The Irony of the Dunning-Kruger Effect

Examining the irony of the well-loved Dunning-Kruger effect. For further resources, see below.
Sources:
* The original study: Kruger, J., & Dunning, D. (1999). Unskilled and Unaware of It: How Difficulties in Recognizing One's Own Incompetence Lead to Inflated Self-Assessments. Journal of Personality and Social Psychology, 77(6), 1121-1134.
* The mentioned 2013 study: Simons, D. J. (2013). Unskilled and optimistic: Overconfident predictions despite calibrated knowledge of relative skill. Psychon Bill Rev, 20, 601-607.
* The mentioned 2018 study: Sanchez, C., Dunning, D. (2018). Overconfidence Among Beginners: Is a Little Learning a Dangerous Thing? Journal of Personality and Social Psychology, 114(1), 10-28.
* More information by Dunning: Dunning, D. (2011). The Dunning-Kruger Effect: On Being Ignorant of One's Own Ignorance. Advances in Experimental Social Psychology, 44, 247-296.
Pictures taken from unsplash.com.
Music taken from the KZbin Audio Library:
"Urban Lullaby" by Jimmy Fontanez and Doug Maxwell
"Hedge Your Bets" by TrackTribe
"Steel" by RalphReal
Created with Adobe Audition, Adobe Premiere Pro, and Adobe After Effects.
Chapters:
00:00 Mount Stupid
01:32 The Real Dunning-Kruger Effect
04:56 The Irony
Not that there is much to be seen, but I do have a Twitter account: / vallisyt
Video No. 1

[@deluxeassortment]

The irony of the Dunning-Kruger effect is that once someone learns of it, they immediately feel immune to it.

[@doctor8859]

I am immune to it, because I always assume that I'm stupid no matter what so, _lol get rekt noobs_ /s

[@mlem6951]

@@doctor8859 i know this was a joke, but this hits home xD .. i wish i had more confidence in fields i know well. But i'm working on it

[@annoloki]

It's been used politically, esp in the UK & US since people voted the wrong way in free elections, so it has provided reason to "scientifically" justify the dehumanisation of a group of people... dehumanisation of the "opposite people" always creates an inverse dehumanisation of the "us people" without having to argue or demonstrate it in any way. When I say "they are dishonest", I give a little nod to my brain that it can just go ahead and assume "we are honest" without me having to actually say that, which might then call into question whether I can actually assert such a claim... ya know... honestly. By pointing out all the "bad" things about the opposite people, I get all the benefit of thinking I'm the opposite of those things... by setting "them" up to be the opposite of me. Saying "women are emotionally driven" is true, as women are people, and people are emotionally driven... but by saying "women" instead of "people", the instinct is to infer the implication that men must therefore be more rationally driven. Of course, this is a logical fallacy... mutual exclusion does not mean opposite. It's also like how more than 50% of people believe they are above average intelligence, something pointed out by people talking about confidence biases... of course, it's easier to become much lower than average than much higher (just drink from lead pipes!) so the average is probably actually below the median, so it wouldn't be out of the question for more than 50% of people to be above average

[@conception3509]

@@annoloki that was a good read, I'll keep it in mind in the future.

[@molikeur]

@@annoloki backing up last comment speech 100

[@AbhinavPt]

Now I know everything about Dunning-Kruger effect.

[@bubbahottep8644]

Well done.

[@terpsidance.]

The more I know about the Dunning Kruger effect, the more I think about nightmare on elm street

[@pulidoggy]

@Abhinav Patra You "know everything" as long as you're able to correctly assess your knowledge... 😉

[@deisk2707]

Let's be real. We are still confused

[@blinded6502]

But what if I tell you there are infinite amount of universes where Dunning-Kruger effecr is different

[@lostinc6791]

The best thing I've taken from this effect is to NEVER assume malice, always assume incompetence first.

[@Lukearthwalker]

That would NEVER work in today's political landscape... or the corporate media... or the pharma / medical industry... or big tech... or (insert mega) business here.

[@arghapatra8771]

something similar to occam's razor

[@matthewtoasty]

@@arghapatra8771 Close! That would be Hanlon's razor. Occam's razor is that simpler, more probable explanations are better to be assumed over less probable ones.

[@petebateman143]

That's where ego comes into play. Some people will accept they're wrong and correct it. Others will refuse to admit they're wrong regardless of the damage it's causing.

[@phylocybe_]

All that this does is allow genuinely evil people to get away with their crimes. If you always just assume they don’t know any better then they will continue to screw you over and you’ll never stop them.

[@DaveDDD]

The real Dunning-Kruger effect was the friends we made along the way ❤️

[@theoforestier8766]

The friends we made along the way can speak for themselves, they know who they are

[@sophiasimmons9613]

I love this comment so much

[@milefiori7694]

Ah yes, a sequence of ephemeral pictures of our past selves making stupid mistakes.

[@disappointedbutnotsurprised17]

Lmao 🤣🤣

[@tnsquidd]

Mabye the real dunning Kruger effect was inside of us all along 😔

[@SomeTomfoolery]

This phenomenon makes a lot of sense if you understand the Dunning-Kruger effect. See, since no one truly understands the effect, they have an enormous amount of confidence in their flawed understanding of it. Just like the graph predicts!

[@AP-yx1mm]

So it's a self-fulfilling prophecy?

[@FelonyVideos]

That's exactly what I would expect someone like you would say.

[@michaelgarrow3239]

I see what you did there… 👍

[@bietola75]

You are clearly mistaken. See, I myself read a lot analytical psychology and psychopatriachy in my spare time, so I know that your understanding is flawed. I am not confident about my claim, but that in itself is proof that I have a more nuanced perspective. You know, you should read about the Danny Kruger effect. Then you would know that your confidence says a lot about you really (I laugh)

[@lucapratorubilar4631]

@@AP-yx1mm mnl

[@MrAwombat]

“My ignorance may now be more elaborate” that is an excellent quote.

[@KDreezy]

Perfection :D

[@docpayce1]

XD Yeah, that is gonna be my go-to catchphrase for 2022. Love it.

[@MrLikon7]

- Charles Bukowski

[@jenm2251]

Loved that part. Video would've been more of the same without it.

[@alphabravo8703]

yup

[@jayc222]

I always took the “mount stupid” curve to be more of a general illustration to explain an abstract concept than a literal graph tied to actual numeric values.

