The Plans to Assassinate Hitler

[@fern-tv]

The timing of this video might seem a bit weird. Naturally, it is entirely coincidental; we worked on this for months. Enjoy!

[@大]

daddy

[@JohnCena-rq4bp]

i'm watching this in the bath 👍

[@vermillion-sz7vy]

props to your animation team on your other works, I assume this will be great

[@actuallyalyan]

Its ok, trump is no worse than hi!ler

[@pyeitme508]

Bruh

[@4GENS]

This is the plots that would make you quit watching a show because it's too "unrealistic"

[@kaydens6964]

If you think about it, what happened to Trump is pretty a Mr Bean movie.

[@kayaphus4303]

Lessons for Trump

[@Notell.]

​@@BringOutTheLobster.Don't be so jealous. He planned it out and flew a drone 😂 your daddy isn't protected

[@markeverhart-xu7hh]

@@BringOutTheLobster.that’s what you think .

[@matteframe]

when I saw the guy wearing a racoon hat and bull horns in the Senate chambers, I knew the show had jumped the shark

[@astral6749]

Resistance: * fails to kill HItler * Hitler: Fine, I'll do it myself.

[@Krachbumm-Ente]

Imagine believing post war propaganda

[@creely123]

Argentina actually.

[@edvardb.2751]

He had the last card. The death card.

[@BGwxlf]

​@@creely123no he didnt escape dna tests were done on his bones if im not mistaken

[@BGwxlf]

Underrated commemt

[@Emil-y3z]

Don`t also forget he was saved from drowning by a priest when he was young and a British solder refused to shoot him in ww1. Mann, he was very lucky.

[@SynthiaVan]

The 2024 version is "he was protected by god."

[@MaddAddam93]

This just affirms that life is chaos and good does not intrinsically succeed more than evil

[@martialhero9544]

@@SynthiaVanor by the devil

[@MoAbuAkb]

No by god ​@@martialhero9544

[@TruffoYT]

Dawg that story isn’t true

[@alvin3698]

Every assassination attempt had a chain of time travelers trying to stop each other from killing or saving Hitler

[@mao-tse-tung-games]

True man. Butterfly effect: if hitler died, maybe someone more competent might have assumed his place, and the world wouldnt be the same.

[@ExtantPerson]

@@mao-tse-tung-gamesYep. That’s exactly why the Allies eventually stopped trying to kill him. They realized he was more detrimental to the enemy than beneficial

[@EEEEEEEE]

E‎ ‎

[@derederekat9051]

@@ExtantPerson yup, now they can move uninterrupted destroying Europe thanks to the holocaust blame! Genius move!

[@aaronmurray7308]

That would be a great movie idea

[@SIMULATAN]

held a presentation about the stauffenberg attempt in school, its insane how miniature things like a person moving a briefcase by a few centimeters prevented attacks from succeeding and history changing forever

[@BouXIII]

also not forgetting that stauffenberg was no saint. he planned to stop the nazi regime, but wanted to impolement aristocracy again and stop all democratic ideas

[@dingsda0412]

butterflyeffect

[@EEEEEEEE]

E‎ ‎

[@CantTellYou]

And, not so miniature but, the allies bomb causing their fancy new costume ceremony to be canceled. I wonder, what would’ve it been like if Stauffenberg and crew had succeeded? Would it eventually just became another, slightly less genocidal dictatorship? idk much about the guy lol

[@aezurefx]

@@dingsda0412 was about to say that

[@catcatcatcatcatcatcatcatcatca]

The style of animations is stroke of genius. The little balls tie the keyframes together, as well as look good with low poly details. It really ties the story together, and allows very strong storytelling with the contrasting colors.

[@Machoman50ta]

Only came to comment the wrong ones won ww2 and they are the reason we are going to start ww3 mustache man coming back 😅

[@fbiagentmiyakohoshino8223]

40 assassination attempts, and he just kills him self in the end

[@psychrubus4503]

lol Fidel Castro had major plot armor too

[@bigpapaplantman5126]

I don't believe he killed himself personally. I think he went to Argentina with the rest of his regime. Still to this day, Argentina has villages in the mountains where people speak German, and there have been 1,000's of high ranking nazi medals found in some of the homes. I think the IDF located him and assassinated him some time in the 60's. Just a theory but totally plausible

[@memorimusic420]

Hitler was like: "if yall cant do it imma do it myself" 😭

[@バカ-l9o]

MYAA NEE

[@Kitchystore]

we dont know that

[@armansinghbhati8446]

Two assassination attempt videos in 2 weeks is MAPPA levels of crazy

[@moshymosh]

Weird reference but ok

[@Adnan-qf2rz]

hes being held captive in some1s basement or sum

[@Paradoxical124]

No it isn’t, you’re just young.

