilty of possession and possibly distribution if you are sending or have been sent mail with illegal *rugs in my country; even if the mail was intercepted before arrival. Many countries don’t accept international letters or packages with stamps on them anymore, and will reject them, and possibly open them. They might send them back to you if you have a return address, or destroy them if you don’t have a return address. In the latter case, they will probably open it first, to see if there is any identifying information on the sender inside the letter/package. If you want to send past international borders, you will need a postal code or a letter/package label and possibly a special label made for customs authorities in the receiving country before countries accept the mail. These codes are unique for each letter/package. Most of these labels are bought online in my country, and you will receive a receipt to your chosen email, and will have to pay with a card. These labels require a return address before allowing you to buy them. Even if they don’t require a return address, I’m pretty sure the police are able to connect the payment card with the unique letter/package label, if they are really insistent on finding the sender. However, if you are able to send internationally with stamps, like within the European Union, which has free movement of goods between member countries, then do that. Remember not to lick the stamps (because of DNA), and it would be advisable to only handle the letters/boxes with gloves on, because many countries have national databases of fingerprints now due to the new biometric passports (the majority of Europeans have passports). This might seem insane and tinfoil hat worthy, but these are things that CAN happen, but probably won’t if you are a small vendor. It’s worth going a bit overboard, in my opinion, when you have taken all these steps to stop tracking online, and then risk being caught because of a relatively low tech mistake when mailing things.
@maricelaguzman2965 Жыл бұрын
They use return addresses of businesses that they are not associated with.
@Lemonz1989 Жыл бұрын
@@maricelaguzman2965 Do they use just any random business as a return address? That would, however, still leave the problem with payment cards possibly being associated with postal labels.
@maricelaguzman2965 Жыл бұрын
@@Lemonz1989 NO LOL. Bro.... The vendors do not pay postage with their card that's in THEIR name that would be idiotic. They use crypto postage services and most likely theyt have runners that drop their packages.
@Lemonz1989 Жыл бұрын
@@maricelaguzman2965 Where on earth would you pay for postage with crypto? El Salvador?? It’s literally impossible in Europe, as far as I know. And it’s extremely difficult, if not illegal, to get an anonymous payment card in Europe, due to money laundering laws. And crypto isn’t anonymous either. Only Monero, of the major currencies, is completely anonymous.
@stigcc9 ай бұрын
Not sure why using regular stamps is a bad idea. If you don't leave fingerprints or DNA on them, they are not possible to track back to you.
@24hourtourist2 жыл бұрын
Wow I'm surprised the YT gods have not pulled this yet as you're posting Darknet bulletin boards, Mental. Good info as always!
@gruzi.2 жыл бұрын
I don’t even use the dark net or deep web these videos are just interesting
@pseudoluxurynight2 жыл бұрын
they are the same thing
@flyback_driver Жыл бұрын
When I was in the military I had a friend of friend in psyops and they frequently handle material that cannot be lost. He taught me in a pinch you can take a handful of misc papers as well as the one you do not want seen and throw them in the kitchen sink. If you have alcohol or acetone dump it on top to bleed the ink and then run water on it. This is obviously a last ditch effort method but I feel like it applies here. Also, for secret documents and above shredding is not allowed. We exclusively burn documents like that because the army does not consider a shredded document destroyed.
@Tallero Жыл бұрын
even small museums are being offered tools for ai powered visitor tracking from the camera feed. So public route could really be less secure than one thinks. Fascinating stuff.
@rldp2 жыл бұрын
Whonix is theoretically more secure than Tails. Because Whonix uses a separate virtual machine for routing all traffic to tor (gateway) even if you fuck up and infect your workstation VM, it is near impossible to get your real ip without also infecting gateway vm. Also it has more built-in anonymization tools and techniques.
@alexdelarge94252 жыл бұрын
The only advantage Whonix has over Tails is malware protection.
@kim-hendrikmerk41632 жыл бұрын
To attack a Tails machine you would need either root access to Tails it slef or BIOS acess to the host computer. There is no way to access the internet on tails without tor.
@serpentixx8542 жыл бұрын
Yes, but if i.e. the screen or keyboard of your host are compromised, then whonix would be indirectly compromised too. Best would be to have a Live USB with Whonix on top in VMs on a persistent storage and do not use the host at all, except for installing the hypervisor and updating the system. That way you reduce the attack surface of the host, but get the advantages of Whonix.