[@Chiaros]

Yeah, I think of it as the same graph shown in the video - just expanded

[@zepperman2679]

yeah, never once thought of it as a hard graph. It represents the confidence taken in by beginners of a new subject and their ability to perform well followed by a realization there is far more to understand than initially perceived. People who are hardstuck low elo in games will think they deserve a higher rank while being at the bottom of the barrel of skill level are the epitome of Mt. Stupid, and the drop down is a hard one to take. My own dad who lost hundreds of thousands in the stock market thinks he gets to say and thinks whatever he wants about it and believe he's right. I also think the study Vallis presented in the video is flawed because people are specifically asked to gauge what score they got, and most will feign modesty. In a real world situation though with high stakes, people will cloud themselves with confidence believing everything they do is right due to their inability to live in uncertainty, and when things do not go their way, it is always due to forces outside of their control. The Dunning-Kruger effect is hand in hand with narcissism in other words, and overcoming narcissism isn't something that can be statistically measured on a performance graph since people can still improve or perform well while being far up their own ass.

[@plastictouch6796]

I don't really think the curve applies in most situations. Like just because more knowledge creates more questions doesn't mean that people without the knowledge are going to be confident and think they know everything. And in other areas like math once you know 2+2=4 there really isn't much else to know about 2+2 you just know it equals 4 and can be confident in that fact. It is really more situational and about mindset. Let's sayPerson A read a book about the history of the Roman empire and Person B is a PhD in the history of the Roman empire. The PhD is going to take into consideration that most of the things we know are based on speculation and incomplete and biased and that they could be wrong because not everything gets written down etc. While the person who read a book is going to simply take everything at face value. Person A is just consuming pieces of knowledge that have been discovered and are generally accepted whereas person B is on the cutting edge and trying to find out more. Person A is going to be confident because they are operating in the sphere of what is known and person B is not going to be as confident because they are operating within the unknown.

[@plastictouch6796]

​@@zepperman2679not everyone in low elo thinks they are good, people will simply say they are "hard stuck" to protect their egos when questioned about it irl, nobody wants to be made fun of. In reality most low elo players have self esteem and confidence in the dumps, that's why they are so toxic. Also, because the match making system is designed to keep you at a 50% win rate and at low elo when you win it's usually because you were the one to snowball and carry and in low elo if you carry a game you carry it hard since it is very much a snowball based game. You always feel good at the game when you are ahead. There are also a lot of griefers and trolls at low elo, so if you are taking the game seriously and let's say beating your lane opponent in the top lane or going even, but your bot lane is trolling you aren't going to focus on your own mistakes that game, you are gonna see your own score was positive say "see I'm not that bad, it's just that the bot lane fed." and move on to the next game hoping for "better luck".

[@Sage-us7oj]

⁠@@plastictouch6796”once you know 2+2 = 4 there isn’t much more to learn about 2+2 you just know it equals 4.” This is incorrect. There are whole areas of math, like analysis and number theory, where the very first thing you learn is a rigorous definition of addition. In other words, you have to give rigorous proof that 2+2 = 4, not just assume it is true. In math there is always more to analyze behind the simplest of claims. And they are often the most advance proofs because you have so few principles to build upon.

[@Elriuhilu]

I've always thought of the Dunning Kruger effect as being that both people who are incompetent and people who are hypercompetent feel like they're of average competence. The difference is that incompetent people don't actually know what it takes to be average, so they greatly overestimate their own skills, whereas hypercompetent people know the difference between competence and incompetence, but because of their great skill they feel that surely it can't be so difficult to be competent and figure that they likely aren't significantly better than any other competent person.

[@karimitickaeloogreattemlor3486]

That's a very interesting observation. And true for the most part too!

[@tarico4436]

Finally somebody mentioned both halves of the Dunning Kruger effect. People usually don't mention that hypercompetent people find problems so easy to solve that they assume pretty much everybody must also do well with these problems, so--in life--they're constantly overestimating the intelligence of others.

[@honghaohuang8766]

As a researcher in the field of psychology, word of advice: almost never believe so-called “psychology finding” on internet. Such as left brain for logic right brain for creativity.

[@deidara_8598]

Popscience in general seems to grossly misrepresent/oversimplify the underlying research on a consistent basis

[@honghaohuang8766]

@@deidara_8598 in fact, there are psychologists studying exactly this hahaha

[@floreroafloreril1458]

@@deidara_8598 I mean, it kinda makes sense, right? The easier it is to share a piece of data, the more it'll be shared, so over-simplifications would logically be more "viral"

[@cyberneticbutterfly8506]

I eagerly await advances in neurology and cybernetics so that we can become intelligent enough to make better judgements about this. Like an anti-bias chip that also compansates for us needing some of our biases to feel fully human and only cuts away a small part at the worst excesses of our nature. Or an anti anger chip that doesn't remove all our anger just the worst 5% of it for people who want to adress their anger problems. Same with orderliness etc.

[@overloader7900]

Funnily enough our school psychology teacher believes in astrology and left/right brains

[@TigerTzu]

The dunning-krueger effect is essentially that if you ask people to assess their own performance relative to their peers without telling them how their peers performed, people are biased towards assuming they fall closer to the average than they necessarily do. The thing is, this is actually perfectly rational. If you don't know how well your peers performed, then the "least wrong" answer you could possibly give is "I did about a average." If you assume you fall into the 50th percentile, the most you could possibly be wrong is 49 percentile points. The farther your estimate is from the average, the greater margin for error you open yourself up to. Having said this, most people will err on the side of assuming they did a little better than average. This is where ego creeps in. Even still, the DK effect may look like the poorest performers have the most arrogance, but really they're only about as biased in their own favour as anyone else, they just happen to be more wrong in this instance.

[@altergeo5322]

You just threw me in an existential never ending rabbit hole. fun.

[@altergeo5322]

@@blakejohnson3864 I'll tell you how they aren't: enough

[@dairyqueue]

Well said

[@satsubatsu347]

@The Grud I really enjoyed your analysis.

[@BartdeBoisblanc]

@@altergeo5322 I pictured a rabbit jumping into a portal and popping out the other end only to enter the original entrance and repeating ad Infinium.

[@pignebula123]

I think Mount Stupid is still a useful construct in that it is a way for people to remember to temper their confidence on subjects in which they are beginners.

[@goodboi1725]

Definitely makes things easier to learn when you actively arent being a bitch to the person teaching you. Instead, you take your time to see whether or not the thing youre learning isnt bullshit instead of jumping the gun

[@justindie7543]

Is that really helpful though? Perhaps there is a reason we all approach confidence this way, such as fitting in better with the group or achieving better social positions. I've certainly felt the urge to overstate my confidence when I secretly have doubts in order to avoid ostracism. Perhaps tempering confidence is a good idea if you are a scientist, but I don't see how it helps in other scenarios.

[@goodboi1725]

@@justindie7543 prime example: politicians

[@gengis737]

It's not helpful to describe beginners as overconfident to the point of stupidity, when they are not, or not to that extent. One of my teacher said "There is no such thing as a stupid question".

[@theeclectic2919]

As a student, when I begin a class, I assume I know nothing.

[@CB-lh4ph]

I really like that line at the end. "My ignorance might be a bit more elaborate." Very well said

[@Maddog-xc2zv]

with a lot of conficent in such a seemingly innocent short sentence.