[@lennywhere]

@@moshymosh weird because the employees of MAPPA are literal slaves or weird because it's an anime prod. company xdxdxd

[@Hello-There.-General-Kenobi]

Could you or anybody else explain to me to what op was is referring to please? I know MAPPA but what does it have to do with assassination attemps?

[@Zero_Zero_0_0]

You forgot to add 2 crucial parts in which the meeting was supposed to take place in secured underground concrete bunker but was changed at the last minute due to the extreme heat, and not to mention that initially Staufenburg places the briefcase as close to Hitler, but was unintentionally moved further away by Col. Brandt, thus contributing to another factor as to why he survived the explosion.

[@InterlacedStudios1]

Noticed that too because I had to learn all about this stuff last year on school

[@KingK2205]

Did Col Brandt survive?

[@tom12-128]

No you are wrong: „It is often falsely claimed that the meeting should actually have taken place in one of the underground bunkers of the Wolf's Lair.“

[@bronnquist]

Yes agree, pretty big thing to mention that the bomb was moved.

[@Rare_Spore_Fan]

Imagine if col was a time traveller

[@lyndestructible]

The animations just keep getting better with every video! This looks incredible, keep up the good and informative work.

[@hexagonal565]

rs

[@MonkeDiesTwice]

10:55 What has KZbin come to. Having to censor words like "Suicide" so that the video does not get demonetized... What a dystopian nightmare.

[@SDub5050]

Liberals want a soft world

[@josephsandifur]

literally 1984

[@lesbianrichietozier]

it doesnt seem dystopian for advertisers to not want to support channels with references to suicide. just not the best thing to be associated with

[@MonkeDiesTwice]

@lesbianrichietozier it's history. It's not "being associated with suicide".

[@lesbianrichietozier]

@ dawg hoyoverse and squarespace are not going to advertise on a video openly mentioning suicide lets use our thinking skills please 😭

[@augustus4832]

"Hitler commited ' ' in his bunker" God, I hate KZbin's censorship of certain words for historical videos.

[@Willy_Tepes]

It is political censorship, but often it affects historical videos.

[@SizzleCorndog]

@@Willy_Tepesit’s not even political, they’re just trying to avoid language that would put at risk people on edge

[@Willy_Tepes]

@@SizzleCorndog No, it is definitely political. I have been probing and tracking this since 2007. There is a logical reason why you can't see this. You hold no opinions that go against the media narrative. If people knew what was really going on, I am sure some would be very angry..

[@SizzleCorndog]

@@Willy_Tepes Thats total bs, in 2007 youtube barely existed and was more interested in showcasing what videos were being actively watched. This was the peak of CoD where people were calling each other slurs or telling them to kill themselves for no reason. Nobody gave a shit back then. The reason they're actually doing this is because there are people who exist that are fighting with whether they should be alive or not and mentioning topics like suicide or self harm might be enough to either send them over the edge or relive some past experiences. This isn't anything new either, people don't like talking about it to the point where back in the day people would say someone "died of grief" or "died of melancholia" instead of just saying they took their own life. The reason you're here moaning and groaning about this is probably because you saw Hitler in the title and thought "finally, more content for me and my Ai Hitler pfp" and then were surprised when they approached the topic with a crumb of sensitivity. But no, its all a narrative created to stop you specifically and keep the rest of us sheeple in line rather than, you know, be respectful of other peoples feelings and experiences.

[@cuboidmelon]

​@@Willy_Tepes no its not, it's most likely simply the fact that companies don't want to be associated with negative/controversial topics. If youtube didn't censor stuff they wouldn't get money from running ads. Most corporate decisions are made for monetary reasons and not political.

[@ScarySkele]

Just a reminder to people: This video took months to make as do all of them, the previous one not to be mentioned was simplistic in comparison to this so obviously it was pumped out quicker. Don’t judge him on the basis of coincidence, judge him on the basis of journalism, effort, research, and knowledge sharing. fern-tv has my upmost respect.

[@tmsupreme7763]

They released a video about Trump's assasination before this one, I mean I don't mind but still..

