How to Actually Escape the Botnet

[@name-qi1gs]

Tech companies are not just selling your data. They are changing your opinions and behaviour - this is often overlooked.

[@notuxnobux]

sus amogus

[@ColinBFClarke]

why do you think everything is a "curated" experience

[@bigmax69]

As of now I am more concerned with not letting big tech control my thoughts as I am with not letting them spy on me. By no means am I saying i am sacrificing one for the other btw

[@Nirossen]

Behaviour especially. Mindless scrolling is a plague

[@starllama2149]

They subliminally influence how you think, and then give you the "freedom" for self-moderation on their own platforms. Then what you end up doing is spreading the opinions they want you to spread and the mass starts censoring itself.

[@TheMetaldudeX]

I’m sorry. But I absolutely NEED my Alexa smart soap dispenser. Don’t tell me how to live my life.

[@TheSuperJepphyKiller]

Lol

[@roguewasbanned4746]

Exactly bro, I also need my refrigerator to have the Google™ automatic lobotomy extension. It’s a must have for whenever my thinking goes out of sync! Haha

[@peanut3438]

@@roguewasbanned4746 Man I hate when I start wrongthinking too lol

[@rileykiing2266]

Then don't watch his videos

[@zzingping3674]

@@rileykiing2266 you missed the joke

[@justinbuddy56]

I CAN’T BELIEVE IT. MENTAL IS NOT AN ORANGE CAT

[@praetor29]

Garfield

[@kenosabi]

I'm disappointed.

[@Abn.mohamed]

and doesn't has four eyes

[@TheItalianoAssassino]

@@praetor29 GARFIELD in Fortnite confirmed??

[@distorted_heavy]

It's just a deepfake, no need to worry

[@devondorr8212]

What I think the most hilarious thing about VPN is that a technology that was originally intended to be used to connect Private Networks while you are not physically within that network group, now is being used to connect to the internet...

[@VertegrezNox]

Right? WTF is with the constant obfuscation or patent trolling (MS) of specific/accurate computer lingo/jargon.. Monitors were once measured by vertical pixel before cinema standards"".. Before normos heard of fiberoptic internet lines Gigabyte internet got reduced to Gigabit internet... (& loool that people thought "ray tracing" was brand new technology.. )

[@seronymus]

What are Private Networks originally like?

[@FoulUnderworldCreature]

@@seronymus It's still used like that. Examples: a business may use a VPN so that a system administrator can remotely work on a server. A university may use a VPN to allow professors to access the school library from home.

[@devondorr8212]

@@seronymus It basically makes you able to access networks that are not exposed to the internet. A very typical (and probably most formal) usage to this date is for accessing corporation/school resources with your own network.

[@trollerjakthetrollinggod-e7761]

it's worse than you think. VPNs are designed to make it EASIER for the government to take your information. Look up Operation Rubicon.

[@WilliamMcAdams]

Luke, the deepfake is on point. Had me doubting for a few seconds.

[@niggacockball7995]

he is using the same deepfake for so long that feds will think that this is his actual face

[@Bruh-hd4rj]

🤣

[@bren.r]

Same - the new beard in this patch looks a lot more realistic.

[@slothguy_]

Really cute, really cute...

[@razorsharpgs3556]

can someone explain me the deepfake thing ? im new to the channel lol

[@inkmime]

"How to have privacy on the internet: step 1: Never use the internet"

[@gaminggamingtm]

True

[@maxweber06]

This video might as well be named "How to not get wet while boating"

[@bushy9780]

@@maxweber06 Step 1: Buy a yacht

[@UnixOath]

@@bushy9780 wrong, I think it's supposed to be a submarine.

[@aorusaki]

Unfortunately :/ but we can strive to make it better

[@clared5812]

I often feel hopeless about all the corruption in this world and how impossible it is to have privacy or freedom of speech. Your videos give me a little spark of hope. Thank you.

[@w__a__l__e]

dont feel hopeless, use it to empower yourself!

[@captgeoff0713]

I was feeling hopeless until I was introduced to Linux.

[@yes-vy6bn]

urbit

[@sumkindacheeto]

Hope is beliving that something will happen for the better sometime in the future. People should be less hopeful.

[@afallingtree9114]

i used to think that too. the more hopeless a situation is, the more effective your individual efforts become (not to say your efforts immediately become meaningless when things start getting better)

[@3lH4ck3rC0mf0r7]

This is the main crux of the privacy problem with the Internet. Achieving any decent amount of online privacy basically requires going off the grid and into DIY territory and giving up on the more common apps, platforms and OSes. Because those default to helping themselves to all of your data, with no easy way to put a wrench on the collection processes. This should not be the end-user's burden. But as it stands, it is. In an ideal world, people would use whatever standard app or service and be perfectly safe, but the landscape has shifted into being increasingly predatory and pervasive. You can load pretty much any website out there and get spoonfed trackers up the wazoo, even non-Javascript trackers like click counter images, 3rd-party cookies and magic pixels, and even CDN-based tracking. Fingerprinters use every trick in the book, and they still collect a ton of potentially-identifying data even with Javascript turned off. Worse yet, the more browser and OS extensions and settings you stockpile to block ads and tracking, the more you stray away from defaults and statistical averages, the more unique your browser behavior gets, the easier it actually is to fingerprint. It's nasty. And good luck getting any trustworthy amount of privacy out of your smartphone. That's where the challenge gets real. I mean, I don't even trust Google or Apple not to lie to my face and bypass the permission settings or upload other data not accounted for by any permission toggles that I still find concerning nonetheless behind my back. And if I don't even trust the OS that comes with the device, well... let's just say I have a lot of work to do every time I buy a new phone.