[@michaelkidd969]

I was coming to highlight that same line, it’s very well said

[@ivankaramasov]

Still the "mount stupid" curve fits very well my own experience when learning a topic. Confidence grows much faster than actual knowledge before it starts to sink when you realize how much more there is to know. I think this is a general pattern and quite interesting in spite that calling it Dunning Ktueger is inaccurate.

[@VallisYT]

True! Like I said at the beginning of my video, I have had similar experiences which is what initially attracted me to the Mount Stupid graph. As the study by Sanchez and Dunning shows, there is some empirical proof for the graph, so it still has some merits as long as you don't confuse it with the Dunning-Kruger effect :D

[@xxportalxx.]

@@VallisYT perhaps it's a mislabeled graph of the error value of one's self assessment. I.e. the lowest scoring individuals would be those who can't answer all the questions (or have to guess) and therefore are painfully aware of their incompetence, those that can answer all the questions overestimate how many they get right, those with avg scores correctly self assess, and those with above avg scores underestimate their ability. If you scale the graph of the error from the original dk it would roughly fit if extrapolated a bit.

[@your-mom-irl]

I think that's bound to happen only a few times in one's life tho. If you study mathematics, history, chemistry, Seinfeld episodes or whatever, at one point you'll realise that you are overly confident as a beginner and stop doing that. it would be weird for someone to think "hey, i was overly confident with all these topics, but i'm sure Economics is gonna be different!" There's a meta-dunning krueger curve somewhere in platonic ideal forms-land that explains what i just said

[@altergeo5322]

Maybe that confidence you speak of actually sparks from the excitement of learning a new topic. The signals in our brain are probably the same. The excitement naturally decreases as time goes by, and takes our confidence along with it.

[@ArgentavisMagnificens]

@@your-mom-irl exactly what I was thinking.

[@richardhorn7688]

I envy this creator in being able to eloquently narrate this video in a second language to perfection. Impressive

[@VallisYT]

Thank you Richard, that means a lot to me :)

[@PunCala]

@@VallisYT Great video, just a slight correction on your pronunciation: the "p" in "psychology" is always silent. Other than that, great job.

[@user-vd1gm2sm2t]

@@VallisYT big plus for this. You should be proud of yourself. Looking forward to more great content from you.

[@ianmoore5502]

An important topic to be crystal clear on! And he did swimmingly!

[@danielnewby2255]

@@VallisYT I'm a native speaker and I didn't realize you weren't until I saw this comment. This was an exceptionally clear presentation. Enunciation and pacing were absolutely spot on for KZbin-narration format presentations.

[@purrcatharsis]

There are numerous other problems with the original study. The setup is a bit confusing, because the participants had to rank themselves *against their peers in the study* and their scores are not absolut, they are *relative to their peers in the study*. The actual scores were never published. So you cannot just assume that the participants with the lowest *relative* score actually scored low in *absolute* terms. Which is actually unlikely, given that they were all students of the same university and courses, meaning they had to pass the same entry exams. What the studies in the original paper actually showed was that everyone figured themselves to be above average in ability. Also consider Regression to the mean.

[@thomasmclean9406]

You make a very good point

[@tricky778]

You mean everybody figured themselves to be above their estimate of average, to be clear?

[@stopdeplommoninmeikweetdat9670]

Thank you for typing out my thoughts, saves me a minute or two. :P

[@user-lz3vf7ou9t]

Why not just cite Moore and Healy (2007)? Lmao

[@drkrishnap]

Please read about percentiles. It itself just means that it is relative. Absolute score doesn't matter. For example, if topper scored 10 in 100, is not because he is dumb. That's why they took percentiles.

[@jermyc7982]

I don’t think that the people who overestimate their competence are stupid, and are just misled by how fast they learn the basics. From my experience in learning guitar, when I learnt the pentatonic scale, I felt like a true wizard, only to realise once I hit the intermediate wall, that it was really easy in hindsight. And I think that intermediate wall is when people start questioning their competency as they are no longer making progress as quickly as they did in the beginning.

[@meowl2396]

I would like to point out that the way you explained it, the best students did not underestimate their performance but instead overestimated the performance of the other students, which is a big difference. I would have been interested in their answer to the question "How many questions do you think you answered correctly".

[@OliverJazzz]

This is a quantitative analysis, so that kind of data would be more tricky to handle, since it would depend more on the actual content of the test, and would actually measure a different thing all together.

[@UB3r31337HaX0R]

They actually did address this somewhat in the original 1999 paper. For the logical reasoning test, participants generally accurately estimated the number of questions they answered correctly. For the grammar test, poor performers overestimated the number of questions they got correct, while top performers underestimated it.

[@ccost]

it's also possible that the worst students just underestimated the others and that everyone just thinks people are more similar than they are

[@HazhMcMoor]

Yeah dividing it into quartile of student instead of absolute number of correct answer i think weakens the video's argument

[@monhi64]

@@UB3r31337HaX0Rwait… this is really getting so confusing. Wouldn’t being in the top performer group sort of statistically force you to underestimate your own predicted score. Since you did the best you literally have the least room and opportunity possible to overestimate. It’s a bit of a hard concept for me to explain in words, but I’m hoping you guys can tell what I’m trying to say. I know there are ways around that with proper research and testing/scoring but then we circle back to whether the original study was reputable at all 😂

[@benjamingoldstein1111]

Strange, I only heard of the Dunning-Kruger effect in terms of relative overconfidence when people are incompetent at something. Until this video I never heard of 'mount stupid.'

[@VallisYT]

I guess you can congratulate yourself then for not being fooled by the Mount Stupid graph :D It's good to hear that at least sometimes people are informed correctly about the Dunning-Kruger effect

[@meikhochakre3309]

Same case here.

[@KaiiAyrenNevaeh]

@@VallisYT I always knew mount stupid curve as learner's confidence curve with experience and confidence on each axis, and the DK I knew was the correct one so I was surprised that most people correlate them, I still don't understand how I never knew about this since a quick search clearly shows that it's a prevalent misunderstanding and it's not like I've never seen videos where DK or the other are mentioned.

[@KyriosHeptagrammaton]

Yeah the whole video felt like a bit of a strawman. I've heard it Dunning-Kruger used a lot, but never as the mt.stupid thing

[@danm8004]

@@KaiiAyrenNevaeh the word you're looking for is conflate, not correlate. Another common mistake.

