Alofs: A Steampunk Mousetrap for a Shotgun

[@richieb7692]

Considering all the springs, sliders etc, are all over 100 years old. I'd say its working really well Fantastic design

[@keyboardstalker4784]

They sure don’t make them like they used to.

[@intrepidferret6704]

@@keyboardstalker4784 yeah, "the best designed product, meets you need and doesn't last."

[@kenanderson3954]

Yeah, it feels like a bit of calibration and fresh springs would make this thing run real smooth, it's impressive they've held up as well as they have though.

[@BreakdancePeach]

@@keyboardstalker4784 In 100 years, a future soldier shoots a functional M4 Carbine or M16: "Wow, weapons from 2022 still work! They sure don't make them like they used to!!!" That's because all the bad products from 2022 already disintegrated. It's 'survivorship bias'. It's why you don't see the bad stuff from 100 years ago, because they all already broke down and were scrapped. I can't buy that things were magically better back then. Anyway, not directed at you in particular, but it's weird, the comments that don't think garbage American products and cheap con-artists were JUST as common back then. The issue was seriously so bad, that they invented an insult so popular it still exists today -- "Snake oil salesmen". Aside. I'm so happy Ian finally did a video on the Alofs. I've been wanting to see this for a long time.

[@immortal218]

Springs at 2.54 are not that old

[@infamoushacker4chan883]

Honestly, I *love* this. It screams steampunk, but unlike random exposed gears on a hat, it has practical use. I wish I were a machinist so I could recreate this with modern carbon steels and for today's standard shell length.

[@AmaraTheBarbarian]

I wish you were too, because I'd like to purchase a left and right pair and cobble them onto a dual triggered side by side for the most absurdist BS I can come up with...

[@canobenitez]

"but unlike random exposed gears on a hat" shots fired

[@t4nkychannel921]

@@canobenitez Most likely from an Alofs, no doubt.

[@airplanemaniacgaming7877]

@@t4nkychannel921 you can hear the singe-shot-turned-lever-action shotguns!

[@cookieschocchips5551]

You'd also need to be a gunsmith... As a machinist though, those parts wouldn't be impossible to manufacture. (Unfortunately the law and my lack of a modern lathe prevents me from manufacturing them)

[@Girvo747]

The fact this thing works with 100 year old springs in such a Rube Goldberg manner and actually DOES work is amazing

[@lukewarmwater6412]

not realy. people took pride in their products back then, not at all like now.

[@Zaque-TV]

@@lukewarmwater6412 things made in the USA and not outsourced for cheap labor are very well made. Even down to some zipper pouches I bought. Support US made!

[@nick4506]

@@lukewarmwater6412 spring steels now are way better. and back in the day there was no way to make something cheap because plastic didn't exist and international shipping was incredibly expensive. people didt take pride in there products, they cheaped out exactly as mutch as physically possible at the time. and stuff back then was stupid expensive like 32 bucks in 1927 is 521 today. you could buy a whole repeating shotgun for that money not just a conversion kit for that.

[@chuckhoyle1211]

The best thing about it is that even if it fails in some way, there is no danger to the user. You may eat a spring loaded shell, but I don't see a way to accidentally fire a shell out of battery with this contraption.

[@Aliyah_666]

@@lukewarmwater6412 Bro metallurgy was trash back then, pride....lol funny you said pride and meant cheapest possible solution.

[@Lethyss]

When I saw the shotgun in Hunt: Showdown with this system, I thought it was something weird created for the game. But damn, it's a real life design.

[@DetectiveLance]

Isn't it great!? I started playing Hunt again for the first time in a while and I was like "wait, haven't I seen this before..."

[@thertsfan]

I remember seeing this device attached on a double barrel shotgun instead for demonstration purposes, but I don't remember the video

[@DetectiveLance]

@@thertsfan Shit, now I gotta find that atrocious looking thing.

[@thertsfan]

@@DetectiveLance I'm not sure if I'm missremembering, could be that I mistook that device for a second barrel of a double barrel shotgun, been a long while

[@Sigmasigmaboy150]

EVERY gun on hunt showdown exist in real life, they got these forgotten guns and changed their names for the game

[@Genny207]

The only thing that disappoints me about this video on such a cool mechanism working, is the fact that we didn't get to see any high speed footage of it. Getting to see it work in slow motion I think would be REALLY cool!

[@matthaught4707]

Check out C&Rsenal's videos on it, they have some slow-mo of it operating with snap caps.

[@ThraceVega]

tadaaaa! kzbin.info/www/bejne/nn-snJaXbdBki7M

[@matfhju]

They had so much funn with this system that they probebly forgot about it XD

[@xmanhoe]

You can slow down the video speed 😉😎

[@MrPanzerDragoon]

As much as I love seeing the modern and advances milled weapons out there, THIS TAKES THE CAKE for just the sheer cleverness of the homegrown style, steampunk like, design.

[@MrPanzerDragoon]

@@industrialvectors yeah, it's steam punk like for sure. But it's just one of those unique work arounds. Not all work arounds are pretty, I will have to admit, but when they work...it just shows there were some hard and clever thinking involved. I love it!

[@zealot777]

I would say more diesel punk. But it works for both.

[@wesleykupic627]

Just the sound of that reload; all the springs, levers, movement falling into place perfectly is beautiful

[@acomingextinction]

It's so satisfying. It's the sound of mechanical rhythm.

[@WE_OF_THE_NOV]

A pocket full of shells, and a proper break action(with eject) is pretty damn fast once you get used to it, so I can understand why this didn't catch on. It's still beautifully designed, considering how raw everything is, and being a lover a mechanical movement, it would definitely be a wonderful item to have!

[@creakycracker]

I remember watching my Dad take out 4 phesants in about 5 seconds by keeping 3 shells in the web of his left hand. I practiced this technique as a boy but never got as good as he was.

[@TheMulti313]

I would imagine adding a lock of some sort to keep the feeder away from the chamber, so you could still operate it as a regular break action would've helped. Its like the SMLE'S with the magazine cutoff so you could feed fire it, but still have a mag ready if you needed it. Would've worked wonders for bird shooting.

[@samuelstacey2309]

I think you are spot on, I completely agree! Though I too am a lover of fine mechanical movements lol. So we’ll put, like clockwork!

[@bfchristianbf]

i imagine what a device like that would look like for a double barrel,like two of these one on each side,or maybe just one for the 5 plus 1 ammo capacity

[@mattandrews8528]

Kind of like the Bioshock 2 double barrel capacity upgrade? I loved the look of it in the game.