@ButWhyMe...2 жыл бұрын
What about Qubes?
@ButWhyMe...2 жыл бұрын
@@leeroyjenkins0 Yea, I think so too. I just hate that Qubes "requires tons of ram". I really want to try to run it with only 4 gbs of ram to test that theory.
@wilurbean Жыл бұрын
Everything he said about the packages is true. It's been done. To prosecute they need intention and possession
@poprawa2 жыл бұрын
Separating hardware is proper way to go as if main and darknet machines are on in the same time there is no way to proof remotely by correlation, that one fingerprint is always off when second one is on. When working on years of aggregated data this method can really precisely point who owns what
@poprawa2 жыл бұрын
live cd first off when second on, and vM first on when second on and second disconnects before first does. It is not about who to hack, but who to raid
@v3listube2 жыл бұрын
It's been about 8 years since I looked into opsec and the same practices ar still relevant.
@seronymus2 жыл бұрын
Christ-chan thumbnail in 2022? Based bless you MO
@mr.cauliflower35362 жыл бұрын
I think the amount of people stealing pendrives with bitcoin wallets will increase as time goes on.
@screwgoogle49935 ай бұрын
I haven't seen a "pendrive" in 15 years
@MirajMusicUSA2 жыл бұрын
No joke. You have the best channel on KZbin.
@angelrosas37242 жыл бұрын
Rule 1: Everything is a larp except that which is hiding as a larp.
@josipX2 жыл бұрын
why do you even need to lurk on the darknet that much, stop glowing Kenny
@rileybrown90452 жыл бұрын
To add onto the darknet laptop angle: If you wear glasses, get a polarized pair & remove the polarizing film on the display of the laptop
2 жыл бұрын
If anyone sees you looking at a white screen for hours, they will think you are crazy
@tolkienfan19722 жыл бұрын
Genius!
@hasher93602 жыл бұрын
@ or they could see the actual reflection of CP and _know_ you are crazy
@joey1994122 жыл бұрын
Any tutorial for how to do this?
@osurgac2 жыл бұрын
Old thinkpads have a privacy filter on them by default. They call it a TN panel
@aaronryder40082 жыл бұрын
Remember when the dnm bible was on clearnet? Ahh those were the days.
@JocularJack Жыл бұрын
I feel like I am on a list just for watching this, but I follow Barely Sociable and find his series on DNM's fascinating, so when I saw this video I couldn't resist clicking 😅
@ApoplecticDialectics2 жыл бұрын
If I was in charge of interdiction efforts, I would put a lot of resources into the weakest leg of the darknet supply chain, the postal system. I'd be using AI to spot patterns, and I'd do a heck of a lot of random, passive scans of packages using machine learning to determine what is normal and what is not - weight/size of package, odor detectors, x-ray, and so on. And I mention this just to underscore that for all of this digital opsec, once a package is in the mail with your name on it, that's probably the biggest risk, and it is also the thing you control the least. I wouldn't bet on whether Darknet markets as a main source of non-government-approved goods will become more or less viable in the future, because they will keep building up government infrastructure around the postal service and they will strong-arm the big shipping companies the way they did a certain telecom some years ago with that room in San Francisco: they will make these companies an offer they can't refuse.
@Jacob-ol9ji Жыл бұрын
Ordering safely online will always be better then meeting someone on the street.
@beagleonvodka Жыл бұрын
Mental Outlaw You're one of my favorite cyber sec channels, each time you upload a video I am compelled to watch. Keep it up 💯!!!
@turtleb012 жыл бұрын
With tails on an old thinkpad, your wipe key is pulling out the battery.
@funnifurrytechgirl2 жыл бұрын
This guy is the reason I installed Gentoo, and I'm currently loving it.
@adam.k82222 жыл бұрын
Why do I feel like this video is only going to be available on Odysee in pretty short span of time.
@FACS012 жыл бұрын
im too normie to even run linux, but i still watch all your videos, very interesting!