[@Sawta]

I think the thing that worries me about the take away from the misrepresentation of the Dunning-Kruger effect isn't so much how the information is portrayed, but how people may be prone to interpret it. To sum it up in a very brief manner, it is generally a suggestion of something like, "Quiet people are almost certainly more knowledgeable than outspoken people." The thing is, if you sit back and think about experts in various industries, you will probably come up with examples of extremely controversial, polarizing people who are _incredibly_ competent at what they do, are in no way humble or reserved, but act in that way precisely *because* they are knowledgeable enough to speak with a kind of cutting, brash authority on the matter. In my own opinion, I would argue that the reason why it seems that confident people are "more stupid than quite people" is because confident people make more _noise_ than quite ones. That is, if you speak publicly about a thing, people will have heard your assessment of that thing. If, on the other hand, you say nothing, people will not know your thoughts on that topic. Therefore, the person who speaks is the _only_ of the two that can later be rebutted for presenting incorrect information. You may have an intensely stupid, misguided position on, say, whether people need water to live. However, if you never _say_ that you think water is something that is not necessary in order to live, then no one will have known your thoughts about water, and in turn, will not have formed a lesser opinion as an outcome. I do think this raises an interesting question: "Does that mean, if peoples opinion of you might be lowered by speaking, does that make silence the "smarter choice" to avoid being mocked by your peers?" I think the answer is that it depends. How willing are you to reassess any possible bad information you have? How high is your current social ranking? Are you a manager or subordinate? How well do you take criticism in general? Etc. I think the level of intelligence of knowing _when_ to speak is predicated on understanding the environment and variables in which speaking will impact your life. TL;DR Knowing when to pick your battles is more important than any perceived confidence, or lack thereof, on that specific topic. Silence is not an indicator of intelligence, but can be used intelligently by making good choices, based on various details.

[@guibeck8259]

This, plus it feels good to shove someone's mistake on their face if they're outspoken. It's very cathartic to show someone they're wrong so their mistakes are bound to be much more glaring than a simple throwaway comment done by a quiet person

[@clive1294]

Something worth considering: There are several topics in which I genuinely am an expert (for example, data driven state machines, amongst a number of other topics). I have learned over many years of interaction with both uninformed and supposed-experts that it is best just to keep quiet when one of my expert topics comes up. Why? The people I am in conversation with almost always know less than they think they know, and very often actually know very little about the topic despite being confident "experts" - the result is that they are unable to evaluate my inputs, and will almost inevitably argue the points. Arguing with someone who does not know enough about the topic is pointless - you can't win the argument, because the person can't evaluate your statements, so you can't build a logical argument from stated facts. So just shut up. That's what I do most of the time.

[@Spooglecraft]

fair point. when someone loud fucks up, everyone notices. but nobody ever knows if someone quiet fucks up, because they didn't talk about doing anything in the first place.

[@danitho]

​@@clive1294 I've found the best way to deal with those types of situations is to always bring a source. Those who are uninformed don't usually try to change the situation. They dont think they need to. So when faced with a source of proof, they either have to look it or they will refuse to look it up, but they don't know what your proof is. It almost always works. I used to just stay quiet too, but that is how misinformation gets spread.

[@snuffaluffy42]

My main issue with the Dunning-Kruger Effect is that it seems to suggest there's only one way that people's perception can change with increased knowledge. Namely, I know women (especially in STEM) frequently don't have a Mount Stupid since their Impostor Syndrome drowns it out. There's constant self-doubt that persists from being a beginner all the way through becoming a subject matter expert. Which ironically, knowing about the Dunning-Kruger Effect can worsen, because they assume they would have gotten to Mount Stupid if they were getting better, so they think they must still know too little to even get there.

[@aaronmicalowe]

The irony of the Dunning-Kruger effect is that everyone who thinks they understand the Dunning-Kruger effect is actually suffering from the Dunning-Kruger effect. 😂

[@pushslice]

If I admit to still be confused by it …does that mean I have mastered it??

[@aaronmicalowe]

@@pushslice Honestly I just avoid knowing about it then I can't be caught in its trap. The buzzphrase used to be "strawman", now it's this. It's just used to dismiss anyone that people disagree with.

[@sauercrowder]

I think many people reference it but most probably wouldn't claim to know much about it

[@dIancaster]

@@aaronmicalowe I'm sorry, but you're just not making any sense. Clearly not EVERYONE who claims to understand it is incorrect-- do Dunning and Kreuger understand it? Also, being aware of the effect doesn't "catch you in it's trap". You're not putting yourself at risk of anything by learning about this except to better self-reflect.

[@steviesevieria1868]

@@aaronmicalowe Strawman is more than a buzz phrase. You’re suffering from the Dunning Kruger effect as far as your understanding of this term. Now that I have the humor out of the way, strawman is manufacturing an argument for your opponent, then knocking it down, even though your opponent never made that argument in the first place. It’s a common ploy in political arguments, and any kind of arguments really.

[@dimitriisov1262]

Here is the irony about the irony of the Dunning-Kreuger effect: the original study is widely discounted given its various methodological errors. The original study is very brief so I would recommend reading it to get the first hand source. You will find that the metrics they used to test competence and indeed intelligience were absurd by both modern and 90's standards. Here is a single example. To evaluate a sense of humor they hired "professional" comedians to rate whether certain jokes were funny. The jokes were abysmal, knock knock style drivel. You can't use a subjective quality like sense of humor to make grand assumptions about humor and competence, especially with multiple levels of irony. Many famous comedians today are despised by younger generations of comedians for being hacks that write telegraphed, pandering jokes that still get laughs. They failed to consider that finding some things humorous can actually be more demonstrative of incompetence than competence. The general methods and procedures of the study are not on par with what anyone even remotely familiar with APA standards (or basic experimental design) would consider as acceptable and, as such, most serious psychologists relegate the study to "pop-psychology" trends like the power pose rather than serious work.

[@treesaregreen]

Sheesh. the video describes how the 'DK effect' has been distorted over time, and the irony of people being satisfied with this simplified version that doesn't accurately represent the original research. the comment describes how the research itself, uses methods that simplify the competencies that were measured. Dunning and Kreuger were satisfied with this research and released it, even if it doesn't accurately represent reality.

[@Sumanitu]

And the irony of your comment about psychology is that things like the power pose work for some people because of the placebo effect. This is useless in most of the scientific world. But in psychology, if anything from a power pose to wearing sexy underwear under your clothes gives you a confidence boost, then it is a real world benefit. Unfortunately it can never be quantified by the rules of objective science.

[@spawnofheck504]

What about the other categories? Did they mess up there? (sorry if this sounds rude, I genuinely want to know) :)

[@dimitriisov1262]

@@Sumanitu the placebo effect has no relevance to this topic, you can't become more intelligent because you think you are more intelligent. Also the power pose equaling or under performing a placebo is not evidence of anything because it essentially means that the power pose is masquerading as a completely different effect. The woman who "discovered" it has had her research claims called into question as they are almost certainly fraudulent and also part of what is known in psychology as The Reproducibility Crisis, which everyone who cites psychology should look into.

[@MrPatejl69]

@@dimitriisov1262 I don't know whether "you can't become more intelligent because you think you are more intelligent"(and would love to see something to back up this claim). However, you CAN underperform just because you think you are less intelligent...