[@benni1015]

This is why i have basically given up on perfect privacy. Sure i try to evade the cookie banner(reading mode), try to block as much JS as possible(especially google analytics), use a hardened firefox, ublock and so on and so on, but at the end i'm certain that in some shape or form i'm tracked anyways. My VPN is probably contaminated as i accidentally logged into youtube with it, but well use it anyways when i need it. I have resorted to leave my firefox setup as it is and apply the most comfy measures against tracking. Noscript can be a little annoying at times, but overall it is alright like this. Trying to archive perfect privacy would be like fighting a constant war against any and every website, which gets exhausting after some time.

[@pietrocavicchioli6128]

The real problem is... Could I stop using whatsapp in favor of another messaging app? Well... NO. That's the real problem you are tied to these fucking apps, they are embedded in our social system, I live in Italy, here WhatsApp is used for everything, work, school, talking to your friends, everything, you can't just stop using it. You will have problems at work if you stop using it. Instagram? The same shit, you meet a girl at a party but you were quite drunk, so you didn't get her phone number, how can you contact her? Well... Instagram is the only (socially accepted) way to do it without looking like a creep... It's like a ancient Roman trying to escape the Mos Maiorum... Well, no you can't, you are just fucked. In my opinion the only actually good weapon is... Awareness, knowing that you are being tracked and used.

[@BruceCarbonLakeriver]

@@pietrocavicchioli6128 yep and knowing which topics you actually want to communicate through those hostile services. I've more and more live meet ups with friends than writting or calling them stuff.

[@valghyna7668]

I subscribe to nextdns and it typically blocks about 20% of my DNS traffic via filters. At 2 bucks a month I consider it worth it.

[@TheDiner50]

And now you all have given consent for Google to lable you as a activist or just to make it easy on them "terrorist". :) Good privacy mind of you to give the enemy a heads up what you really think and do. No but really. Everything to do with internet is FUKT. Phones ANY phone that can be called modern is FUKT. Modern computers are FUKT. Modern home networks are FUKT. I hate to write stuff on paper but I mean it is the only got dam thing I can be sure of is secure as long as not a physical attack/camera is watching the papers. Really even a computer not connected to anything but grid power is sus. Since I bet that a serious high end attack can compromise it without physical attack vectors by piggy backing on USB drives or just moving any kind of data block devices between it and a internet connected device to transfers the spying on you and your stuff. Really in IT/Data security there is always something hidden from your control audit reach. You need to nip the problem right in the balls. Where the data leaves and enters your device. It really is the only place you can make 100% sure what happens with your stuff. I mean that outside of malware that encrypts your data for ransomware (this kind of attack is made to spread to everything so you are in danger of it constantly). Computers, even a modern ones with no connection to Wifi, Bluetooth or Enhernate cables and mic/camera, well they are the only reasonable trustworthy tech devices left. Since they can not talk with anyone. So they can not really do anything without being very clearly not what we want. (Blue screen, erase everything just because you said a bad word) Since outside of a ransomware the only attack vector left is to set up a protocol to communicate with hard drives (block devices) and by that mean compromise even a offline device. You can have all kinds of spooky computer and software going on as long as you can audit the dam data that leaves and enters it. So the only REAL feasible solution to privacy is to being able to audit data transfers. That takes skills and dedication. But it is the only reasonable way to make sure what you leak out on the internet. How? Idk really. Not a nut job yet. Not a bot. Just saying that if you can make sure that the data you transfers. ONLY contain what is meant to go down the transfer lanes you are down to physical attack vectors and poor security from your own actions and failings as a user. Like by mistake type in your password where it should not go XD. But even got dam paper printers CAN NOT ***** STOP TRYING TO FINGER PRINT YOU!!!! And SCAM YOU! Agen I hate writing stuff on paper. But I got to say that it is the only way you can store information nowadays safely as a private individual. A real VPN is to drive down to the milk and cigarette store and hand a letter to your contacts. Preferably in a container made of led and hate speech XD I really hope this rant is taken as a joke. But the point is that we are all FUKT. And it is just silly to talk privacy in this day and age. I can only hope it dose not get any worse then it is currently. Imagen if somehow it is feasible to communicate 100% securely over internet. Audit every single bit and run very check possible for tampering. To then have the hardware in the computers relies that they did not get the payload it expected for "safety" and "terrorist" prevention and just nukes everything. Since ofc it can not be right to allow privacy and security. This is the truth and reality. We are not meant to decide anything anymore. Not a nut job. Just talking about the core thing in all of this. Privacy and free speech. Right to repair. Right to own. Etc etc. Being allowed to own yourself even. Right now I do not see it being impossible to stop this stuff from totally hinder you to do stuff. But looking at what repair prevention is doing we can see it being implemented to stop free speech too. Stop any way to use computers and tech without accepting being under control by gov. Or really it is not the gov but the people seeking power and control over others. Gov is in itself good. FYI. You can probably still 100% make sure that data transferred is only the stuff you the user wanted to be in there. But as it is look like we are heading into the possibility of more layers of obscurity some Linux nonsense is not going to do jack shit to solve. We are going to be down to type in every dam character as they did in the 70s 80s since hardware is going to be built to be payload operated for "safety" or "DRM". We are going from hardware that are just power lines and resistors to a world of the power lines being protected by DRM. We are connecting more and more to internet/direct connection to goverment/attackers. There is no where for enterprise or private individuals to go but start going back to pre computer days. Pre 70s. You realize how dangerous that is? To be literately forced back 50 years in evolution? And the big companies do not need to and profit from it? It is scary enough to watch phone review and they say how good google accident is at understanding what your saying. Shina got cameras everywhere so even if you have no device on you the gov know you every move. Every interaction you have. Everything. Are we any different right now? I know for sure we are being striped of our ability to repair and own our stuff. That is no question about that. For what reason? Profit.

[@Konkov]

Wow the deepfake looks so real this time

[@Prem-j9l3s]

is that actually him or a deep fake idek who that is

[@yogurtColombiano]

got a beard upgrade

[@sirjerearchive1342]

@@Prem-j9l3s ik he has such a white voice. It’s like it’s not possible for a nigga to speak proper.