[@RalphReagan]

Yes! :)

[@JustSumGuy01]

It'd be like if Kel-tec existed in the 1800s

[@calvingreene90]

A longer magazine tube with two transport tubes and one spring pushing both shells out at the same time so that they load the correct barrels.

[@User-dc6sm]

you'd have a steampunk DB-12 or DBS

[@Abatement7]

What is more impressive is the spring tension is still good after 100 years

[@tochka832]

probably is replaced tbh, but who knows

[@Oblithian]

I suspect that may have been the source of malfunctions. Or people doing it improperly like that one instance.

[@mpetersen6]

As long as the springs haven't been compressed and released 100Ks of thousands of times and gotten rusty there's no reason they should have failed.

[@fairulaiman9648]

If it on my table, i rather swap the spring with semi auto revolver prototype in the early videos and add up grips to improve the chamber capacity and stable rate of fire.

[@RTJsims]

I am honestly shocked you guys didn’t slow motion capture the reloading sequence. We need that in our life.

[@SundownMarkTwo]

C&Rsenal has a video on the Alofs and has slow-mo for it.

[@saintrico3456]

And as I watch the reload slow motion sequence for the 20 millionth time; I would need to have a backup tab open so when my wife walks in I can pretend I'm just watching porn.

[@shooterqqqq]

Check the settings in the lower right hand corner and select video speed.

[@haylinpm8973]

@@shooterqqqq I was about to say this

[@RTJsims]

@@shooterqqqq but but but. It’s just not the same (I’m spoiled by the slow mo guys) 😜

[@XWar_LockX]

Theses are the kinds of "weapon modifications" I love to see. Really would like to see things like this in more FPS games

[@nightraven836]

would be awesome to see in a Fallout game.

[@nazaryunis2443]

its in hunt showdown as the romero 77 alamo

[@XWar_LockX]

@@nazaryunis2443 Awesome!

[@theshellderinslowbrostail5422]

There is a weapon like this in Warframe called the Rauta

[@1SilverDollar]

​@@nightraven836would have been a beautiful mod for the single shotty

[@Vaultmon]

I don't care that pump and semi shotguns are available, I want one. Also, imagine if a similar contraption was made for the m79 grenade launcher.

[@nothim7321]

Who needs an m203 or m320?

[@sarath431]

There exists something like that. It is called china lake. Its a pump action style grenade launcher. I too love to see a m79 with alofs system

[@46jerdboy]

I think grenades would be too heavy / potentially dangerous (front to back misfire chance would be very low, but catastrophic).

[@Vaultmon]

@@sarath431 I know. But pump action is not the same as alofs.

[@sarath431]

@@46jerdboy - the weight is indeed an issue. However, the chances of exploding via dropping is less as the grenade require some arming distance like 5 mts. It'll be a rare case the grenade might explode upon dropping. I might be wrong on this.

[@adamshira6368]

Someone needs to remake this with modern materials and manufacturing, for no other reason than just because it would be cool!

[@StreakedSilver]

Get Brownells on it

[@stevenlee798]

I'm sure Mr Novak would be delighted to take on this project 😀

[@stevenlee798]

I'm sure Mr Novak would be delighted to take on this project 😀

[@jacobmccandles1767]

Im also sure you're looking at quite a price in today's world. The Krag-jorgensen for instance would be about $3500 worth of machine work.

[@anilin6353]

The ender 3 goes brr my friend

[@timfoster7979]

I have one mounted to my Grandfather’s Champion 12ga. The barrel has had so many buckshot shells run through it the top end has grooves.

[@nickmaclachlan5178]

Not wanting to be a Safety Sally, but with that much wear on it, I'd probably retire it to a mount on the wall......... you don't want it blowing up in your face.

[@dai2dai246]

@@nickmaclachlan5178 why ? If the chamber is fine, you won't have issues. It isn't a rifle, you can drill a shotgun barrel without it exploding...

[@youtubeSuckssNow]

@@nickmaclachlan5178 as long as the chamber is fine then theres nothing really wrong with it. Theres not really anything that would make a shotgun barrel explode

[@dundun8640]

please post a video i have no idea what you said but it sounds like something i want to see (the grooves (i have no idea what top end means))

[@colejosephalexanderkashay683]

totally do a video of this

[@Farfetchd.]

This video single handedly brought this attachment to Hunt.

[@codyopperman5930]

17:02. You can see the problem that causes the boble to be necessary. The transfer tube is over too far. The adjustment screw is probably worn from use, and needs to be tightened so the tube doesn't go so far. Or replaced, depending on if it will move.

[@lunarpking]

It's REALLY close to being right too, I could see it being fixed easily.

[@Noarisonn]

Also the angle that Ian is breaking open the shotgun is a bit upward for the camera to see if he pointed it down the way most people operate a break action it *might* be a little more reliable.

[@ethinos2719]

One of the screws on the transfer tube turned easily as he was handling it during the show-n-tell portion of the video. I wonder if it was still loose when he was shooting it.

[@daviddomanski4872]

@@Noarisonn I noticed that too! It was always smoother with a more muzzle down barrel position.

[@UH1Phil]

And perhaps the spring is worn too. A little bit more spring pressure might do it good.

[@h.a.9880]

The whole design, the basic idea and the intended market... This is absolutely genius. And to think it runs this well after a hundred years, I would not be surprised if those hiccups were very uncommon when it was brand new. And even if that wasn't the case and it had those hiccups out of the box, it's still nothing more than a tiny inconvenience to an amazing, useful gadget. If you squeezed my arm and forced me to come up with anything that could be improved, I'd suggest to add a lever that disconnects the feeding tube tilting mechanism, so when the main tube runs out of ammo, the feeding tube gets fixed in place so you can manually reload without the feeding tube getting in the way.

[@TheHatori1]

I love how the designer encounters a problem, finds a solution and not only makes it work, but also makes it kinda universal. Which is why I think that it wasn't flawless even back in the day - it seems that the main problem is the fit, not springs or something. Either way, systems like this are what makes me interested in weapons from engineering perspective, even though I have never had an oportunity to shoot one.

[@1978garfield]

I suspect the springs are worn out. Not so much from use but from age.

[@khrisna-k1x]

I think I have the faint image of the feeding mechanism to the magazine(?) but not the problem of the feeding tube get on the way. For my image, just make some sort of one way resistor(?), make it active when the feeding tube in reload state and disabled when in feeding state. For your problem, adding some mechanism that doesn't conflict with the feeding tube's spring is kinda hard. Maybe like add some mechanism to the spring under the the feeding tube where when the feeding tube is empty, the feeding tube slide to the side more when the gun's barrel closed by tweak the already existed spring's mechanism or add some new. That might also can solve the problem of barrel alignment issue if the spring can be adjust.