[@HieuBris]

Honestly I love the way everything was explained, sourced, and and even questioned (even going as far as questioning your own conclusion). From beginning to end I felt like there was something to be learned, great job!

[@thomaslindroos1667]

The irony is we will all confidently now tell everyone that mount stupid is not the dunning kruger effect without fact checking this video.

[@satortenet]

...and that's why Socrates is still right: "I know that I know nothing"

[@georgejo7905]

and he was executed for proving others were wrong , his dialectic method

[@jthadcast]

one of my pet peeves. a logical contradiction that violates his own method for finding "truth" in a culture of platitudes. after humiliating his patrons with unanswerable questions, he ends the conversation with off-the-cuff feigned humility and pure unironic hubris. no wonder he was executed by suicide. “the art of being a slave is to rule one's master.” -Diogenes

[@Rootsman417]

@@jthadcast I think the quote means "i know that i know 'almost' nothing". Because at some point he realized how insanely complex everything is.

[@jthadcast]

@@Rootsman417 nah, he was a huge prick at the top of the food chain. if you read all his stuff he was absolute trash but was very good at critique, a smart but equally arrogant man of his time. i would love to have heard all his origional conversations and lectures though if only to debate him with apposing views.

[@fredneecher1746]

He was wrong; he knew that he knew nothing. He died from the cognitive paradox.

[@parkerfitzen3609]

Oh my goodness! Someone finally read the actual Dunning-Kruger study before making a video about it! This makes me beyond happy!

[@drbonesshow1]

Keep gerkin' the gherkin.

[@VallisYT]

Admittedly I only read the study after months of telling everyone who would listen to me about the Dunning-Kruger effect while using the Mount Stupid graph to explain it, but I think this has made the subsequent realization of my mistake while reading the study even more powerful :) Since then, I try to be very careful with what blogs and KZbin videos claim about psychological effects before I have read the respective study for myself

[@hermitthefrog8951]

@@VallisYT - so you spent some time on Mount Stupid too? I thought it was just me...

[@MechaWingZero]

Fascinating video! I love that you included the thing about the 2018 study on overconfidence among beginners (which does seem to be a phenomenon) and differentiated this from the Dunning-Kruger effect.

[@oliviastrahan9004]

"my ignorance is now a bit more elaborate" is a gold standard quote

[@davidh.4944]

Yes, this. I have even personally dubbed it DKRF: The _Dunning Kruger Reflective Fallacy_ . That's when a person demonstrates DK, about DK, when attempting to apply DK to others. I think the main problem is that the general concept is (or at least seems to be) so simple to grasp that people quickly come to believe they understand it, simply from hearing one or two abbreviated descriptions of it. They come out thinking they know more about the effect than they really do. And yes, I have read the original paper myself. Although now I apparently have to find and read the follow-ups given here, in order to further reduce my own ignorance.

[@VallisYT]

I really like your concept of the Dunning-Kruger Reflective Fallacy, I think I might steal that one for my future conversations about this topic :D

[@davidh.4944]

@@VallisYT Help yourself. Spread it far and wide if you can. Not only might it help improve intellectual honesty among the public, but I'll finally get my long overdue fifteen minutes of fame. 😜

[@xaviermagnus8310]

@@davidh.4944 So I've been reading this for about half a minute, with all other viewers combined we now need to cut your fame time to approximately -2 minutes. Don't spend them all in one... wait...

[@Redskull1411]

It can be see a lot with the concept of falacies...everyone that hear the "short" version of them believe that they completely understand how they work or his mechanics...but in reality they are more complex and fine tuned that people are willing to admit...

[@xaviermagnus8310]

@@Redskull1411 This is best explained by an old quote I found. I was never so sure of my beliefs on a subject as the first book I'd read. Because of course you only have one set of inputs and rarely where that set fails.

[@Abigail-hu5wf]

I was taught about "conscious competence". The idea being that, when you take any given topic, everyone starts out "unconsciously incompetent" - they don't know anything, and have no understanding of how much they don't know. Then you learn a bit, and you're "consciously incompetent" - you're aware of how much you don't know, and try to change it. You'll spend most of your time here once you get out of the first stage. Then you learn a bit more and you're "consciously competent" - you're aware that you know more than most, and that you still have a ways to go, but you're also aware of how much you don't know and of how much effort it takes to be right when it's so easy to be wrong. Then you learn a bit more, and maybe one day you're "unconsciously competent" - you're no longer aware of how much of a knowledge base you have, and are ignorant of your own lack of ignorance; you've forgotten what it was like to NOT know certain things. However, you're still going to be constantly aware of how much you don't know, but might start to overestimate others' knowledge of your field because you aren't totally aware of how little they understand about your field. I don't think it's the same, but it feels like a parallel line in the field of "estimates of knowledge"? I've met many scientists who have kind of forgotten that, no, most people don't actually know how to read the periodic table, or know what a photon actually is, or understand how cell replication occurs. It's very fundamental knowledge to them, and they kinda forget that it's NOT fundamental to a lot of people. I feel this is part of why the pandemic response failed to connect with some people: many of the explanations were not great, spoken by people who had forgotten what it was like to be ignorant. Ignorance isn't stupidity, either, which is another factor: every very smart person started off completely ignorant about everything. They weren't less capable of intelligence at the time, they just had less to work with. Someone whose life revolves around skilful manipulation of metal is far less likely to care about how to analyse genetic information, so why should we be surprised when they fail to understand how to do that? That doesn't make them stupid, it just means their intelligence is doing something different. I'd love to see my bioinformatics lecturers try to forge a knife blade - they're ignorant of that, too.

[@Maddog-xc2zv]

I guess even old Piaget would greatly agree with you. If we do not feed our brain genetics by itself would serve for nothing, even for an eventual genius

[@ukestudio3002]

What feeds into this Is being generally competent and assuming that competence generalizes out (to all fields.)

[@myentertainment55]

Isn't everyone learns how to read periodic table (aka Mendeleev table) in grade 7 and learns basic organelles of the cell in grade 6? For someone who played any attention in school should retain at least the most basic facts. True, I am chemist and biologist by my education and I indeed forget big portion of high school math (especially geometry), but the most basic knowledge should remain still. I agree with you, I would add that all this big biology professors assume that everyone knows basic structure of specific organelles, their basic biochemistry aka what makes them work. Obviously, they learned in their late teens and continue learning for next 30-40 years.

[@tricky778]

@@myentertainment55 and we see some things like conservation of momentum, of mass (at regular speeds), and others in so many places that we find it hard to understand when someone doesn't grasp things that follow from them. But we can also fail to recognise that the conscious incompetence of someone who is relatively expert can appear to us to be extreme incompetence, as their doubts and rejection of imperfect summaries can manifest poorly in our eyes depending on factors like communication competence, social fears, modesty, etc.