[@funkyfresh1013]

gj luke

[@johnyewtube2286]

He only deepfakes his skin color, he really is an Indian.

[@bigdaddyslick4961]

If drake became a nerd this is the guy

[@drpastormartinssempa8994]

Minus the grooming of minors

[@johannesviljoen9656]

Yall ever forget that youtubers have faces. I had a mental image of a 4 eyed, privacy conscious, heterocromic cat.

[@user-rh9uu1bg1p]

Ive always just remembered him as the black Luke Smith but not retarded

[@userequaltoNull]

Yeah haha. They're just voices from the light-box as far as I'm concerned.

[@beardalaxy]

before i knew what mental outlaw looked like i thought he was an older white dude who always wore a cowboy hat.

[@wontcreep]

@@userequaltoNull says the text "written" by a "real person" can't fool me, neural network

[@matthew2531]

The world is not ready for his final form.

[@1996Pinocchio]

The problem with "run your own [email/ftp/...] server" is, that you need to maintain it. If something breaks, you have to fix it yourself. If you use an external cloud, all you have to do is wait for them to fix it.

[@ANGELRA]

Big companies with dozens of experts have vulnerabilities in their email servers, now imagine your average Joe creating his own email server, he will most likely leave backdoors without realizing.

[@lodocus1501]

Is "waiting for them to fix it" worth keeping your own files inside strangers computers far far away that you do not have any sort of access to apart from the sugar-coated restricted UI that they hand out to you? Not claiming one should definitely host their own services, but I really do not think one should use any of these cloud services either if they care about their privacy.

[@ANGELRA]

@@lodocus1501 If the server it's open source and the files are encrypted, I don't really see a problem

[@fernandobrandt7230]

@@ANGELRA open source is misunderstood with secure, nothing prevents a company to change it's source code for their needs and claim they follow the github source code.

[@madokalover]

it's usually not very hard to maintain. if the only way to access your server is secure (ssh) then you don't really have to worry about anyone getting in. usually installing a server is a one-time thing you just install shit configure it and leave it running forever.

[@experibassmusic]

Of all the things I expected you to look like I did not expect a literal gigachad lmfaooo

[@mirilondondrift]

average linux user

[@Konkov]

This is what shows up at your door when you say chrome os and Mac are Linux distros

[@bomsh_channel]

@@Konkov mac is more of a bsd distro

[@TalsonHacks]

@@mirilondondrift Arch Linux to be exact

[@KingLich451]

giganiga

[@bruno-vicious]

Ironically I saw a video of someone explaining how to make a point to point wireless link between two Amish settlements between Pennsylvania and Ohio. The Amish aren't 100% against technology. They just seemed to be more conservative about their uses of it.

[@Kittysuit]

as it should be

[@victorhugo-wo2ci]

Damn thats pretty interesting, honestly

[@AlexZanderMuro]

from what i understand theres different "tiers" of amish too, like some of them will wear somewhat modern clothes, use some modern tech, etc but still have a lot of the base fundamentals, then theres an intermediate group thats somewhere between that and the stereotypical amish person, and finally theres the ultra orthodox traditional amish families that still have arguments about using bikes

[@evanhuizenga8626]

@@AlexZanderMuro The ultra Orthodox are ultra-based

[@MeatCatCheesyBlaster]

If they didn't adapt to technology, they would starve.

[@jordanmcconnon6214]

bruh the similarity in the facial structure of both yourself and Luke Smith is actually striking.

[@MentalOutlaw]

Same deepfake, different brightness and contrast levels.

[@cyberninjazero5659]

The Tech Privacy Physiognomy

[@KingLich451]

i do like that you are pushing Odysee even more out there. I wish more youtubers did that

[@MemoGrafix]

We're adDicKted to ScrewTube seems kinda hard for most to give up.

[@HopeisAnger]

​@@MemoGrafixTruth.

[@shiverello6109]

The world needs more people like you, really. I know few people as redpilled as you and it often makes me angry when non-tech savvy people are like "So what i dont have anything to hide".. Im always telling them that the way to totalitarism is not a single new bad law or a single piece of data you have to give, but a gradual change that the normies dont get or dont want to notice. So they might ignore this one new law and the next one and the next one and at some point they will have lost their freedom of speech without paying attention. I am not afraid of the feds trying to stop criminals, but of the technology they use to try to do that, which is so easily abusable to create a totalitarian state over time. Whatever, have a great weekend

[@sinful4569]

Bro uses 'redpilled'

[@theexalius7947]

The best we can do is spread the knowledge. That's what I've been doing. Informing as many people as possible on opsec and the naughtiness of these corporations and governments

[@birdblue4821]

while I agree on the part that people usually say "so what if they have my data or spy on me" I don't believe that using open soruce software will stop the government from doing the shit they have planned. It's like, you can reduce the amount of tracking they do to you but if everyone reduces that, a new way of tracking will be implemented or some other shit so that they get their power over you back. The only way you could argue with them and not be their pet is with money.

[@mrbanana6464]

People implicitly preform risk-reward evaluations for data disclosure decisions on their own. This privacy calculus is subject to cognitive biases, choice architecture, information asymmetries, and other factors which typically result in people making decisions against their own interest. If you want people to care about privacy you need to stop asserting your own subjective risk evaluation and premonitions, and let people make these evaluations on their own. The real problem is that legislation that grants consumers rights to access, modify, delete, as well as limiting the collection, use, and specification of their data is very sparse and needs more attention. It is more productive for privacy advocates to address this problem than to warn about the "risks" of information disclosures when people are capable of making these decisions on their own. Telling people to stop using certain services can actually work against perception towards privacy when people find the reward of using the service to exceed the risks associated with information disclosure.

[@theexalius7947]

@Mr Banana How would I go about allowing them to form their own opinion when their own opinion isn't their own opinion? I assume by making them aware of the issues you mentioned, namely information asymmetries.