[@h.a.9880]

@@khrisna-k1x I was imagining a little plunger that gets pushed out when the feeder tube is empty and then arrests the inward tilting. As long as there's a cartridge in the feeder tube, the feeder tube is movable, when the feeder tube is empty (ie: no more ammo in the magazine) the feeder tube gets fixed and you can just use the gun like a normal break-action.

[@IncredibleMD]

That'd be as simple as a little swinging latch on the front side of the plate on the magazine that can flip over the top and hook into a matching detent on the plate on the loading tube, to latch them together.

[@akaLethal]

The Alofs seems to load more reliabily when the shotgun barrel is pointed towards the ground. Most of the hiccups occured when the shotgun barrel was at or near horizontal. It appears that when the barrel is pointed down, the shell is able to slide a bit further into the chamber which helps it to clear the receiver when closing the action. I bet a thorough cleaning and perhaps light oil on the chamber would aid reliability as well. Very cool video, nonetheless. Thanks!

[@silentferret1049]

I would give in part that the spring more than likely being original could be weaker than new so that could cause the bind ups.

[@evanlee93]

This is unbelievably cool. I love old mechanisms like this.

[@jeffprice6421]

When this was new, I don't think people had the expectation of flawless function that we have today. So the little bobble to get the round to feed would have been taken in stride and without much notice... Very cool. Tinkering at it's best.

[@sgas]

I thought it was old and that's why it's not perfect

[@DjDolHaus86]

Yeah there is also the cost factor of upgrading the single shot break action you've already got versus buying a new pump action to consider. It doesn't have to work perfectly straight out of the box, it just has to work well enough for the price and offer enough fine tuning for someone to make it work better

[@beargillium2369]

So you've never heard the phrase "they don't make em like they used to"

[@Gameprojordan]

@@DjDolHaus86 iirc this thing came out around the time pump actions were first introduced. So they were expensive enough where this design was an actual cost effective alternative at retrofitting a commonly owned single barrel break action shotgun into a repeater shotgun

[@MasterN64]

I very much doubt this though. There are many examples of firearms this old and older that are semi auto or pump actions that function basically flawlessly and they would have been the standard at the time. This would have absolutely been looked on unfavorably and its easy to tell that it was considering that the concept never caught on and it faded into obscurity.

[@hootinouts]

As a mechanical designer, I had my doubts about this contraption but after watching you work it out in the field, I am duly impressed.

[@SeventhGod77]

The ability of Americans to make any weapon have more gun per gun is astounding.

[@TimperialBroadcastingAgency]

This is where you can really see that Ian is, deep down, a mechanist that loves mechanisms. He just really wants this to work and is so happy when it does.

[@evilparadigm]

That's me too. I love the French(I think it was French) MG that has the little rod supporting the iron sight that corrects the sighting, as the barrel of the MG heats up the sight post. It's one of the guns Ian reviews. I do a lot of #D printing and am excited to get into gun smiting some day!

[@Zorglub1966]

@@evilparadigm I love this kind of "tricks" too. It's the Saint Étienne (*) Modèle 1907 (*) pronounce "saintaetiaenn" all vowels shorts

[@Darryl1963D]

My 60th birthday today and what a great content to see. This is really great to see as you say, many devices never really worked. This one is fascinating. Well done!

[@Pcm979]

I've always wanted to see two of these mounted to a double-action shotgun as an upgrade in an FPS. In real life it'd be a hilarious disaster, but in the world of say Bioshock it could work perfectly and look cool doing it.

[@Attrixine]

So effectively something to increase the firerate of the doom super shotgun

[@Louber1115]

The reload would take a good 20 minutes 😂😂😂

[@vahidmoosavian6313]

That'd be awesome!!! Unless BF vanguard team gets wind of it😒.

[@notablediscomfort]

have the ammo tube work like a magazine so to reload you twist a thing and slide it off then put another one on. but have a different animation for topping off where you just top it off normally.

[@abysswalker2594]

Metro would work in that 2

[@samuelneese482]

I'm amazed that it actually worked. I'd imagine that when it was brand new it probably functioned quite smoothly if it works this well after all this time. I think part of the problem might be that 2 3/4" shotgun shells are the norm nowadays but they weren't back when this was made. I have dug up a box of shotgun ammo that my grandfather had and it was 2 1'2" which leads me to believe that the shells this was designed for were 1/4" shorter.

[@JCGver]

I wonder if any of the youtube machinists would be down for reproducing a one of, I mean with the patent in hand it shouldn't be impossible.

[@beeboop1726]

Yeah I have a sbs made in 1921 and it has 2 1/2 inch chambers, 2 and 3/4 inch chambers weren’t that common until after 1930s

[@absalomdraconis]

@@JCGver : Honestly, this mechanism is so simple & straightforward that a lot of them wouldn't even need schematics. Working out the correct _springs_ would likely be the hardest part.

[@Nerdnumberone]

It's made for an arbitrary shotgun and shell. You need to calibrate a lot when affixing the mechanism and probably be consistent with whatever ammo you use. I think that careful calibration and luck in picking the right shotgun and ammo would be significant.

[@1978garfield]

@@JCGver If they remake it they need to increase the capacity by lengthening the tube. Might as well make it barrel length. After they get that working they start on making it work the hammer automatically :)

[@ObsoleteVodka]

Would be cool if someone makes an entire gun around this concept. Impractical for sure, but undeniably cool.

[@This_is_my_real_name]

I'm surprised there was never a field artillery piece that used this concept. Maybe they didn't want to pay his patent license fee?

[@noahboat580]

@@This_is_my_real_name seems too complicated to make an alofs-styled magazine tube for an artillery piece, especially when manpower is its own action for any artillery piece.

[@bstrd5573]

This is the whole definition of steampunk:"very impractical, but very cool looking"

[@Schregger]

@@bstrd5573 Was about to say, "impractical, but cool" is the whole point of steampunk. Now, you make something like this for a double barrel side-by-side, that would be a interesting videogame gun.

[@maxpulido4268]

Going bankrupt is never as cool as it seems

[@notanuberweeb]

this is actually one of the coolest designs ive ever seen

[@U6kCtBuN]

im almost certain the issues with loading in and out of the intermediate tube are an issue because of modern oversized shells causing increased spring tension and i would love to see this thing ran with ones closer to what was intended, just in case it could operate flawlessly a century old

[@thamojster]

I was thinking it might be because hes not tilting the barrel downward so gravity can take it further than the spring can travel, it seemed like every smooth load he had he had that barrel angled further down, and every jam it was near level

[@xferth]

Maybe just boring the tubes and new springs would let it load easier its hard to say without it all disassembled but man would it be cool to see a modern one running. but i think you right the shells are just a tad bit bigger. but the fact it does work close to 100 years later shows craftsmanship

[@gavinperch9413]

I dunno a lot about guns but I was thinking that maybe brass shells might work better but that thought is based on my (possibly misinformed) recollection that old shotguns used brass or paper shells.