[@dennylekstrom4517]

I've seen 1:38 of the video so far, and just had to paus to say that was a BRILLIANT opening to a video. The fact that the quote is misattributed is just the most delicious irony. Can't wait to see the rest! Edit: Absolutely phenomenal video! It's like a real life representation of recursive code. It references itself and at the same time answer questions by posing more. Earned a sub for sure

[@idontwantahandlethough]

I loved that too. Although tbh probably would have worked better with someone else (if there is an applicable quote by someone else).. Bukowski is one of those guys where you can actually assume the quote is misattributed most of the time 😂

[@SpiritmanProductions]

Flawed or not, I still think the main use of the term has merit. Highlighting the tendency of those with only superficial knowledge of a topic to underestimate the topic's complexity can be useful when setting expectations.

[@ignaciosolana7182]

I'm truly happy finding this smart and well design video. Never read anything about this Dunning-Kruger effect before, but I really like when someone is really critical about the things we can see often in the general consensus. Keep going!

[@VallisYT]

Hey, thanks for nice words :) And I know what you mean, every time I find out that the general consensus is wrong about something it makes me wonder where else it might err. Once I suspected that something was wrong, the irony of the Dunning-Kruger effect was quite easy to discover, yet even in this simple case it took me a couple of days of research to understand how the various graphs and studies all relate to each other. But since I don't have the time to do this kind of research for every conceivable topic, I have to rely on the general (or expert) consensus for most of my knowledge about most topics-and just hope that the consensus is right.

[@bernaridho]

See my responss

[@susanne5803]

@@VallisYT Yeah. Reminds me of the time the medical consensus was that washing your hands between dissecting a body and assisting a birth was an outrageous new concept by some lunatic science deniers. Who ever heard of germs?🎄🖖

[@alexmallen5765]

If you tell people that their self-assessment is poor, that would probably make the dunning-kruger effect even worse, because people would rely less on their self-judgement and be more likely to just say "I'm somewhere near the middle." "I'm somewhere near the middle" is exactly what the Dunning-Kruger paper showed people saying, with a slight positive correlation and a slight positive bias.

[@ValkynShade]

@Sky Gardener Except if it isn't a driving test but an actual knowledge test with increasing difficulty

[@christopherfleming7505]

I am a piano teacher at a local music conservatory. I had been thinking a lot lately about this recently. How it is possible that some of my worst students, the least gifted and the least studious, can be the most proud of their musical abilities? And yet, the brilliant ones often seem full of self-doubt? There is one 12-year-old girl, who must be the worst student I have ever known in 25 years of teaching the piano, who invites all her friends and family whenever there is a pupils' concert. Her parents film her, and she genuinely seems proud of her performances, while I am thinking to myself: "it would be impossible to play worse." On the other extreme, last year the best pupil I have ever had graduated from the conservatory, winning two important piano competitions, playing concerts to an incredibly high standard. This boy, who was 16, always spoke about his mistakes, what he needed to improve. I always had to encourage him, and tell him that what he perceived as mistakes were virtually imperceptible to an audience. After investigating a bit I came across your video, which explains things very well. For the first pupil, the idea of Mount Stupid makes a lot of sense, although I admit this is an extreme case. Normally beginners are more self-aware than her. For the second pupil, I believe it is precisely his astonishingly harsh self criticism that pushes him to perform so well.

[@amor4dior169]

I really liked reading this comment, so thank you for sharing it. An excellent illustration of the effect

[@rowanmales3430]

I don't think that is a good example at all though. It's just a matter of expectations and goals. I assume your "worst" students motivation is to be able to play the piano. So she loves to show off the fact she can play the piano, and holds real pride in that. It doesn't matter to her how "perfect" her playing is or how "good" is relative to other musicians as it is simply not important to her. What matters is she can play the piano, and loves to show off her "accomplishment". It has nothing about an overinflated overconfidence in her skill level relative to her actual level, or at least nothing you have wrote alludes to that. Being happy and prideful in the level she can play is not the same as believing she is at a much higher level than she is. The boy simply has a motivation that resonates much easier to a music teach like yourself. His motivation and goals involve mastering the piano, playing perfectly, playing at real concerts at a high standard. He has that strong sense of self criticism because he understands that what he is currently doing is not "good enough" for him based on his standards he wants to reach. But that goal is no more or less noble than the girls'. They both are striving for the goal they have set. He finds himself still lacking and striving. She has reached her goal and proud of it. The fact her goal is seemingly very simply and unsophisticated means nothing as all such things are completely subjective. To clarify, I took issue with you placing her as an extreme example of Mt. Stupid, when based on everything you have said, she isn't anywhere on that mountain whatsoever, merely taking pride in what she has accomplished and not seeming to care that she is not objectively a very good piano player. You have provided no information as to whether her own sense of skill was in fact far exceeding her level or not, which implies she did not have that problem, and thus totally not an example of Mt. Stupid.

[@cynthiaaaa5204]

"My ignorance might now be a bit more elaborate." That's going to be my motto while I work on my dissertation this year.

[@sanjaymatsuda4504]

3:45 By noticing that the ones in the bottom quartile perceived themselves as being only slightly above the median, an alternative explanation occurs to me: The subjects in the bottom quartile simply assumed that everyone else who was taking the test was only about as competent as themselves. Much like when you walk into a random basketball court in the 'hood, you assume that everyone else playing in there will be advanced amateurs at best, not NBA stars.

[@draevonmay7704]

This is pretty accurate. People tends to assume they are roughly average, the ego pulls that slightly up on average, and there is a positive correlation between skill and confidence. When you're trash, overconfidence and lack of understanding of the depth of your endevour make you significantly overestimate youself, while experts sometimes have difficult times communicating their work or research because they tend to overassume what other people know, so tend to undestimate their knowledge compared to the mean.

[@Chisito23]

Oh yes! I feel like that might be the case. For example the people that scored in the top quartile maybe thought "I know I did great but there's no way I'm in the 90th percentile, right?"

[@snspartan714al2]

And for all we know those in the bottom 25% and the top could be all of 10 points apart (i.e. the lowest score could be a 75 and the highest an 85) but because of the way it was recorded (performance vs. peers) it makes those who didn't preform well look like they were idiots

[@ribbonsofnight]

@@snspartan714al2 It does feel like it would be hard to misplace your ability if it was something like a maths test where the difference between top and bottom in a cohort of 1 school year can be 80%+ of the total marks apart.

[@Tore_Lund]

What is not mentioned in this video, but possible in the original Dunnig Kruger study, is that the better the test score, the better the subject assume his score is, i.e. the guessed performance curve is not flat or declining. The more humble performer, still thinks he is in a higher percentile than the the lower 1/4 thinks. So it is obviously better knowledge of a subject, that makes you better judge your performance, not that your general self perception is exaggerated, when you know less on a subject.

[@jabordewijk]

I learned about this graph in the mid nineties when I regularly read technology reports from Gartner, they called it the "hype cycle”. It is: 'a graphic representation of the maturity and adoption of technologies and applications'. It has the exact same shape as your confidence curve. I have no idea if the two are related but the resemblance is striking.