[@OneBiasedOpinion]

I appreciate the quick info. I’ve been on the fence about this whole VPN thing for a while now because after some brief research I couldn’t really find anything besides the extra layer of protection offered by the tunneling and the ability to spoof my location to bypass region-locking. Yet everyone keeps saying “it protects my data.” This helped me to understand the situation much more. You’ve also helped confirm my long-term decision to not use major corpo software or almost any form of social media.

[@OneBiasedOpinion]

@Tetrazole I only have 1 box because I am a broke man and I don’t do anything by phone that I care about getting extra security on, but yeah, ideally you wouldn’t have multiple computers running the same VPN account.

[@Gameplayery]

Man... Metal Gear Solid 2 was so ahead of it's time. They knew that information would be the currency of the future. Oh that and nanomachines son 🐍

[@KingLich451]

La Li Lu Le Lo!

[@TwelveLetter956]

La Li Lu Le Lo!

[@龗]

@@TwelveLetter956 raito

[@龗]

@@grayefarer8151 ur batsht insan!!

[@synthesoul]

ラ・リ・ル・レ・ロ

[@chrisbolgiano27]

Hey man I just wanna say thank you for all the content you put out on your own time. Been watching your videos for about a year now and you've taught me so much. Love the content and your presentation style, can't wait for the next video

[@josephkelly4893]

You sir are one of the last intelligent free thinkers still able to navigate KZbin as a creator. Thanks for the vid

[@erinkylecordero]

Back when i barely knew anything abt tech in general I wanted to use NordVPN simply for changing IP for a game but the service alone was so bad and even the free trial sucked that I just gave up lol. You are right, one shouldnt trust youtubers too much on what they advertise

[@RobbieStarburster]

I think some of those services are fine (depending on the threat model). Proton/Signal would be good for the average person looking to improve their privacy but not someone with a more serious threat model. Knowledge is power only when trained, get used to learning as much as possible.

[@bradk8590]

Yes, perfect shouldn't be the enemy of good. I'd so much rather people use ProtonMail (which obeys subpoenas) than GMail (which actively harvests your data and gives you ads when you check your email.) Hosting your own email server is a PITA even if you know what you're doing

[@Damon_At_Forged_Faith]

@@bradk8590 PITA?

[@spyro3635]

@@Damon_At_Forged_Faith pain in the a

[@ANGELRA]

If we talk about average people privacy, both signal and proton are a very good option. I also believe that something like mullvad vpn it's also a good solution to evade censorship and block potential man in the middle attacks.

[@victorhugo-wo2ci]

@@Damon_At_Forged_Faith P.I.T.A or pain in the ass for the common reader

[@Woodywoodah]

The government in my country requires by law that all ISPs to do mandatory metadata retention of all customers ( pretty much log all of your DNS requests ). There have been documented cases of people abusing their access to that metadata being collected. I think that's a pretty good reason to use a VPN.

[@Woodywoodah]

@@UnKnownv5 Australia actually. We have all kinds of wacky and interesting internet related laws here.

[@omnipotentvoice6537]

Damn Man, you've been in a creative frenzy lately. Lots of uploads, I'm loving it. Keep it up. Also, kinda freaked out about the guy named "Omnipotent" getting caught, idk why.

[@DiogenesTheCynic.]

It’s called irony.

[@landon1812]

At this point I find that the very core of the internet is just built around engagement and because of that companies use whatever they can to get people to use their services to engage with other people and the internet in general to gather data on you and study your interests and behaviors to make the most profit off of you, so the points in this video are valid and some of them can be applicable to most people but it just goes to show how screwed up corporations and governments are to know everything there is about anyone.

[@luciusblue4565]

Was surprised that there was no mention of "don't use Google DNS". Setting up something like a local Pi-hole with Unbound as a recursive DNS at home is doable even if you don't sport a degree in network engineering. Won't protect you from law enforcement, but at least you are not volunteering every single website visited to your ISP or DNS Provider (who may or may not sell that data). As an added bonus it can block a ton of unwanted connections by mobile and smart devices.

[@thedoode7749]

could yiu elaborate on this idea?

[@luciusblue4565]

@@thedoode7749 Whenever you enter a webadress, your computer first sends a request to a DNS (Domain Name Service) Server which translates the domainname to an IP adress. Typically the DNS is provided by your Service Provider (which may be subject to local censorship, if they are for example required by law to block certain websites), but third party DNS Services exist. Google DNS is one often recommended because it is fast and censorship free, but propably not very privacy friendly. By running your own local DNS Service, your local DNS server contacts one of the global 13 DNS Root-Servers (which in reality are thousands of machines) to ask for the authorative DNS Server that is able to solve the request you may have and returns it to you. This means that no single server or entity sees all your requests since they get spread out. Pi-hole is a popular DNS adblocker for the raspberry pi that blocks ads on your whole local network. If you search for "pi-hole" or "pi-hole with unbound recursive" I am sure you will find plenty of tutorials and explainations that elaborate deeper on the concepts.

[@SzymonPmc]

I swear what is the thing with pi hole my routers custom firmware has filtering built in.

[@luciusblue4565]

@@SzymonPmc Pi-hole isn't the only filtering solution to be sure. There are plenty of usecases where it can be useful however, especially when paired with Unbound. A fair amount of people may be using ISP supplied routers, in which case a custom firmware may not be an option, or delving into something like pfsense or opensense may seem too daunting.

[@PySnek]

It's still possible to find out which videos you've watched over HTTPS by looking at the amount of bytes passed through the network. Every video has different sizes and is split into many parts for streaming, which makes it even easier to find the exact one. Bare this in mind.

[@filibertocarnal]

Dude thanks for this, I'm getting started into dev stuff and you're pointing me to the right direction, appreciate that.