[@conmcgrath7174]

Holy shite! I was just about to make a similar comment but read yours and got spared some embarrassment/ repetition? Shells in that time were most likely made with waxed cardboard, the more yielding edges (waxed) might have seen this thing run flawlessly. Cheers and Pax,

[@groundscorecuisine9959]

Im possibly more impressed with this than any other gun on this channel, and I've spent countless hours watching. Thanks for finally getting this footage out here bro. I love the complex engineering with no thought given to practicality. "we'll make it work, damn it!" I can just hear the guys designing this awesome thing

[@jeffpayne4697]

I think between modern design and manufacturing techniques you could do a modern version of it that would be pretty dope

[@absalomdraconis]

And you know what? For bird or skeet shooting, this is every bit as practical as a single shot so long as you have the right length of shell.

[@TheOrangeRoad]

This is cool af, but I still gotta give it to that 40 or so shot chain pistol, where the chain goes through the handle

[@groundscorecuisine9959]

@@absalomdraconis not really cuz you need to cock back the hammer too. Maybe some kind of crazy linkage?

[@Nerdnumberone]

I'm personally impressed by the various attemps at repeating blackpowder weapons.

[@katori.mp4647]

This looks like a badass videogame upgrade, never thought I'd see someone so cool irl

[@danbell3827]

It really does, like something from metro, to turn a single shot into a magazine fed gun, made out of scrap tube and springs.

[@lxDastanxl]

a lot of players from hunt showdown are asking for it so since the game it's actually going well they may try to put it in this shotgun it's call Romero in the game

[@Sn0ws519]

@@lxDastanxl I was just going to comment this. I immediately thought of Hunt when I saw this, it would fit in perfectly.

[@weaponizedautism3269]

I wish we had this in hunt showdown

[@walkingburgers95]

@@lxDastanxl I saw this shotgun attachment about a year ago and my very first thought was "we need this in Hunt". It'd be really cool

[@graham1034]

Given that it still functions reasonable well after 100 years, I bet it worked almost flawlessly when new.

[@grimmjowjaegerjaquez3750]

And modern springs are way better. The design is solid and can use longer tubes for more ammo if you can handle the weight

[@catcatcatcatcatcatcatcatcatca]

This thing is genius. I imagine it started as “what if a cylinder holding a new shell could push the it into barrel automatically?”. And then each and every problem that arises was addressed one by one. Where does this cylinder come from? It pivots in when the lock is opened. How does the old shell get ejected? The ejected shell triggers the mechanism, so the cylinder only pivots in after successful ejection. How does the cylinder hold the shell in while not in action? There is a blockage on the side of the gun… Wait let’s put more shells held under spring tension there! Those shells get held on the side by an extra blocker when the mechanism operates. I think it looks steam punk because every piece is visible and has a simple function. It’s not that the mechanism is overly complex, but that it has many simple steps that none were hidden or integrated to one part. You can pretty much draw a circle between each and every part of the action, and end up with the whole shape of the visible area.

[@peglor]

This design could be tweaked do the same for a double barrelled shotgun too, especially an over under layout by putting two on one gun.

[@ComotoseOnAnime]

@@peglor That would be kinda insane with an over under, effectively an 8+2 break action shotgun, on par with some modern magazine fed shotguns. And there's really no reason the feed tubes couldn't be extended with lighter modern materials to potentially double capacity, or use a more effective spring to allow for shortie shells to be used, potentially adding a couple more shells in as well. Just imagine loading an entire box of ammo into one of these things lmao. OOoo, you could also potentially make detachable tube mags, something similar to an SRM 1212, with a little spring loaded catch to prevent shell expulsion that would be interfaced with a nub on the receiver, which would cycle two shells into the moustrap elevator thing to be cycled into the gun. I can think of a half dozen ways to improve this design to make it higher capacity and more reliable.

[@BleedingUranium]

@@peglor I would love to see a pair on a side-by-side, it would be so wide hahaha

[@njones420]

I'd like to see a scaled-up one on an M79.

[@clonemarine1]

@@njones420 How different would that really be from a China Lake? lol

[@casey1441]

This mechanism seems more complicated to design than the whole gun, and I love it.

[@absalomdraconis]

It's like half a step past the complexity of those twin hammer revolver.

[@frbe0101]

Its the really weird reloading mechanism that I love about this channal more then anything else.

[@Motleydoll123]

I am suprised they didn’t have some varient showing up in either a western game, steampunk game, or a post apocalyptic game. Like it could fit so well as a shotgun mod for a single barrel shotgun, or if you get wilder, a double barrel with 2 on each side.

[@frbe0101]

@@Motleydoll123 I can see doomguy with a double barrel version now!

[@JazzKazoo0930]

For anyone wondering what the price in 1924 equates to now, $6 then is a bit under $100 and $20 then is about $325 now. So to buy a single shot break action and this add on would run you about $350 to $425 today as opposed to the $575 that the price of a factory repeating shotgun is equivalent to today

[@cycoholic]

So essentially still worth the bang for your buck. 😂👍

[@travisdoe4663]

I would imagine a lot of people at the time already had a single shot shotgun.

[@FirstGameFreak1000]

@@travisdoe4663 this is the real answer, repeating shotguns were a fairly recent invention. You could either spend $600 on a new one when the single shotgun you own does basically the same thing, just slower, or you could spend $100 to upgrade your single shotgun to something that even closer to the same thing as a repeating shotgun.

[@OntarioBearHunter]

the new versions of these are 399 Canadian

[@garyslayton8340]

​@@FirstGameFreak1000not really drones have existed since ww1 Its just a casw of convenince

[@Ciel1820]

I'd love to develop a 3d print for one of these to modernize 'em a bit. It would take a bit of fiddling with the spring strength to get perfected. It's such a cool design yet it's a shame we don't have any modern continuations of this patent.

[@gruntysskim4145]

absolutely do it my man, that's what 3d printing is for.

[@TylerLL2112]

I have seen many comments like this. Yet, nobody has done it. There must be some gotcha that we don't see until we work on it. I too intend on messing with this idea. Though, in .410 as that's the only break action I have.

[@paddy2019]

You can get new ones in Canada. As far as I know, they work pretty well.