[@jthadcast]

i propose a new study where you perform this analysis on subjects that have never entered western educational system, like animal husbandry expertise among the Maasai or botanical expertise among the aborigional tribes of Brazil. $5 says they don't follow this dk confidence curve outside of prepubescence.

[@MarcyRavenManji]

@@jthadcast sounds interesting, although that's an awful lot of work for $5 lol

[@guidolongoni]

Yes! When I saw the title of the video and the curve I was baffled: "what the hell has to do the hype cycle curve with the Dunning-Kruger effect? Let's see..". Probably, in a certain time between the nineties and today (more toward today than the nineties, I presume) someone somewhere mistakenly associated that hype curve with Dunning Kruger effect and the Internet done the rest... But now this raises a new question: "Is it possible that the Internet fused these two unrelated concepts because they are, in fact, related? And what is the relation?". Of course it can be just a coincidence, but what if not...

[@tzviizaksonas8572]

@@MarcyRavenManji welcome to academia

[@RAFMnBgaming]

@@guidolongoni There's definitely overlap.

[@raphaelswaran510]

This is great content! So well written! Happy the video blew up and I found your channel. Subscribed!

[@mellofan2012]

This is some great content man! This is an entertaining and educational way of breaking down scientific studies and theories, and I’m all for it. I wish the KZbin algorithm showed me more of this educational entertainment rather than meaningless content. Automatic sub. Keep up the great work!

[@Lemon_Inspector]

Thank you for explaining this. I always just assumed Dunning-Kruger was something like the German version of Dunkin Donuts

[@iNsOmNiAcAnDrEw]

Prove to me that it's not Kappa

[@Lemon_Inspector]

@@iNsOmNiAcAnDrEw I can't believe it's not butter

[@jakobbauz]

In Germany, Dunning Kruger actually refers to Diane Kruger's less talented half brother. I think he's in marketing and advertising.

[@santiagofep]

wow you are really ahead in the stupid curve, well done. on the contrary i know everything abount the dunking donuts effect

[@erikziak1249]

How are the lemons?

[@hazelhazelton1346]

The thing is, whenever you try to really understand a topic, the more you learn that things aren't simple. The Mount Stupid graph doesn't represent the Dunning-Kruger effect, but- in my opinion- perfectly illustrates the idea of competence or knowledge about a topic lowering your confidence, or at least makes you reluctant to make definite claims. Because as you learn more, you discover ever new ways to be wrong, and as you do, you realize that you may be wrong this time too. ^.^ Yeah, those sentences aren't very well constructed. May I be forgiven.

[@fedeac31]

But the problem is, society tends to associate confidence with knowledge, when that's so often not the case. I remember back when I was a young student, that I was an inmature prick too full of myself. I was an advantaged student, so I really thought I knew better. Fast-forward a few years of actually working in my field, and I was full of self-doubt and knee-deep in depression. (Which I'm still recovering from.) I honestly think (maybe hope) that I'm a more mature, less insufferable person today than I was back then. And yet, I was ironically more succesfull back then. It was easier for me to make progress in my career, women favoured me a lot more (might also be because I was better-looking back then), I felt more driven to take initiative, etc. Nowadays, I struggle with myself whenever I have to calculate what I'm going to charge for a given job. And I've lost some opportunities out of self-doubt, that I now realize I was actually capable of taking up. I see every day, in my field, people making products of poor quality. Even when working within prominent organizations. Yet, those are the people that get the big salary, promotions, recognition and prestige, etc. (At least until their products fall apart at their seams.) It's crazy, because we're basically doing this to ourselves on a society-wide level. And yet we keep doing it. Ever since I noticed all of this, I've never again been able to put my trust in any professional if they don't carry themselves with lots of healthy humility. Anyone who brags even a little sounds like an snake oil salesman to my cynical self nowadays. Perhaps because they remind me of a younger me.

[@unliving_ball_of_gas]

@@fedeac31 This sounds like Experience

[@CarlosSamuel-ms9ee]

Yep makes sense. Another way to put it is this: There are known knowns, known unknowns, and unknown unknowns. When you first encounter a topic most of your unknowns are unknown to you, therefore it is easier to assume you know more about the topic. As you learn, more of the unknowns become known unknowns, so you are more aware of your shortcomings. I also think that ego and the desire for instant gratification may play a role as well. Given that it takes an effort to learn a new topic, it is easier to keep yourself motivated if you feel like efforts will yield a quick return. Thus your brain may reward you more early on in order to get you started.

[@Maddog-xc2zv]

agree, this late graphic really exists more as a metaphor on how things work in our everyday life rather than establish certainties that only feed even more the principle not only of the paper by Dunning and Krueger but also the metaphoric graph. If such does not have competence to understand such a statement, better consider doing other stuff (I'm also horrible at cooking, mechanic, most engeneers, psysics...).

[@user-uu9vh4zg5v]

This poster obviously doesn't know enough about the English language to fully understand how poor his sentence structure actually be.

[@manuelvo1798]

I am studiying to become a teacher in an elementary school in germany and for my bachelor thesis and many other exams this part you mentioned of dunning & kruger is mentioned often as well in different studies. What is interesting for me is, that it is usefull as a beginner to be more confident about the own skills as the actual skill level would suggest, because with this higher confidence it is more likely, that a student will try to work on stuff of this particular area which resolves (hopefully) in a learning curve. Otherwise if the confidence where always as low as the skill level it would more likely result in students giving up and not even trying. I know its much more complicated and that there are more parts involved than the general confidence, but it plays a part.

[@brandonkelly8193]

Such a helpful video, my friend! I am a percussion teacher who works with students for seven years --- starting from absolute beginners in 6th grade through graduation --- and, incorrectly thought Dunning-Kruger applied to beginners (who very commonly get to a point early on where they think they are really good - with little correlation to how good they actually are relative to their experience and even less awareness of their overall skill level as compared to more experienced players). With that said, you also referenced the Dunning & Sanchez "Overconfidence Among Beginners" paper, which I did not know about and will now be reading...and whatever else I find along this new (to me) line of study. Thanks for sparking this new quest for knowledge!

[@Tjili]

The “Mt Stupid” curve is a visual representation of how we deal with grief, based on Kübler-Ross’ theory about the five stages of grief. It has since been adapted and (mis)used to describe how we deal with change in general. I have never seen it in this context before.