[@galopeian]

The other thing about going "off grid" is that it becomes its own unique signature. If your ISP notices that you are the sole person in a given area using a vpn or TOR they might flag that. You also need to consider a realistic threat model. If you are just privacy conscious without a real threat (journalist, hacker, activist) then this video has great advice.

[@applemarkwantsvids]

Kenny, you rock! I get so much from your lessons and lectures.

[@OnarTheMage]

I love Tom Spark's Reviews VPN content he virtually reviewed every VPN and even has a tier list.

[@P1T4Bot]

Is he trusted tho?

[@More_Row]

Looking buff, and also great discussion. Thanks

[@KotleKettle]

And again, thanks for educating us, normies. Much love, my dear sir 💕

[@Finkelfunk]

It has taken me the last two years to build at least some of my internet privacy back - switching from things like Chrome to Brave, Google to SearX, Windows to Linux, yada yada, you all know the drill. Despite two years of actually trying and thinking about how to protect my privacy, obscure techniques like User Agent Spoofing which normies will never even hear of in their life and reading like 20 books on surveillance including any kind of technology from government to private companies and smartphones - despite all of the effort I put into actually acquiring decent privacy, I am FAR off from actually done. I still use an Android Phone, still use Whatsapp (mostly because nobody wants to switch to Signal :( ) and use TOR less than I probably should because I'm too lazy to solve Captchas all the fucking time. The point I am trying to make is this: Privacy isn't like "Uh install a magic app and now you're safe". Privacy and anonymity is FUCKING HARD and SUPER TEDIOUS to achieve. It's constantly reading up on what is technologically possible, educating yourself on how everything works, slowly switching over to more privacy friendly alternatives etc. You can't just jump in head first into the privacy-rabbit hole, you'll immediately start using your old apps out of convenience again. And like you said, you HAVE to understand technology to some capacity beyond your average normie. If I don't know what a browser fingerprint is or a DNS request then how am I ever gonna understand why you would track these let alone how to protect myself from it. And all the best privacy in the world isn't gonna do shit once I log into YT. There is so much to watch, so much to cover, so much to change that I personally really hate these guides. I'd give people one or two tips on where they can read up on what is possible, read a couple of great books about it and then slowly start to become aware of how you interact with a computer. Learning how it all works, how to protect yourself etc. is slowly gonna come on its own. But you have to keep at it and be willing to sacrifice some time and convenience to do it.

[@randomrfkov]

Normies don't want switch to Signal, because they grew accustomed to Whatsapp. And they still don't know it was bought by Facebook.

[@Finkelfunk]

@@randomrfkov Yeah, exactly what I talked about, it is an inconvenience to them to set up an extra account and have two apps and maybe not have all their contacts on there and so on - which is generally the entire point why people stay lazy about their privacy.

[@owo6384]

I got bullied because i want to switch to open source apps and secure messenging app. They said privacy doesn't matter if you still using internet

[@KNylen]

what books do u recommend, please?

[@jermm2183]

while not quite as devoted as you, I know what you mean. Past year-ish I've more or less done the same: windows --> linux, chrome --> tor/librewolf, google --> personal SearX instance, becoming advanced uBlock Origin user, degoogling (well I technically still use youtube so ig this one doesn't count,) and like you said yada yada all the other stuff. I myself am in the trap called being poor and am stuck with the iPhone my ISP gives me with my plan so no GrapheneOS for me so I myself am also nowhere close despite tens, if not 100+ hours of work. Since you have an android phone though, here's a guide that The Hated One recently posted that might help you with protecting your smartphone's privacy, I'm guessing you can't get GrapheneOS but you can implement a few things if you want from this, yewtu.be/8FDIef7tVFg

[@PhilfreezeCH]

Personally I think IoT that isn‘t actually connected to the internet at any point is fine (it is of course debatable if that is still IoT). So in my case I have some Zigbee and Bluetooth devices connected to a hub that doesn‘t do Internet. So I can only control it via bluetooth on my phone or via Zigbee remotes inside my house. It is of course still possible for someone to literally drive to my house and access these devices but at that point, why would you do that? A malicious actor could just as well just break in and have physical access to all my stuff.

[@valghyna7668]

Good idea

[@itsawill9268]

That’s cool a private smart home would be sick

[@lemax6865]

Access to your phone gives access to your smart home, then.

[@lukedavis436]

@@itsawill9268 that's what those "homes of the future" did from the 2000s,

[@kenfrench6301]

Cool

[@markarca6360]

Place your IoT devices in a separate VLAN (ingress traffic enabled, no egress traffic for all devices except cameras). I had Location Services disabled unless I am using Waze or Google Maps while on the go.

[@vivaene]

you need to bridge the gap and start using paper maps. reject modernity

[@markarca6360]

@@vivaene Just make sure they are the latest!

[@HermanIdzerda]

Solid advice. One thing: why use cameras at all? Over here the burglars smile and wave to your cameras before emptying your house.

[@Shuroii]

@@HermanIdzerda Here we get a bonus on insurance if we have cameras. More importantly, to get extra money from this, you could talk to the police and show your footage so they open a case and if the thief gets caught you get a fat bonus to replace the things they stole.

[@markarca6360]

@@Shuroii Yes. You cannot prove a breaking and entering/theft to the 👮‍♂️ without any hard evidence (in this case, CCTV footage). It can help in identifying the culprits, too!

[@dagamo6019]

Your room looks cozy. Your cable management not so much.

[@moonrocks7681]

genius and madness are closely linked. -Osama bin Obama

[@finnk1289]

I also highly recommend Techlore, a privacy community that's relatively unbiased, entry level information and as you said on Odysee - they're committed. Great information you can send to your friends and they'll understand it

[@WhatWillYouFind]

Great video. Proton is a great product and service provider even if this video is warning against it "at face value" I got the free account from proton and their vpn a few months ago. I have had 0 activity on that account. I do trust that the encryption is working, because it has remained completely inactive. I am surprised it hasn't been sent any spam yet. I hope that someone doesn't find Proton to be nefarious because I would actually like to transition my email life onto the service just for sanity of avoiding GOOGLE. If a service is being honest about the product at face value, I would like to support that company, there are too few of them these days.