[@ScarySkele]

@@tmsupreme7763 I get that, though if you were working on a project for months then got a simpler project done while doing the big one, I think you would empathize with Fern at that point. It isn’t a matter of Trump first, Hitler second. It is a matter of upload main project second, side project first.

[@s-ata-n]

THERE IS NO PROOF JEFFREY EPSTEIN KILLED HIMSELF

It is not a coincidence. Bruh has no one here had history classes? 😭 It was the 80th anniversary of this assassination attempt on hitler!

[@Eisbaer_2912]

​@@s-ata-n maybe not for that, but for other videos

[@ailsakatona2415]

I love how every single object is made of tiny circles it’s so well done and a really interesting video!

[@DomsYouTube]

I really like this dot projection style animation

[@EEEEEEEE]

E‎ ‎

[@lordbeetrot]

Agree

[@EdvinLu]

Is that the actual name of this animation style?

[@d.6786]

@@EdvinLuprojection dot style

[@amanprasad139]

I hate it More of a pain in eyes, too much going on I like it smooth and clean And if there's some textures that will be great as well

[@FreeBoy.]

You know its an awesome day, week, and a month overall, when fern uploads.

[@xTombou]

so every week and therefore every day is awesome? nice

[@Oliver-ll6pn]

I’d agree

[@mrgrumble_roblox]

hop out of the comments nerd

[@mac_attack_zach]

stop glazing

[@Mewhenthewhenthe-x7j]

He uploads like every week. You can’t even make a comment you stole funny🤦

[@benengel-k7u]

Ist halt schon krass wie stark ihr die Reichweite erhöhen konntet und halt die Qualität massiv verbessert, keep doing

[@marcop.3423]

Posting this after the Trump video is insane

[@juleha2693]

Why?

[@universaltoons]

😂

[@nathandebusschere7259]

Bro dropped the prequel 😭

[@HerrŽikaPavlović]

Yesterday was the 80th anniversary of the most well known assassination attempts on him in history, that's probably why.

[@nickxplore4265]

It's gonna make sense in 10 years 🤣

[@friend]

The rate at which these videos are being pushed out is insane considering how good the production quality is, earned a new sub 👍

[@Kalidor99]

That's easy, their main channel which has now 400 videos is in German, "Simplicissimus", they just have to translate the old videos to English.

[@NickHammer99]

You guys have such a good channel. The production value is insane and every episode is captivating. Great job

[@benitogarcia5069]

Personally this dudes voice isn’t really intriguing like the other lol

[@deziaczek1309]

10:18 I actually went to the place where it happened. It is also worth noting that the briefcase wasn't in the place that it was placed first. Someone had moved the briefcase behind the wooden leg of the table because it was in the way. This caused the explosion to be less impactfull to Hitler as he was further away from the bomb and the wooden leg took some impact on itself.

[@Max-ln1du]

Can't tell you how thankful i am for this channel that you 3 created. I came from simpli and moved also a few years prior to the netherlands. This is such a great channel aswell as arte, displaying what the connection of two countrys can do. ❤

[@eternalslumber2k6]

Keep this video quality up and keep covering such interesting subjects and you will become one of the most popular channels on this platform for sure.

[@nursepls4110]

PLEASE put actual captions on your videos. The auto generated ones are impossible to use, and your videos are too damn good to miss

[@MrBaumGeo]

yeah i agree, its kinda hard for deaf people to view otherwise aswell

[@MrBaumGeo]

and i dont mean insane assylum in an offensive way but just so you can imagine because back then it was totally different from a Psychiatric hospitals. they treated people exremely poor

[@poorsvids4738]

@@MrBaumGeo what

[@whoever_81]

Auto generated ones seem pretty good to me!

[@MrBaumGeo]

​@@poorsvids4738 bro my other comment against nzis was deleted so therefore the context was too. wtf youtube...

[@samtg7507]

The peak Documentary that you won't find in Netflix and it's for free hats off.

[@hans7856]

You failed to mention that Stauffenberg's briefcase was also moved, and a thick table leg protected Hitler from the blast.

[@Ismail-es2ld]

It makes so much sense now how you compiled your last video so fast! Having this video in the works came in clutch

[@AlexW-]

Hitlers secret: A video camera always running in his pocket ... the camera operator never dies

[@reprovedcandy]

video cameras didnt even exist back then silly

[@AlexW-]

@@reprovedcandy don't know if meta joke or not But yes they did. Just a bit bigger

[@gergelyhalasz9754]

​@@reprovedcandy Not true! The very first video camera was created in 1888, 55-57 years prior than these events.