@spamlogs27012 жыл бұрын
Linux mint cinnamon a toddler can pick it up if he grew up windows
@Gigachad-mc5qz2 жыл бұрын
Linux is easy
@FACS012 жыл бұрын
Didnt mean to say linux is hard, i just dont need it
@reconstructedrichard2082 жыл бұрын
you can do it if you want, I believe in you! Even arch takes only ~30-45 min to install and thats with a very detailed installation where you set up a lot of things you really don't have to set up until later. I got into linux with distrotube's arch install guide (any arch guide should work too), but you don't even have to use arch if you don't want to. It's very lightweight and has great meme potential though. Gentoo and linux from scratch I would avoid for your first distro but other than that you should be solid. I was in the same position as you, where I had cold feet and was too intimidated by arch but once I did it I was shocked at how easy it was. Happy computing
@Zimx022 жыл бұрын
@@FACS01 you need it. We all do
@aquadancookie Жыл бұрын
Hello Government Agent I Am Watching This Video For Educational Purposes Only.
@chubbycatfish45732 жыл бұрын
We should all live like Brill from Enemy of the State.
@Praecantetia2 жыл бұрын
I would like to "download " this video to add to the revenue with yt-red but as I learned it might force KZbin to reconsider if this Video should be monitized at all
@jer1776 Жыл бұрын
Doubt I'll ever have a use for half this info but love to learn about it. Great video
@Zinidia2 жыл бұрын
The best privacy hostname is "Admin" or "Administrator"
@tjmbv86802 жыл бұрын
I wouldn't update daily but weekly unless its a critical security patch, the reason being to give updates some time to make sure they are fully secure and don't have an obvious security venerability
@randommarkonfilms39792 жыл бұрын
Actually too you wanna unplug power from the computer after using TAILS. Technically keys may still be extractable for a bit. Also any computer with Intel ME or AMD PSP are other attack surfaces to be aware of.
@user-jx2kg2er5o Жыл бұрын
Dude fucked up when he said "tell the feds XYZ". Plead the 5th, PERIOD. By the time they have you in a room that's your best option.
@roboticbrain20272 жыл бұрын
The reasoning behind a separate laptop comes from a real concern about firmware level viruses. At least theoretically it is possible to persistently compromise a device in a way which is undetectable by the running OS. There have been numerous research papers about it. However if that happens, I'm not sure if Tor etc. would do you any good anyways.
@user-vn9ld2ce1s2 жыл бұрын
I have no idea why i'm watching this. No plans to do any illegal activity, unless our state falls into totality (again lol). It's just interesting, i guess
@reconstructedrichard2082 жыл бұрын
yeah me either, its just really interesting
@tearsintherain63112 жыл бұрын
Pretty sure tinfoil act as an antenna, I remember watching an engineering explaining why the whole idea is not just crazy but also counterproductive and the math was right
@truerandomchannel2 жыл бұрын
it can be both im sure, but if something is inside the foil that's different
@rusi6219 Жыл бұрын
It lowers certain frequencies and amplifies others, there's merits to it. Don't trust the popular opinion.
@AzazelHash281 Жыл бұрын
They already someone who has developed a software to monitor transactions on the blockchain, Darknet Diaries has a recent podcast episode on it
@Hauketal2 жыл бұрын
Don't set up a kill switch. You won't be able to use it when the flash-bang-grenade is thrown into your room. Have dead-man-switches that wipe your system as soon as you stop doing some activity for a while. Be fail safe.
@TomTom-gx1sm Жыл бұрын
"if I were to be asked about my BTC holdings I'd say I donated them" - LoL.
@corejake2 жыл бұрын
This bible is kinda glowing ngl.
@scalalearning78502 жыл бұрын
Girl be glowin' up
@livinglikeahuman7918Ай бұрын
Glowie asf
@ichsagnix41272 жыл бұрын
Mental Outlaw: "Yeah, public WiFi is probably overkill, logging on to tor from home is probably okay" Also Mental Outlaw: "as long as your home wifi us public wifi caught via a huge f****ng antenna."
@1xadavid2 жыл бұрын
Mental, you are the only channel I turn on notifications for on KZbin. Your videos are that dope. Thank you, and please keep them coming.
@bluezz5002 Жыл бұрын
To some degree, i think that the sheer complexity and hoops you have to go through in these darknet bibles are a kind of manufactured uncertainty made up by some three letter agency such that for an observer looking in, it all seems so complex that they're never even going to bother.
@tuskiomisham2 жыл бұрын
There are 2 types of drug purchasers. This guy, the schizo dark net enthusiast. Me, the Facebook marketplace enjoyer.