[@ShitfazeMigee-cu1vt]

Don't fiddle with the design 😂 it's 100 years old and it most likely functioned perfectly out of the box. I'm sure you could improve it but don't fix an issue that doesn't exist

[@ALWhite-ub1ye]

​@@paddy2019are they sold under the same name? Did they ever produce one in .410?

[@Senator_Byrd]

9:22 Imagine the creator and his boys having this same excited “heh heh!” over 100 years ago

[@doomer_to_boomer2402]

The ingenuity of the designers of this era never ceases to amaze me

[@ASlickNamedPimpback]

Einsteins in the 18th century Well, besides actual Einstein but yknow

[@burieddagger8064]

@@ASlickNamedPimpback Einstein wasn't born in the 18th century, he was born in 1879, which is the 19th Century. This conversion is from the 1920s, so the 20th century. It's actually from 1923, the same year Einstein gave his Nobel Lecture "Fundamental ideas and problems of the theory of relativity"

[@H4FF]

I always find this intriguing. Does their ingenuity surprise us because it was a 100 years ago, and we don't see people as quite as advanced back then? They weren't less intelligent or resourceful, they simply did not advance quite as far technologically. I do get what you're saying, but when I catch myself thinking like that I sometimes wonder if there is some weird kind of "bias" going on. Similar to how it surprises us when ancient civilizations made very complex and sophisticated buildings and artwork, for example.

[@yourlocalweebfriend3537]

Its merely a matter of ‘We do with what we have’ kind of mindset

[@tomwoodrow5494]

@@H4FF Man kind has had great knowledge for many centuries, engineering principles have not changed that much either. Devices like these are amazing not because of what they do, but rather how they were made. Modern tech could make this device easily, how it was made 100 years ago, mainly by hand, that is the amazing part. This device is no more complicated that most timing machines out there now, the challenge is timing needs precision. I might try to make one, does not look that hard.

[@StopMoshin]

I'm surprised I haven't seen these in Hunt: Showdown, considering that they have something as niche and weird as the auto Mosin, which is a Huot conversion on a Mosin Nagant which wouldn't work for obvious reasons.

[@ZezacleB]

I AM HERE SPECIFICALLY THINKING ABOUT HUNT Was loading up the game to see if the Romero had a Manual Hammer or not while scrolling through the comments. Absolutely love that someone else was thinking the same thing LOL

[@MatigrisSH]

That on a Romero would be OP.

[@andrewlavoie6034]

You can make auto mosin conversions, the one ingame has only a few problems, but I mean Fedorov was doing it

[@Skulgar321]

@@andrewlavoie6034 Avtomat is a general term for automatic weapons (AK, AN) the Fedorov is a ground up weapon. The mosin would require a bolt turning mechanism, the Fedorov is a recoil operated rifle.

[@kaniodon]

I saw someone present this gun in the suggestion channel on the Discord a couple of months ago and it was swiftly downvoted to hell unfortunately

[@martgryfny]

I think that if you adjust that bolt at 2:56 (you have a fingertip underneath it) the loader will work without hesitation. It aligns the loader tilt with the barrel. On the video it looks like the tilting action goes too far. And then you might want to adjust the height on the mounting system. And that repeat these two steps in aligning 425421 times and you good to go :D

[@jubuttib]

The fact that it's such a weird design, managed to be a cheaper combination than an actual repeating gun, worked back then, and STILL mostly works today with nearly 100 year old springs... I'm honestly flabbergasted. I don't even have a shotgun, yet I want one of these. Someone will surely come up with a 3D printable design (with store bought springs and metal pipes) for this at some point. EDIT: And it wouldn't even be that much more difficult to design some quality of life improvements into this, like a cut-off for the loading mechanism when empty, so that it doesn't get in the way of loading manually after you run out, cartridge stops, etc...

[@pouncepounce7417]

no need to 3d print, all parts are either tubing, plates or springs or bars, minimal workshop equipment should be enough

[@sirapple2406]

Loading cut off could be done by having the follower stick out slightly into the “loader” thereby basically jamming the system, all you’d need then would be a slot and hole in the follower and magazine tube to pull back the follower. Or just have a slot going all the way down the magazine tube attached to the follower allowing you full control over it.

[@TylerMcL3more]

Lol- that’s the first thing I thought too! My friend is actually about to start modeling this as they’ve been wondering exactly how it works for years… and Ian’s explanation explained the last bits so… design time!

[@TylerMcL3more]

@@W1ldt1m the reason is that it’s cool- why must you hate that what which is nifty?

[@alexisrivera200xable]

Flaring up the tubes a millimeter at the ends would clear the feeding issues and would speed up the loading process while at it. its a clear simple design so its not difficult to improve on it to up the reliability.

[@NO_LOVE_LOST]

I get the steampunk associations, but I think this also fits really well into the fallout universe (or any post-apocalyptic setting). I can totally picture some survivors building this out of scavenged parts and various break-action shotguns (imagine a double barrel one with this system! ;D) to get the upper hand against raiders because more advanced weapons are rare and hard to maintain

[@caliber5302]

It just works

[@ledocteur7701]

yeah, it would be awesome in a fallout game, especially since there already is a fairly advanced weapon upgrade system that allows aesthetic modifications. someone should totally make a mod for it.

[@ObeyCamp]

I would love if they put this in Fallout 5. We wouldn't get to see it until probably 2029, but still.

[@dist0rted320]

Double barrelled with two mechanisms? DOOM guy approved.

[@mcrwoell]

It was recently added into hunt showdown, as an upgrade to one of the early game guns, the romero (a standard break action shotgun.

[@raygumm]

Love Ian's dedication to the shot hiding his terror over the guy seemingly breaking his Alofs loader! Great video as usual!

[@matthaught4707]

I'm amazed he lets me shoot any of his guns anymore.

[@raygumm]

@@matthaught4707 you handled it exceptionally well. I would have been mortified. Would love to see outtakes of this episode!

[@ImusNoxa]

Watching your channel has given me a new appreciation for gun mechanics in general, but something about this... contraption is just so freaking cool. It's amazing.

[@custardavenger]

I'm sure when new, and with some fine tuning, that would cycle pretty well. There are lots of options to tune the device to match the gun its mounted on.

[@mpetersen6]

And places for it to get out of alignment. In a way it reminds me of the table saw I've got for just general use. It's got a sliding table that movable on the fence rails which are moveable all on a sheet metal box with an cast aluminum table. Cuts nice when set-up properly. But it is a real PITA to get set-up.

[@crestfallensunbro6001]

I've got to say, this does put a smile on my face, hats off to the original designer. For how wonderfully brilliant the whole action is, how well it works and how extremely nicely it has help up over time.