[@BT10e]

Of all the great things done in this video, i think the pronunciation of german words stood out to me the most. Its so crisp and clear.

[@HistoryOnPaper]

1:41 subtitle: “Tesco’s turning point” I think that’s the funniest subtitle ever

[@will2056]

This moment led to the 2013 invasion of Denmark.

[@vijay-jw8gq]

No more meal deals😢

[@1oxin]

6:07 just to think if the allies didnt bomb, the war wouldve been over a lot quicker 💀

[@tobiwan001]

10:33 it’s the Bendlerblock (not Blenderblock). It was a city block in Bendlerstrasse. Now the street is called Stauffenbergstrasse - obviously.

[@thePaloo]

Your storytelling is incredible and documentary-level. Many thanks for this video!

[@saacde]

Fern keeps on dropping banger after banger this whole month?! Thank you for all the content

[@kevinr7216]

Freakin LOVE the animation on these vids good lord. Such high production quality great vid

[@busterrex7588]

Fern, your videos are too amazing. From when I first clicked on the Whittinoom video I have been hooked on this channel you guys somehow are able to produce such great quality videos whist still uploading consistency and often! Just wanted to say I appreciate the effort that goes into these videos. Cheers

[@aggravated_assault]

Because they were backed by the german public broadcasting

[@anderson._.._.8801]

Yup, the simplicissimus guys are great 👍

[@Colmath]

There is an argument to be made that him being alive actually made the war shorter. His involvement in military command from 1941 was so disastrous, so incompetent that it made huge Allied advances possible. Had he been assassinated and the German military been left to "do its job", they might have been able to hold out for longer. So in a weird way, the most evil dictator not dieing soon enough might have actually lead to fewer deaths than him becoming a martyr and even worse people coming to power.

[@MacenW]

Weird take

[@cheesegizzler14]

@@MacenWweird but definitely reasonable

[@shidditiddis]

Everything happened as it was supposed to

[@Brandonlandis]

the worst dude in history has the most luck and i cant even win $10 on a scratch off lottery ticket

[@Dr.W.Krueger]

There were far greater butchers throughout history

[@Nippleless_Cage]

Not with Hitler's level of sophistication and premeditation. ​@@Dr.W.Krueger

[@blank4ever]

i cant even win 1!!!

[@_WyngX]

Wow fern.. your animation just gets better and better every video.. I'm jealous! :D

[@rulers8969]

I'm the first person to comment on you channel.

[@_WyngX]

@@rulers8969 HEy mate! :D

[@rulers8969]

@@_WyngX hi brother

[@rulers8969]

@@_WyngX I sub to you.

[@Apfelloch]

I really like this "point cloud" style animation and the transitions. Probably saves a lot of time in comparison to actual walking animations. However, all these little dots are pretty hefty on KZbins compression algorithm such that some scenes become blurry. Tom Scott has a great video about this ("Why Snow and Confetti Ruin KZbin Video Quality").

[@christianc8453]

It’s really wild what you can uncover about history when you teach yourself. “History is written by the victors.”

[@Housewarmin]

It is music to my ears to hear you say these names properly. I love your accent

[@UPDIMAJIDBinuZaynab]

Raelly😢

[@Clock_Man_2763]

Two assassination videos in less than a week is crazy, Fern really cooks well 🔥🔥

[@thetr1x3r76]

Hey, I came from Simplicissimus (watch 2 Bored Guys as well) . I really enjoy your german videos especially because my native language is german as well. English doesn't bother me, but there are topics you discuss on fern that would be interesting on Simplicissimus as well. Especially topics like this, to get a wider target group and also the peoples that don't understand english very well. But maybe I did get something wrong and there are reasons you don't do this. But however great Video and thank you for this high quality researches, a ray of hope in a time were it is not self-evident that people really take there time to carefully work up such topics and to present them as neutral/objective as possible. Really thank you, and I hope you both keep sticking along a very long time and produce such high quality content. ☺ (I'm sorry for my written english)

[@rahmi.digital]

Unglaubliches Timing und unfassbar gut umgesetzt. Hut ab vor dem gesamten Team!

[@5upl1an]

Its easy, someone wrote his name in a Death Note with the date 30. April 1945 which made him pratically immortal until that day.