@bilgemadamseyis14142 жыл бұрын
lmao
@sesei21492 жыл бұрын
@@bilgemadamseyis1414 lan türk
@JuliaYamYam2 жыл бұрын
Ew Facebook drugs, just how lazy can you be
@bilgemadamseyis14142 жыл бұрын
@@sesei2149 4çandan buldum kanalı baba
@sesei21492 жыл бұрын
@@bilgemadamseyis1414 abov
@TunaMelt982 жыл бұрын
the tracking device shit made me laugh out loud. that will never happen
@uwu2 жыл бұрын
thank you for everything you do
@AverageAlien2 жыл бұрын
Thanks, as an aspiring drug dealer this tutorial has been very helpful!
@ogamibirdflu51522 жыл бұрын
You voted for Biden I take it?
@creature24792 жыл бұрын
@@ogamibirdflu5152 >Sees "I am an aspiring drug dealer" >He must be American >He must have voted for [other old bad man] >Americans truely are a fascinating species
@AK-us8jh2 жыл бұрын
@@ogamibirdflu5152 Not the sharpest tool in your special ed class are you?
@nalgene2479 ай бұрын
@@creature2479 American YT users outnumber every other English-speaking YT nationality factor of 4, s assuming he is an American is reasonable. Assuming he is a he is also reasonable. Of Americans, liberals are more likely to make drug dealer jokes than conservatives (anecdotally and not entirely exclusively). An American Biden supporter is perhaps the most statistically likely nationality/party affiliation combination possible in this case.
@adeus666 Жыл бұрын
Remember everyone; aluminum foil will not work to block signals like real tin foil (which is much more costly)
@noodles71572 жыл бұрын
The fact that this showed up in my recommended when I have never used the dark web, nor do I know anything about it worries me.
@umeng20022 жыл бұрын
So I shouldn't file a USPS insurance claim when my drugs get lost in shipping...
@davidstocker2278 Жыл бұрын
A good bit of advice I heard from SIM. No one in jail was too paranoid
@MrGFYne13373572 жыл бұрын
Here's a tip, any orders coming from a Russian city and being shipped to USA, US Customs will open it, search it, label it, and if ok'd, continue its way to the destinations address. No tinfoil here lol. Just facts from life exp.
@bradenculver74572 жыл бұрын
I’m not sure where he says customs won’t open out of country packages, that’s kind of a given
@MrGFYne13373572 жыл бұрын
@@bradenculver7457 Some may not know this. You do, I do, but there are the few out there.
@bradenculver74572 жыл бұрын
@@MrGFYne1337357 your comment just worded as though u were contradicting something in the video, as though he called worrying about customs “tinfoil”, which didn’t happen
@MrGFYne13373572 жыл бұрын
@@bradenculver7457 I'm sorry you read it that way.
@mithrandir4912 жыл бұрын
You can location lock your data where it gets deleted if location turn out to be incorrect during decryption, but these tools aren't available in open market.
@dafoc64182 жыл бұрын
Where are available?
@WarLordN1k2 жыл бұрын
I saw some post on this geo fencing but was more of a Proof of concept and can not remember the source
@WarLordN1k2 жыл бұрын
also in a forensic scope i would thing a high level threat would work on a system that was air gaped from any normal RF communication like gps ect or could spoof it if they thought that was an issue... again this is a High level threat actor.
@mithrandir4912 жыл бұрын
These are custom drives with a gps chip, it bruteforces every co-ordinate within a hundred meter radius and when it fails to unlock it deletes the disk contents. You can't get them easily but you could build a raspberry pi version yourself if you just want to fool around with the tech.
@WarLordN1k2 жыл бұрын
@@mithrandir491 that is cool af but few can implement this kind of solution... love the idea
@TheGoodChap2 жыл бұрын
Idk if you've seen domas's lectures on hardware CPU backdoors and undocumented instructions but I think it's extremely interesting and am not even sure just how much it could affect but its sort of a big deal
@someyounggamer2 жыл бұрын
Glad I was already doing this years ago (Also bridging the pub wifi connection)
@maximus68842 жыл бұрын
Hotkey to delete everything sounds neat. Encryption is mandatory for any OS now though. But veracrypt hidden volumes are from the future.
@atranimecs Жыл бұрын
Overkill and Opsec should be two words that go together.
@balisticheym42882 жыл бұрын
Learn more about info sec/op sec from your vids than my comp sci classes