[@ralphmills7322]

That is a pretty cool device, they were pretty inventive back in the 20's and 30's. I'm left-handed too and the first centerfire gun I owned at age 16 was a shotgun, an old Bay Colony Single shot Break open in 16 gauge Used mostly for upland (rabbit/grouse) Although I did do some unsuccessful deer hunting (none seen). I lost a butt stock mounted elastic 5 round loop holder, dropped somewhere in the woods after I removed and pocketed it for the trip home.

[@reecethurman4714]

This is such a fun design, and the movement of the action is incredible!

[@forrestdevine2336]

I love when Ian is very clearly excited to show us something wild.

[@charles_wipman]

It's a really pimp device, i can't belive that after almost 100 years works so well; happy new year to you and your family too.

[@maxanderson8872]

This is exactly the kind of ahead of its time design that would work in a game like hunt showdown, especially since they already have a single shot break action gun

[@Crow_Mauler_]

Very happy too see yet another hunt showdown player in the comments. I main the terminus, how about you?

[@OverlordHD36]

Oh no .. not a semi romero ... not like this ... :D I'd love it

[@DoctorFrostbite1]

Congratulations, you just called it. Its in the upcoming update, basically a new variant of Romero 77 called Alamo

[@blurpleshark]

CONGRATS 6 MONTHS LATER AND ITS HERE IN GAME

[@brentward3893]

This really reminds me of the weapon upgrades in Half Life Alyx - alien tech thrown onto old weapons to improve performance, such as robotic arms to auto reload pistols. It's so cool that something like this really exists, and it's a hundred years old!!! Fantastic design.

[@dioarya6275]

Or maybe like how it works during that scene in "Equilibrium" where Preston just reload his two guns with an autoloader device under his sleeve

[@StrangerOman]

Love the click-clack and tube sounds while running the action. Clever, crude and yet awesome design.

[@FL0D0S]

There's only one thing I want more than high-speed footage of this, and that's for someone to mirror the design and bolt one to either side of a side-by-side double barrel!

[@MrSheckstr]

Couple of problems with that concept…. Try shooting THIS thing left handed…. Now imagine trying to shoot it with devices hanging on both sides and not have then smash against each other when reloading

[@MegaGaming11]

I AM SO DOING THIS WITH A BREAK ACTION NERF GUN!

[@sqeeye3102]

I've wanted to see one of these actually run for a very long time, thank you for showing it off for us. Also, my heart skipped a beat at 16:24 when it looked like 100 years of mouse trapping was finally over.

[@alifr4088]

"Oh you broke my alofs!"

[@8bitarmory846]

I had no idea what to expect when I saw this comment

[@matthaught4707]

Imagine how MY heart felt!

[@vect0rwolf]

Devs for The Hunt: Showdown are in the back scribbling notes.

[@_gungrave_6802]

Out of all the guns I've seen over the years this device is still one of the most fascinating things to me when it comes to firearms. It serves such a simple purpose even if its a bit finnicky in operation but so much ingenuity had to go into its creation.

[@psp2862]

Tt

[@eliandominguez3575]

Crytek is literally taking note for putting this in hunt showdown

[@RmacNet]

Wait - for real? My first thought when I saw this was it needs to be in Hunt

[@xClars]

as i said before this thing belong to hunt showdown, romero variant would be fun entering compounds blasting like a k&k but with a damn romero

[@johnbraadland9556]

I always wondered if there was a left handed version of this, so you could mount one on each side of a double barrel shotgun.

[@prjndigo]

Yes, but it wasn't production. You can actually mount one of these on a break double to keep firing the left barrel.

[@This_is_my_real_name]

If you mount one on both sides of a shotgun it would work, except for your being unable to _fire_ the thing! (Recall the _reason_ he could not shoot it left-handed -- this would make it impossible to shoot left OR right-handed!)

[@Bozar91]

I wonder if you could bubba some onto a Chiappa Triple Threat.

[@Ezekiel_Allium]

@@Bozar91 .... imagine a custom device for a liberator quad barrel

[@russetwolf13]

That's just the shotgun from Devil May Cry.

[@mitchmalinowski7103]

They just added this to Hunt: Showdown so i had to come back and drop a shoutout to Ian for being the reason more than 3 people in the 21st century have ever heard of this…thing.

[@donaldasayers]

It needs an adjustable stop in the transfer tube to adjust for exact case length. What a wonderful device, that it works at all is just incredible. Thank you for the vid.

[@limprooster3253]

That and an adjustable stop for the transfer tube itself. Looked to me like the transfer tube was sitting below the chamber and the new round was getting stuck on the bottom of the barrel

[@UNCLETOEKNEE]

When I shot one of these over 30years ago I was misled by the owner who said it was made for him by his father. What we DID find however was that it was more reliable when we dropped the barrel to reload rather than dropping the stock - ie the stock remained horizontal throughout May have just been the way that one was setup and it was on a hammerless single barrel gun so was altogether smoother in operation. ( in the UK )

[@wintermute1]

So keep the stock on your shoulder? Interesting

[@Murgoh]

Maybe it was installed by his father when he was a child and he thought his father "made" it?

[@Wolfhnd]

I think this is my favorite "weird weapon system" and it will be so cool to see a more reliable and lighter modern version ! Hope someone will do that someday ! Thanks for the video !

[@theaddictive6676]

god just the idea of someone seeing a break action shotgun and saying "fuck it I'm turning this thing into a makeshift pump action" and succeeding baffles me to no end

[@feynthefallen]

This is easily the coolest gun you ever reviewed, and thanks for taking it out to the range for us, that was the cherry on top really. I love your approach to these videos, keep em coming please, and happy new year (unless you have some old blunderbuss that shoots fireworks to show us yet)

[@JimTheZombieHunter]

I love how this channel focuses on historic and obscure .. and sometimes unique and bizarre - firearms engineering rather than how many pumpkins can be blown up. You bring a certain awesome class and honest respectability to shooting.

[@gsilva220]

It's like Jay Leno's historic car show

[@MikeDCWeld]

The issue you had when maxing out the Alofs was the rim of the rear most round in the main tube was catching the crimp on the round in the transfer tube on the left side as you released it into its resting position. This is clearly visible at 8:47. A flat, thin object of the correct width could prevent that issue. Simply insert it in between the tubes until the transfer tube is in place and remove.

[@whoohaaXL]

Is this the reason that they are putting a previously fired shell in before running the gun? Because I don't see any reason why they couldn't breach load and then load the tube mag?