[@goblincomic4522]

I though maximum day for death note is 23 days ?

[@looniemoonie5955]

@@goblincomic4522 yes. It's just a joke. I don't remember if it's 23 days, I thought it was around 28

[@obnoxious_moron]

you can't extend someone's life with the death note

[@patrikmatousek5450]

I remember having a presentation about the Operation Valkyrie a year ago. I couldn't find any information about this nowhere. I'm very surprised how much you guys know about it. Although there's two small things I'd like to mention. Staufenberg intended to take control of Germany and make a "deal" with the united forces. He wanted to end the war with an agreement. Later that day, A. H. was having a conversation with somebody and they even laughed at this attempt. Very well made :)

[@timpa2397]

not saying this feels pretty relatable rn but it might feel pretty relatable rn

[@--AnonymousUser--]

0:10 You made a mistake here. That's the Bunker-Hitler outfit from Spring 1945, not the Chancellor outfit from late 1939.

[@6mtsaab]

Bruh who cares

[@Abdullah0091a]

​@@6mtsaab I care

[@FJWL898]

​@@Abdullah0091a not me

[@Kxmikazee]

That’s actually really interesting!

[@RavinRavindrakumar2]

richtig

[@Qba116]

Love that you included (or maybe "excluded") Stauffenberg's missing right hand!

[@striderwhiston9897]

This artstyle of yours kinda reminds me of those war flashback cutscenes in call of duty ghosts.

[@Lt_Koro]

I was gonna comment on how this video after the trump video is weird, but pushing the trump video out as quickly as possibly was just important and yesterday was the 80th anniversary of this event, so it really cant be malicious in any way.

[@jackfireee]

I never knew about this. I'm a huge WW2 history fan and I love and enjoy watching videos like this. Thank you for making this video fern!

[@rjbeatz]

The irony is that he ended up killing himself after all the attempts 💀

[@mrbilter83]

"Fine i'll do it myself" - funny mustache man, 1945 -

[@the_mastermage]

He be like fine I'll do it myself

[@grandcanyon-d4d]

He ran to South America

[@mariopasta]

Or maybe not

[@shashwatgrover1]

Maybe they would have said that Trump also did it himself 🤷🏻‍♂️

[@Alex-rn6rr]

Cant wait to watch this on Simplicissimus

[@Jonathan_drg]

Ihr übertrefft euch mit den Videos mittlerweile selbst! Die Animationen sind 💯💯

[@virdixxii8341]

taking notes

[@CARDAMELO]

Y'all messed up in the head

[@LG23-ho3zk]

Hitler is the real life stupid comically evil villain that the franchise keeps on reviving Edit: dawg this pfp is satire, I ain’t actually ancap

[@Neverlose001]

O.J. Simpson

[@dikipprasad]

Look who's saying that 😂

[@unnameduser-1]

sus profile pic

[@Snp2024]

​@@unnameduser-1why

[@unnameduser-1]

@@Snp2024 dont get it? look at the colors 🟨⬛

[@BrendanLorenzo]

The aesthetic of the animation is so unique and lends itself beautifully to the storytelling 👌

[@DiplexHeated]

The people who think it’s crazy dropping this after the Trump video are the ones associating Trump with Hitler, not the channel.

[@mao-tse-tung-games]

It wasn't planned, but when it happened, they grabbed the opportunity. Truly a deficit of respect

[@BlackoutWH]

@@mao-tse-tung-games Or maybe it was the 80th anniversary of the attempt mhhh.... nahh they just grabbed the opportunity

[@Stijn5]

@@mao-tse-tung-games Boohoohoo. The orange sociopath is impossible to respect.

[@johnnyxmusic]

@@Stijn5 you know it’s fantastic… Powered by the right AI algorithm… Every disparaging comment about a certain person could probably be collected in one afternoon… And go on a certain persons list… A certain person who is planning on creating concentration camps… And when the people in those concentration camps are emptied out… They’ll be plenty of room for people who don’t go along with the agenda of that certain person. I believe the camps in Germany at least one of them were created As rehabilitation camps. That’s the one that has a certain phrase over the gateway…

[@micahsarm]

@@mao-tse-tung-games Respect should be given to those who deserve it, not to those like Trumpie.

[@dhavalshah2612]

babe wake up, new Fern video dropped.