[@michaelgaddajrfi9192]

Always solid. You and the hated one are a godsend. One day I hope one of you can do windows hardening or digital forensics. I'm having a nightmare windows hijack that no one can solve other than cry clean install. Great job keep it up!

[@sumkindacheeto]

I read it at first like "windows hardening and digital foreskin" lol

[@MickenCZProfi]

Hardening Windows is like being naked and optimizing your hand placement so that other people see the least amount of your privates instead of just picking up clothes. Try out GNU/Linux, I recommend Linux Mint for desktop and Debian for servers.

[@holo525]

If you really need to use Windows then just torrent a copy of LTSC Windows (corporate windows thats JUST the OS and no candycrush etc..)

[@valghyna7668]

@@MickenCZProfi I'm quite happy with mint 20.3. Dual boot but I rarely launch windows anymore

[@MickenCZProfi]

@@valghyna7668 Great to hear! Glad you're happy.

[@AstoundLikesWoW]

You know when you listen to someone's voice for hours and hours and you have a picture in your head of what you think they look like? I was wrong. 😂

[@raffandbotnik]

Thanks for making these videos. You're one of the only channels (or even the only one) on youtube that teach people how to protect their privacy correctly. You're one of the only people on this platform that know what they're talking about in great depth. It's amazing to know there are still people, passionate in tech, wanting to help, or entertain people. I agree with this video alot, and it exposes the way people can get tricked into believing shils, or just accidentally do things that will hurt their privacy only because they aren't knowledgeable. People all around the world should know that nothing is safe, and that big tech isn't their friend, without any requirement of knowing how tech really works. Unfortunately, it seems like we're being taken advantage of by them just because we don't really bother to learn about these things that take a while to understand. Not alot of people have the time to set up their own email server, as an example. But it's good that awareness is being raised.

[@pcislocked]

please keep going daily man, i really love listening to your podcast-ish videos while commuting

[@incredibility3173]

Thanks a lot Mental Outlaw. I've been watching your videos for the past few months and I can say that I've sort of had no idea how to improve my security and approach on browsing and using the internet, and these videos help a lot. Can't wait for more. Also - deepfake looks great.

[@lordkroak6670]

I prefer to live in a cave and grunt at people than live in the techno world

[@staciefreshener4032]

" Cloud is a fancy word for data stored in someone else's computer " This opened my third eye and send billions of worrisome electrons into my mind knowing that I backup my most important personal passwords , documents and what not in Google drive and such The reason is , my HHD and SSD gets virus often and sometimes Auto corrupt files I have disk crashes and sometimes the data is just inacessible and even if I got the best HDD or SSD I want my data to be really safe Cloud is my best bet. but they're also same . Just another person's data unit I know it but I still trust it Cloud is a fancy word ? , [more like deception] because normal people had so much difficulty understanding the word. Make words simple for everyone. I like complicated stuff and I do feel sour when it's too easy to learn but everyone need to learn stuff and simplicity is the way " another person's computer HDD " is the easiest way to describe cloud rather than all that text book , and internet vids we watch and confuse ourself sure theyre important 100% too , but learn the Stair climbling ways step 1 , step 2 and such. Cloud definations or any technical definations are so much complicated due to technical words. making it simple then finally telling all would be better.

[@artisticendeavors5076]

You are one of the most intelligent techmen online. Why you don't have millions of subscribers is mind-boggling!

[@Zordiak]

I think for the web it's better to have some centralization because it allows the features of browsers to move forward faster. We update one codebase and all the browsers get updated. This is great for new features in Javascript. Native typescript, preprocessor support, etc. So long as it's open source. You could say the Linux kernel is centralized and it's better to decentralize the linux kernel, but I think for some things, decentralization creates more problems than it solves.

[@catcatcatcatcatcatcatcatcatca]

I wonder if private privacy consulting could be an option for future. For example securing browsers, setting up self-hosted cloud and email-services (and updating them), setting up password/account management and just general mentoring could be actually more trustworthy system (you trust an individual expert who most likely can set up the systems up so that they can’t even themselves access all the data). Many people don’t have the time, but have interest and money - no way around that. I would also love content about bulletproofing firefox. Simple guide would be much appreciated, for example I have trouble setting up user-agents and containers, and honestly have little idea how to even properly make use of the option.

[@KSherwoodOps]

I still have dbox because so many people i work w have it but i use cryptomator on all my folders so ends up being a decent solution yeah?

[@KillerOfU33]

It's funny that you posted this video to KZbin. The irony isn't lost on me lmao

[@rh906]

Since I am currently in a place that actively blocks OpenVPN, I stopped spending money on a VPN and just made my own proxy server using tech the place can't quite block.

[@RedSntDK]

You can't wiggle your way through one of the open ports? I recall using port 443 TCP when I was at school to get a line through back in 07-10 when I was at a school that was fairly strict. Not sure how widespread HTTPS was back then since it didn't cause any problems, but it worked perfectly for me. I just mailed the service I used at the time (I believe it was StrongVPN, one of the earliest VPN services around according to wikipedia), had them change the port for me, and sent me a custom OpenVPN config file.

[@rh906]

@@RedSntDK China is a lot more sophisticated then that.

[@Dr_Larken]

Holy crap! And I mean this in a good way but definitely not the character I imagined every time I watch your videos!

[@angelenriquechavezponce1629]

You'll get used to, he's a cool guy and I do appreciate his content.

[@Nirossen]

What do you mean?

[@asssssssssdawdadw]

@@Nirossen he buff (i think that's what he meant) and beard (looks like a chad)

[@angelenriquechavezponce1629]

@@Nirossen you know he's a buff guy you'll normally expect some goofy hipster guy. Idk that's what I thought of him without camera

[@gl4989]

This ain't a face reveal chief

[@bigshrub45]

Mogged us with the cornercam

[@draabuu]

Regarding email, correct me if I'm wrong, but having a self-hosted email is not enough if the second person is using, for example, Gmail.