[@MikeDCWeld]

@@whoohaaXL no. They are doing that so they don't have to manually trip the transfer tube. The system is designed to use the ejection of the empty shell to release the stop holding the transfer tube inline with the main tube so its spring can push it over in front of the chamber.

[@whoohaaXL]

@@MikeDCWeld Ahhh. So basically they're just doing this to save a few extra shells during the firing demo then. As they did State you could breach load one if you'd like to. So total capacity could be 4 + 1 basically. Because the ejection of the first shell knocks the tube into its place, I hazard a guess they just chose not to waste an extra few shells to show the demo more in depth?

[@wcookiv]

The reason you have to double bump it to close it it because you haven't properly set the set screw on the stop arm. Properly tuned, the action is much smoother.

[@Fedorchik1536]

This is so cool! It totally needs a modern replica just for the coolness factor.

[@calm_skies]

basically, it made the entire grip and stock part into the lever of a lever action? THAT'S GENIUS!

[@_ArsNova]

This would be a fantastically cool device to fit on my old single-barrel 16-guage shotgun. Shame this Rube Goldberg of a device is long out of production.

[@misanthropichumanist4782]

Wonder if a modern version could be 3D printed?

[@Bramble20322]

@@misanthropichumanist4782 probably, 3d printed stuff is very fragile though.

[@onpsxmember]

@@Bramble20322 That highly depends on the base material mix.

[@TheVexCortex]

@@Bramble20322 3D printed parts are about 60% as strong as injection molded parts of the same material, so not as fragile as you think. The springs would need to be metal, and the pins would need to be metal, but I think everything else would be fine 3D printed.

[@1101agaoj]

@@Bramble20322 proof-of-concept 3D printed AR receivers are a thing now

[@lordmado3918]

Ah yes the Romero Alamo.

[@FrancescoGiorginiFilms]

I was looking for this comment

[@Dr._Nope]

This gun needs to be put into video games, it's so ridiculously cool! This thing looks like it should be hunting vampires and werewolves in Victorian England or something! 😂❤

[@animanera89]

If they ever make another Dishonored game with less stealth and more "boom" I NEED something inspired by this to be in it!

[@theduckaholicgamer7976]

Could even work as a Star Wars blaster or red dead redemption shotgun.

[@axtondragunov1784]

Edwardian England because queen Victoria died in 1909

[@Murzac]

@@axtondragunov1784 Eeeh you can bend those rules a bit for this. Especially if you're making something with a steampunky vibe in the first place. Like if you put this thing in a victorian era steampunk game, nobody would bat an eye.

[@-John-Doe-]

A little anachronistic but I don’t think it’s implausible for it to have been developed earlier. Of course virtually everything steampunk / fantasy is implausible anyway.

[@_starlegion]

I can’t believe it…. I’d never thought I’d see the day where this would get a review. Looks like Wednesday is the day of prayer for our love for Gun Jesus.

[@thatmckenzie]

m.kzbin.info/www/bejne/nn-snJaXbdBki7M

[@onesadtech]

This is an absolutely incredible little piece of engineering for its time! Thanks for showcasing this! I can imagine that if you trained with this, and used it often enough, you could get it working pretty smoothly.

[@alwayscensored6871]

Tweak those adjustments a little.

[@ayebraine]

I think it's mostly very old. If one made a new one with the same dimensions and not all bent and wobbling off axis, it should probably work every time, with modern shells being mass-produced on machines and very consistent.

[@outsider8209]

Think this might be my favorite random gun thing I've seen, I love the idea and how efficient it is for someone's old diy project essentially

[@imbe.]

OH MY GOD! This is literally my favorite shotgun gadget thingie!! Most satifying cool magazine that actually works!! Thank you Ian! Cheers from Finland!

[@mrjockt]

I’m pretty sure Othias did a video showing how this contraption worked a couple of years ago, it was a pretty short video just to show that it did actually work.

[@nymfan1990]

He did. I knew it looked familiar.

[@cvmaniac7286]

Yea, it was one of their breakdown videos if i remember right.

[@LadyAnuB]

He did and here's the 2 videos on it: kzbin.info/www/bejne/nn-snJaXbdBki7M kzbin.info/www/bejne/qpO7gHmhorCsn7s

[@vicarus2728]

I bet this is the same gun

[@mrjockt]

Got to admit, it’s unusual to see what we in the U.K. would class as a “Heath Robinson” (or a “Rube Goldberg” if your American) device for a firearm that actually works as advertised.

[@PhycoKrusk]

Honestly, if you were in an environment where there weren't a lot of repeating shotguns, this would make you king of the hill. You've got at least 4 shots where you'll be faster than the next guy (unless they've got a double), and after that there's nothing to stop you from single loading until you get a couple minutes to top up. Pair it with a cartridge belt or a bandolier, and you've got a high speed, low drag shotgun in 1905. Could you win a 2-gun match against a proper repeater? It wouldn't be impossible, but most likely not. But that isn't really what it's for. In the intended role of giving you repeating firepower for hunting, it probably works great (unless you drop it in the mud), and like Ian said, a $10 topper and $15 Alofs device is substantially less expensive than a $35 pump, and if you inherited the topper, the savings are even higher.

[@PhycoKrusk]

@@phant0m233 these devices are no longer being manufactured, and are quite rare these days. As it stands, a pump shotgun is going to be far less expensive than a brake shotgun with one of these. It would also be more reliable, and potentially have even greater capacity. There's certainly interesting from a historical perspective, but if I was setting up a home defense shotgun today, this would not even be on my list as a backup option

[@ILLEagle_1]

@@PhycoKrusk well I think he was talking about back in the day home defense, not modern day

[@PhycoKrusk]

@@ILLEagle_1 back in the day, I think most people would be concerned about the device getting in their way while hunting. Yes, you can remove it if you don't need to use it, since it's just held on by the axis screw, but that would get old after a while. Still, this would be a significant force multiplier, and certainly I can recognize it for that

[@BaritoneMonkey]

@@phant0m233 Economy of scale makes pump cheaper than break-open today I believe. Mossberg Maverick 88 can be had for under $200, can you really get a break-open for less than that? No reason to opt for something like this today.

[@n3m3sis03]

Hunt Showdown gun research brought me here. I find myself suddenly in love with these 18th-19th century weapons.

[@gunthersunshine9418]

many people from the hunt community requested the alof and crytek really did it :D

[@bigtuna4731]

This was patented in 1924, so it's a 20th century weapon, not 18th-19th. They keep saying it's 100 years old, so not sure why you would think it's older.