[@shadowdweller-f7q]

I use KZbin Premium so I don't see ads now. So I really want to know how you guys create such 3D scenes so amazingly. They are mesmerizing. Truly amazing. The ads are annoying but they also introduced me to many new websites and other things. I appreciate them for that. But my time saved in those ads is much more valuable than those website in my context. Hence I use KZbin Premium.

[@Vinitys]

Really underrated channel

[@swedishplayer97]

Literally has over a million subscribers

[@POLIZFI]

@@swedishplayer97 only a million

[@hanibalfischkopf6286]

​@@swedishplayer97Should be way more.

[@neusyns]

Underrated? Bad choice of words. It has a German main channel and an English channel (this one) But underrated in the fact that these haven't been picked up by an official TV docu-series. Yes Whatever goal this channels creator set for itself, it HAS to have accomplished because idk how it gets better than this

[@aurexify]

Learn what 'underrated' means.

[@marianandnorbert]

HE CAN'T KEEP GETTING AWAY WITH IT

[@g3nj1]

The tried to put Adolf in a self defense situation and found out.

[@johannesr8709]

The dust visuals and animations are absolutely insane ! Amazing work!

[@samhayzen]

Hope y'all are taking notes :D

[@CARDAMELO]

Ur messed up in the head

[@amayaslore]

if trump somehow gets 😵🪦 then you will get Vance as president. Just saying.

[@just_mdd4]

Fern must've planned these videos! 😝

[@just_mdd4]

Disclaimer: Yes, I know the timing was not intentional.

[@Paradoxical124]

@@just_mdd4why make the comment then 🤦‍♂️

[@Hyperlaser_Merc]

Its funny, ​@@Paradoxical124

[@Paradoxical124]

@@Hyperlaser_Merc I suppose that’s my issue because I didn’t laugh 😞

[@ftr98]

Yes because yesterday was the 80'th anniversary of the stauffenberg attentat

[@orfoisus]

Damn! Brilliant really spent A TON on this recent youtube-wide ad-spree

[@Cypher791]

They don’t make tables like that anymore… ✋😆

[@foudie]

i mean they could've just put the other unarmed bomb with the armed bomb in the brief case, so when the first bomb explodes the other one would too.

[@grimnippz7398]

depends on the explosive used, it could have just blown the second bomb apart failing too detonate.

[@Marcel-yu2fw]

@@grimnippz7398 But it couldn't hurt to put in the other bomb too, right? Just in case it works.

[@hwfq34fajw9foiffawdiufhuaiwfhw]

not that i have knowledge of bomb making, but that would likely just shatter the other bomb into shrapnel like it was any other object in the blast radius. wouldn't be the same as a second bomb exploding (overheated) soda can vs firing a bullet through a soda can

[@cuboidmelon]

If it was minecraft, then yeah...

[@grimnippz7398]

The explosives used required a chemical reaction for the detonation, meaning the pressure of the second bomb would have had almost no chance too undergo detonation. However as a redundancy it couldnt have hurt.

[@nyfex4190]

Jonas is the perfect speaker for this topic, since there are so many notable German personalities in those happenings

[@0h5ive]

holy shit he still alive?!

[@GeorgeNoah-xf9tb]

Hallelujah 🙌🏻!!!!! The daily jesus devotional has been a huge part of my transformation, God is good 🙌🏻🙌🏻. I was owing a loan of $49,000 to the bank for my son's brain surgery, Now I'm no longer in debt after I invested $11,000 and got my payout of $290,500 every month…God bless Mrs Susan Jane Christy ❤️

[@PoynterGeesey]

Hello!! how do you make such monthly, I’m a born Christian and sometimes I feel so down of myself 😭 because of low finance but I still believe God

[@NoahOliver-rx3mp]

Thanks to my co-worker (Carson ) who suggested Ms Susan Jane Christy

[@KleffmanRosenbush]

She's a licensed broker here in the states🇺🇸 and finance advisor.

[@KleffmanRosenbush]

After I raised up to 525k trading with her I bought a new House and a car here in the states🇺🇸🇺🇸 also paid for my son's surgery….Glory to God, shalom.

[@LouisPeters-fw9cg]

Can I also do it??? My life is facing lots of challenges lately

[@kanjiking]

The quality of your animations has become just insane. Love your work.

[@timr.2257]

1: Aren’t there better methods back then than relying on chemicals for a time bomb? 😅 2: They don’t even pat down new people that gets close to Hitler?

[@concept5631]

Nazi's aren't known for being smart.