[@dom5]

You’ll be absolutely fine if you configure your DMARC settings correctly and your server IP is not listed on any blacklists

[@elijah3487]

Switzerland is not in the EU. It is a country in Europe but is not and has never been part of the European union

[@some1and297]

The two endgames of being a privacy minded individual, A) getting a CCNA and managing all of your own infrastructure or B) going Amish and smashing your router with a rock

[@chrxstt]

Thank you for talking about a smart buttplug as my mom walked into the room 🙏

[@giantchamp415]

Best video I seen on this subject in a long time. Very informative and your intelligence on this subject is obviously very high. KZbin shity algorithm never recommends your videos and this is exactly the videos I like. I shit like "The Slap" videos made by everyone instead of videos when finished you feeling a bit smarter than before. Much appreciated

[@evanwilliams8908]

Drake is so tech savvy! 😍😍😍

[@hbhealthandsuch6179]

Thank you. really needed this. I especially am outraged by how email is so necessary in todays society, yet its impossible to make it truly private. Except with a private mail server setup. Ive given up on phones until something like pinephone or the like may get more developed, so email or an equivalent to it is the only hope to me at this time. I dont want to trust any providers if its avoidable either at all. I would really appreciate some ideal recommendations for what i would need to study and programs to use on a raspberry Pi or the like, to finally achieve true, idealistic email privacy... adding nextcloud or another OSS cloud setup to a physical private raspberry pi email server system would be even better. im not trying to be overly idealistic, i just want to achieve a true aim to go for, which can be hard to get informed of in all the chaos. ... i would isolate browsers and only use java free Tor for non-traceable coherent searches etc, and then look for browsers to use for other purposes.. but is it possible to avoid java or play it in a way that it cant track, consistently/relativey conveniently ? thanks again for the video. Blessings

[@tanmaypanadi1414]

Man at the end after dropping big bombs about privacy. Kenny still tells me to have great day. that's so sweet of you.

[@prodsweezy9507]

love the content, constantly protecting myself more and more, thx for clearing up the VPN situation I am going to do research into mullvad

[@nibbletrinnal2289]

Out of curiosity, how secure would you say *you* are personally on the internet? Are there things you'd recommend to others to keep them secure, but don't actually do yourself? A large portion of this video is dedicated to talking about how you can only guarantee privacy and security by putting in the effort to self-host everything, but how much do you actually self-host yourself?

[@bettercalldelta]

In one of his videos where he opened his Firefox (or whatever fork he was using, might be Librewolf) profile manager, you could clearly see he has a "public" profile where it's good opsec but not really, like where he uses social media, and there are hardened profiles that actually use all of this advice

[@saikerzlol]

im not much into tech or IT, but i love your videos bro. keep fighting the frontlines!

[@cxob2134]

the best cloud is an old laptop with some additional hard drives on it to mirror your files to. It has a build in power outage protection. I just put mine in the attic an connect to it via SSH and SFTP and dump my files on there, and if i need a backup to roll back, i just grab it form there. No Cloud needed. No spooky software, just a simple Linux server.

[@theminer49erz]

Thanks this was a nice thing to share for those who dont know enough. Even if they cant do what one probably "should", at least they will know where to be cautious and maybe even be influenced to learn more.

[@Examoon]

Its also important to use a sim card lock so you can make iit significantly more challenging for sim card theft

[@mdrdprtcl]

When you told us not to play Raid Shadow Legends, you gained my trust as a KZbinr 😂 👏

[@JodyBruchon]

Remember that if you use a VPN and you access a website...your browser sends that site's cookies back to it, so the site knows who you are immediately. There are tons of ways VPNs don't help at all. VPNs are great for torrents though.

[@beardalaxy]

there are 2 uses for VPNs: 1) to hide what websites you are visiting and who you are connecting to (in the case of p2p) from your ISP (this is why it's good for torrenting) 2) to view content from a different country (if you live in germany and the youtube video is blocked in your country, VPN over to somewhere else) it won't protect you against big tech collecting info about you if you're logged in to their service anyway. the only thing that will get confusing to them is that you appear in multiple different countries. if you're logged in to an account, they still have your watch history, maybe your birthday so they can tell how old you are, perhaps your gender, and even just those three things alone are super useful for ad companies or really anyone looking to see analytics. it's even good for youtubers themselves so they know who is watching their channel and who they should be catering to. those things have nothing to do with location.

[@JodyBruchon]

@@beardalaxy Don't forget that the DMCA takedown notices go to the VPN provider instead of your ISP.

[@0xshaheen]

OMG you are a monster, you made me wear my sunglasses to watch the video

[@CatAvGuy]

Regarding the point at 24:30, it bears mentioning that other options for fediverse software that are cross-compatible (for federation purposes, as the relevant ones all use the ActivityPub API) with Mastodon can often be a better fit for particular use use cases. Pleroma (for example) is both lighter and easier to set up, if you or someone you know wants to run an instance on the cheap, and Pleroma instances tend to be far more based. Not that it necessarily matters which software you use on that front since you are able to freely associate between instances as long as you know where to find your type of people and nobody has intentionally interfered with the ability for either server to federate.

[@tbhidk8903]

the fact that this channel is still up concerns me that maybe the companies that rule the online and entertainment environment aren't so bad after all... or maybe they're doing this so we think this way... well they're allowing such libert of speech and not taking corrupt actions this time so guess that's a point for them. or maybe the channel just isn't that popular atm to get their attention

[@Kittysuit]

youtubers (and other social media figures) like to overreact a lot. when something happens to them (eg. being "shadow banned") usually means something else is at play. the fact that mental is nearing 300k should mean a lot. there are many more channels like him that are also growing steadily. big tech is problematic, and they are definitely trying to influence the way we think and see the world (on top of a plethora of other bad things they are doing behind the scenes), but they arent "as bad" in certain aspects as some people make them seem.