[@XFourty7]

"That's so cool" -Camera man, damn right! When Othias did a teaser vid on this it was so interesting. Amazing to see it actually running! Can't wait for their full length vid as well. That IS so cool. ;) Happy new year to you as well Ian!

[@coco26006]

I just love watching this device operate, its so satisfyingly interesting that it just seems cool even if it isn't necessarily the ideal shotgun loader

[@seifertak]

Okay, I need this immediately in Hunt: Showdown! One of the coolest mechanism I've ever seen. EDIT: Well, it's in the game now but it turns out it's painfully slow and dogshit compare to Spectre. Shame.

[@mattsmustang65]

I was just thinking this looks like something that would be in that game 🤣

[@nathanhammond3860]

It sounds like it would be a bit out of the time frame of the game but it would fit perfectly.

[@seifertak]

@@nathanhammond3860 You maybe right but look at Avtomat. That is completely random meme weapon, also the Bomb lance. This is kinda steampunkish in the same way imo.

[@nathanhammond3860]

@@seifertak yeah I see where you are coming from. The only other issue is balancing it.

[@weaponizedautism3269]

@@nathanhammond3860 There are zombies in this game I don't think slightly inaccurate weapons would be issue

[@fryfrom98]

This is the coolest gun attachment ive seen by FAR. absolutely beautiful action

[@lanedexter6303]

Fascinating! From the time period when MANY inventors were trying MANY things! You’re right, this Rube Goldbergian device has a steampunk vibe. It would be great fun to see it in a steampunk action movie.

[@Tysto]

Fascinating and clever design. Brand new, I bet is had very acceptable reliability for hunters. And the reload time is immaterial for hunters as well. You get four or five shots at some ducks, then reload while waiting for more ducks.

[@raikbarczynski6582]

its just amazing how well this thing runs ( yeah those little hick ups after transfer are not an issue) given how bloody old it is. would like to see a modern reproduction running this well :)

[@GunnerAsch1]

Its simple enough to make a repro out of. All one needs is a set of dimensions and a home work shop.

[@ItzVeggie]

Had to come back after seeing they added the new alamo in Hunt

[@MarshalSmith1]

When Matt said it's like loading a model 12 I screamed "EXACTLY!" I hated loading that thing it'd always bite your thumb and in the cold out hunting, man does it sting. Also the RATM reference was hilarious. Great video guys!!

[@matthaught4707]

Every time I shoot a model 12 it makes me appreciate my 870s all the more.

[@CMDBob]

This is hilarious, and yet somehow practical. Can't help but think some form of magazine cut-off or lock would be handy for when it's out of shells, so you can single load it a bit easier.

[@georgewhitworth9742]

@@justforever96 Chillax man, he didn't say for close combat. Just expressed curiousity.

[@astridvallati4762]

Dear Ian, I have a lot of fair to good H&R singleshots ( also Steven and Iver Johnson) In Australia, Pumps are highly restricted, but mechanical ( lever, straight pull) are not. So this design being totally manual operation ( not "Pump") would be quite legal ( and close to 100 years old!!) Your videos give me a good idea to reverse engineer this accessory to convert the numerous single bbl..break actions, which otherwise would be " chopped" as un-saleable. ( I am a dealer and manufacturer) DocAV

[@jamesfisher9594]

I live in the US but have wanted one since seeing it on C&Rsenal. If you reproduced or just loosely base something off of the original I will buy one from you!

[@abcdefghijkl123454]

@@jamesfisher9594 i believe you could just straight up copy it since the patent expired quite a while ago

[@Matt_The_Hugenot]

Even more restricted here in the UK. Even attaching one of these to a shotgun would land me in a whole heap of trouble.

[@ecarlate]

@@Matt_The_Hugenot i feel you, was wondering if that will be legal in france with all the restriction we have too lol

[@SnoopReddogg]

Won't someone think of the Australian children????.

[@TheHorzabora]

That’s a really pretty loading mechanism. I don’t think it would be that hard to iron out some of the bobbles when loading, either. I really thought that was going to jam hard and fast, instead it has an immensely satisfying sounding and looking loading action. For extra credits, a detachable/easier to reload ammo tube would make the ultimate steampunk shotgun… … until the double barrel break action version is made.

[@larryfontenot9018]

Since the system stays over to the side until it's operated, I'd say that's a five shot repeating mechanism, not four. You'd have four reloads in the mechanism, and carry the shotgun either unloaded or open. Then you load a live round into the chamber when you want to fire the first round and the mechanism takes over for the next four shots. You could carry it loaded with a live round in the chamber and four in the mechanism if you want to live dangerously, I suppose. But either way, it's perfectly safe after you fire a shot because it doesn't automatically cycle a new round into the chamber like a modern repeating shotgun does. The next live round isn't loaded until you break open the shotgun. Clunky? You bet. But I like the features. The only things that keep it from being perfect is the loose tolerances that make you have to fiddle with it a little, the lack of a means of keeping the rounds in the tube until you want them to move, and the lack of automatic cocking. But that last is a problem with the shotgun, not the add-on magazine.

[@Astraeus..]

In regard to $ value of 1925 vs today, it's roughly 16x what it was. So the 6$ attachment is an equivalent of around 96$. A break-action shotgun's 15-20$ would be 240-320$, and the 35+$ pump-action would be 560$+. Pricing seems to be roughly in line with what can be found today, although obviously we also have guns that are considerably above those price points. Very interesting all told.

[@Sk8RJOSH94]

I would love to know where to buy one of those devices

[@AtlasJotun]

Worth the wait for certain! I give the Alofs device the benefit of the doubt; I'd bet it functioned without that bauble 90+ years ago when it was tight and new. Good to see our resident Shotgun Expert back on the range as well. I love this expanded FW/InRange crew from the last couple years!

[@mishmash4760]

Just in time for the algorithm to recommend this video right after the hunt showdown event

[@apathetk]

I feel like this thing could have been improved by the addition of a loading stop. Something that snaps into place when you move the transfer tube outward. Not only would it assist in loading, it could also be used when you empty the magazine and need to switch to single shots, like a magazine cutoff in old rifles. Carry that thing loaded with 5 plus however many in loops/pockets and you've got something decently effective for the time.

[@ericmitchell985]

I would legitimately buy one of these things as a complete system. It is just *that* cool.

[@robbiemer8178]

I would think that when this was new it likely served somebody pretty well for their hunting. It appears to be good in concept but now, after 80 or 90 years, it needs to be fine tuned some to get everything to really line up well. Give this to Mark Novak and I'll bet it will run pretty damn smoothly. Thank you for sharing this with us Ian!

[@isaiahjerue6564]

Duel Alofs on a double barrel would be awesome, impractical, but awesome.