[@JollyBubuyug]

The fact he got away from all of those assassinations but not the assassination from himself.

[@brainboggleyt]

Bro’s editing is another level ❤

[@Bloidz7]

Fern is on his assassination video arc

[@rostislav.lisovy]

Ok... so showing all those explosions, talking about killing someone, showing human figures with grenades in their pockets and explaining they would have also killed themselves is ok... but for some reason you have to "censor" the word "suicide"?

[@myaccount__7269]

Blame KZbin who de mometizes bad words

[@jakedee4117]

I thought the same thing myself, but it's KZbin rules, and perhaps censored automatically by algorithm not by a human who understands the full subject matter. I recently have heard KZbinrs saying, "He un-alive himself!"

[@ergwertgesrthehwehwejwe]

At what point do we stop forgiving youtubers for bending the knee to censorship like this? Nobody seems to have a spine anymore

[@myaccount__7269]

@@ergwertgesrthehwehwejwe it’s either this or they get zero money. Do you work for free? As I said…blame KZbin

[@keisuketakahasi4584]

@@myaccount__7269 dont hate the player, hate the game

[@realpv_aka_vp]

Despite the fact that i know that its a coincidence, this video's timing is the funniest thing I've seen in a while even though other people, including the creators, might disagree, this is kinda meaningful as well

[@saltywater5097]

You are the problem.

[@realpv_aka_vp]

@@saltywater5097

[@Ostro-goth]

@@saltywater5097womp womp

[@vincent-of7vo]

Today, we remember Claus schenk Graf von stauffenberg🕊️

[@muysli.y1855]

11:47 smart

[@Kaanooo]

Ich frage mich immer wie solche Videos entstehen. Also ernsthaft, wie funktioniert die Animaton der Videos? Wie werden die Themen rausgesucht ? Man merkt das viel Mühe und Arbeit reingesteckt wird und deswegen schaue ich sie mir auch gerne an.

[@skorp5677]

Simpli haben halt inzwischen ne recht große Redaktion. Auf dem Kanal gab es glaube ich auch mal irgendwann ein Video zum Entstehungsprozess. Vielleicht auch auf 2BG

[@Kaanooo]

@@skorp5677 ah ok, danke für die antwort.

[@nelo1453]

Ungewöhnlich Euch auf Englisch zu gucken wenn man nur Simplicissimus gewohnt ist

[@Turkishgameinvader]

That bastard survived 43 assasinations dude he has some kind of plot armor

[@ArthurSenior-g9i]

please make longer vids bc i love ur content

[@mr_npczzz]

All this and bro killed himself 💀

[@k4m-z1]

lmao

[@TheOGRokma]

Odd coincidence of when this video came out🤔

[@udiniali]

the production level is crazy

[@ShowCasesGD]

SHUT UP MOM FERN UPLOADED

[@hanibalfischkopf6286]

Hitler put all his skill points in luck.

[@Nobody.exe50]

the production value of this is amazing

[@sleepingmelons8420]

Why is KZbin posting Wikipedia articles.

[@Mightydoggo]

Haha! The timing is just glorious, I think the universe wants to tell us something. lol And yeah, every halfway sane person knows how long it takes for such a video to make. It´s a coincidence, but a really funny one.

[@nikoraasu6929]

timing on what

[@mao-tse-tung-games]

Nah. They had been working for a while, sure, but they get to decide when it uploads. It's not a mere "coincidence". It's their strategy of getting the algorithm on their side. And they got it.

[@BlackoutWH]

​@@mao-tse-tung-gamessure it's not like the most famous attempt in the video had its anniversary the day before it got released

[@arc1419]

I think I speak for everyone when I said that we will be more than grafetufl if we got 40 videos of the 40 different assassination attempts on Hitler with this animation, writing and voice acting beyond amazing

[@lukemontgomery1774]

You'd think after 40 attempts he'd take the hint

[@alphakevin687]

Fascists are not the smartest bunch

[@antdiamond64]

He did

[@Willy_Tepes]

That the hand of God was protecting him?

[@sayorancode]

@@Willy_Tepes if god was mean : , no it has to be a coincidence

[@Willy_Tepes]

@@sayorancode God takes care of his servants..

[@NegativeProcess]

If this happened in America we would have some people saying these were acts of god 😂

[@VeriEnana]

your passion for teaching and sharing is clearly visible in every video! ❤️

[@DoFliesCallUsWalks]

fern is on an Assassination streak.