[@proloycodes]

he got a temporary 2-week ban bruh. so big tech IS bad.

[@AuroraAce.]

any channel that think KZbin cares about them positively or negatively has either subscribers in the multi millions or are full of themselves

[@golvellius6855]

Dude thank you You made me fall asleep your voice is soothing and relaxing. Thank you

[@StiekemeHenk]

Block JavaScript, it isn't that bad. Only allow the main domain's page to load JavaScript and block all else, if it doesn't work, enable a few till you find the one that's required. How often do you visit brand new sites? And then it's just 10 seconds of your time for the most functionality and privacy. Also randomize your user agent, some sites have issues but just select windows, chrome, firefox and it should be fine.

[@hbhealthandsuch6179]

thank you.

[@adriatical9016]

Man your southern accent really is awesome.

[@wishub]

imagine if there was a service that would sell your data and you would receive part of the money...

[@BuenoMcgurski]

But what happens when you show up late for one week in a row because you just forgot to turn on or bring your devices with you…? 🧐😕🤫☠️

[@wishub]

@@BuenoMcgurski I'm taking about an online service that collects your data and usage statistics and sells it then pays you part of the sum

[@bonk2935]

@@wishub i mean isnt that what swagbucks does, kinda?

[@Wyowanderer]

Holey buckets - there's a LOT more to it than I thought. Thanks.

[@thingsiplay]

"We are Scharlatans." ~ 2022, Mental Outlaw, probably a KZbinr

[@teacon7]

Could you walk us through looking at source code, showing examples of what to look for in terms of security issues? Failing that, where do we go to hear discussion about a particular program's source? Ultimately, you can't have digital liberty without the virtues to keep it. "Learn what you're doing, don't just throw money at it" is great advice in any age. This is a high quality video, and I'm glad I watched it. Thanks for making these - keep 'em coming. :)

[@fullscale4me]

I graduated from tech school in the mid-'70s but still keep up on modern tech because I use it! Don't shy away from boomer bashing as many of them have 2nd/3rd/4th hand 'really good tech tips' to share that are a lot like the things that the article hyped. They need to be reset to reality. A retired F100 email server support guy.

[@tanmaypanadi1414]

Hiding in plane sight is the only way . become part of the bot net .

[@victorhugo-wo2ci]

Cam deepfake outlaw looking crispy clear today

[@viktor133100]

What's even harder than setting up your own mail or xmpp, is getting other people to use it or making it work with tech conglomerates (eg sending a mail from your own server to gmail)

[@Don_XII]

appreciate the tech videos, but more foss cooking videos when?

[@MentalOutlaw]

I'll probably grill some steaks soon

[@duckmeat4674]

@@MentalOutlaw foss workouts please too!

[@Channel-he5fr]

How can you claim https is secure - only post data is even partially obfuscated. A get request contains all data in the header. Your browser, ISP, domain authority, and VPN all have access to the request. Most importantly the receiver and sender. Req.URL on KZbin tells the ISP what video you are watching

[@SCTproductionsJ5]

That point at the end about not being able to throw money at the problem for a simple no-thinking solution pretty much sums up what's wrong with boomer logic.

[@rexrip1080]

Thanks for feeding into my paranoias, it is appreciated! btw, just started using win 10 enterprise, I really like all the access. I don't own a company btw... Everything can be found or figured out if you look hard enough. Learned a bit about kernel level access in anti-cheat software so a good portion of online games are out of the window as well, every Ubisoft title as well, even the single player. It seems that things are getting more and more dystopian all the time, I am currently tied to Unreal engine for my work but will get a "working" computer and a "fun" computer that I can mess around with. Anyways, thanks for the heads up on what to watch out for!

[@No-uc6fg]

Can't wait for this video to get flagged and demonetized like all the other privacy videos you have, keep fighting the good fight, man.

[@DanteLikesRock]

nice to see Drake giving us privacy tips ! ^^

[@yandere8888]

i really dislike people using "politically biased" instead of saying what the thing is actually biased against the GPL license is politically biased too, doesnt make it bad, makes it good actually depends on how they're biased and who against

[@gabrielecocino8998]

Thank you for sharing all this knowledge with effort (and humor too)

[@Zaptosis]

For a bit I was like: "Wait I'm a good KZbinr, but I advertise VPN's" But then you make an exception for creators with Odysee, instant relief. Also I advertise WeVPN, & their affiliate payout is garbage, but they got good privacy policies & I personally use them. Tom Spark's VPN tier list is how I found out about WeVPN.

[@RemotHuman]

vpn outside of 14 eyes that builds a name on privacy is still a lot more trustworthy though than the big ISPs

[@P1T4Bot]

Any recommendations?

[@yeahgirl11]

@@P1T4Bot I would like to know too!

[@arminiusthehibernian7282]

@Mental Outlaw- IOT's end game begins with *rationing of services* . It get's worse than that but we have to see. I see the plans but this is like an equation. The more people know about this, the more they change their habits (shun the oh so easy conveniences). Great work and I love your channel. One thing about the Ukraine situation-it's very much like *Wag The Dog* .Very few know that about 9 million Ukrainians have either gotten, signed up for, or are in some process of getting digital, biometric IDs that have their entire history on it. This is way beyond privacy-

[@neverquit2923]

The new facecam looks great, keep up the great work. I have learnt so much from this channel

[@okamiboi]

Nice new background green screen Luke, keep it up with card points purchases and maybe you'll get that new kawaii Luke-kun VTuber model you've been craving.

[@oglothenerd]

The only free service that is safe and not 'selling you' is Linux.

[@peytonishere]

Or any open source software you can host yourself

[@oglothenerd]

@@peytonishere True.

[@Erik-cv4tm]

Very educational. Thank you!