[@Doct0rLekter]

The curve looks very similar, but I’ve not been able to find evidence that “Mt. Stupid” is adapted from the Kubler-Ross curve. There is no primary source in any research I’ve been able to find, but some speculation says it could be a cartoon depiction of the “four stages of competence”, or an adaptation of the equally unscientific “hype cycle” curve that uses both an incredibly similar curve, and somewhat similar language (and it also may predate the Dunning-Kruger effect). If I were to make a S.W.A.G (Scientific Wild Ass Guess), it was probably a one shot exaggerated illustration a popsci magazine or company came up with to easily explain the effect to a general public. Other places probably saw this illustration and thought it did a good job of explaining their understanding of the Dunning-Kruger effect, and so they reproduced it. This is, at best, an educated guess, so please take it with a grain of salt.

[@twinsunianlp7359]

I guess it’s a case the “if all you have is a hammer, everything looks like a nail”. In my case i see the “stupid mount curve” as a poorly calibrated PID controller. Anyway, i guess this is a question for someone like Matt Parker.

[@Doct0rLekter]

@@twinsunianlp7359 Who doesn’t love a good proportional integral derivative?

[@nemo9396]

The graphs look similar but have an important difference, mainly the spike at the start. I don't think that is the graph we are looking for.

[@Turruc]

"My ignorance may now be more elaborate" is oddly beautiful to me. A humble recognition of both your growth and your shortcomings. Might have to use this in the future

[@lestercollins2230]

Very good explanation! It seems to me too many are taking this out of context. From what I gather now is this is about competence/incompetence in which we all fall into both categories, so it makes sense to me that many of us could fall into all quadrants, depending on the many various subjects or topics.

[@derekw9724]

This video rocked, the ending was poetic. I'm excited to see more :)

[@pudy2487]

Dunning and Kreuger attributed the decreased confidence among the top quartile to the False Consensus Effect, but why would this effect not also be responsible for the increased confidence of the bottom quartiles? Surely, if someone performed poorly, and did not have knowledge of how their peers performed, they should assume that their performance was roughly average. Naturally, higher quartile members ought to be aware that they tend to be smarter than the average, so their estimations reflect that. This seems to be more of an issue of not being able to derive information about a population when your sample size is exactly one rather than any problems with metacognition.

[@VallisYT]

Uhh, that's an interesting thought! I have to admit that I don't have a satisfying or informed answer to it, yet applying the false consensus effect to the bottom quartile participants makes at least intuitive sense. I also have to admit that since I made this video, I've stumbled across several aspects of the Dunning-Kruger effect like the one you just mentioned (most of them were brought up here in the comments) which made the effect look more muddy and less straight-forward than it appeared to me while writing the script. Once again, things are always more complicated than they seem at first :)

[@jamesdean5095]

This seems pretty key. This video is excellent at showing how critical the specific aspects of studies are... comparing against a population is not the same as self-assessing knowledge. Assessing against others brings in a huge number of conflating social factors. It would be interesting to see the results if they were asked to estimate how many questions they actually got correct. Given how we know humans like to save face, not appear too egotistical, but also please others (i.e. the researchers), what if they were told after the test that they were actually being assessed on how accurately they could self-assess performance - the original test was irrelevant? That being said, it does feel that DK is often invoked to identify when people over-assess their knowledge comparative to others, so in that sense it is being used correctly.

[@iurigrang]

When informed about how most people did on the test and given an opportunity to reavaluate their assessment, the top percentiles drastically improved their estimate, the bottom ones didn't. While the false consensus might be responsible for the confidence in the lower quartiles, the "dunning Krueger" part of the effect comes when the top quartiles have more to go on besides just false consensus because, as the study says, the skills to evaluate competence deeply overlap with competence itself.

[@satibel]

@@VallisYT the scores might also be tightly grouped, so if the lowest bracket is only a couple points behind the highest bracket, making a good evaluation on relative score might be pretty hard. Also social circles do bias your average, if you're only hanging out with low skill workers or highly technical jobs you probably will have different averages in knowledge/problem solving.

[@eliontheinternet3298]

@@VallisYT sounds like you’re experiencing the curve that people attribute to this effect 😂

[@kimwelch4652]

The hardest problem in epistemology is figuring out how to know how much you do not know. However, I think it safe to assume that you do not know even half of what it is possible to know and what is possible for a human to know is less that half of the knowledge that exists. The less said about the knowledge that does not exist the better.

[@VallisYT]

Good point! However, I think that even assuming that I know less than half of what is possible to know is still far too optimistic. Even for the most narrow topics you can find people who dedicate their entire lives to it, so what do I have to offer on these topics in comparison to them? One lifetime is scarcely enough to master one subject, let alone the ever-increasing plethora of topics about which I am entirely ignorant. Anything but humility would be presumptuous.

[@JuanRios-kh8sq]

I accidentally tried to explain unknown unknowns in a job interview.

[@MadofaA]

@@JuanRios-kh8sq And how did that work out for ya?

[@JuanRios-kh8sq]

@@MadofaA I got the job in spite of having a philosophical seizure in the middle of the interview lol.

[@rtlau-mk4di]

@@VallisYT I agree. In fact, I'd say that even the most intelligent people of all time only know a fraction of a percent of the knowledge in the world because there is just not enough time and energy in the human lifespan to absorb all of that information. Perhaps polymaths who never have to work a day in their lives could end up acquiring 0.25% of the world's knowledge, but even that seems unrealistic. It is truly mind-boggling how much information is out there on so many subjects.

[@ryanstells]

I love this video. Researching this topic must have been really hard. I have tried to read scientific papers before and quit after failing majestically so I have a lot of respect for people who dare to do it anyway. Thank you :)

[@idontwantahandlethough]

You should try again!! I think there's a pretty decent chance you happened to come across a really dense/opaque/dry/wordy paper, but not all of them are! Some of them are super understandable and super interesting, you probably just got unlucky 🤗

[@bevo65]

“My ignorance might now be a bit more elaborate.” Bukowski smiles. Great quote! 😆

[@JamesCristKingJas]

"...my ignorance might now be a bit more elaborate." This resonated with me, I just finished a brutal graduate school final exam. I have exceptionally elaborate ignorance.

[@fennecbesixdouze1794]

The Dunning-Kruger effect has more in common with reversion to the mean than the Bukowski graph. In short: Dunning and Kruger Dunning-Kruger'd themselves with respect to statistics (or were deliberately deceptive). The actual results for quartiles with raw scores: Bottom: guessed on average they scored 5.8 questions right. Actual mean score: 0.2. Second: guessed on average they scored 5.4. Actual mean score: 2.7. Third: guessed on average they scored 6.9 questions right. Actual score: 6.9. Top: guessed on average they scored 9.3 questions right. Actual score: 10. Looking at these stats, you can see this is probably a pure data artifact. People in the bottom and second quartiles essentially had no knowledge of the subject at all, and simply randomly guessed their answers. They both guessed that they would score a little over 50% this way. If you have people guess how many coin flips out of 10 they will get right, then perform the experiment and arrange them into quartiles, you will produce exactly this kind of graph. As for people in the third and top quartiles, who presumably had at least some knowledge on the topics, they extremely closely predicted their own performance, showing that as soon as someone isn't just randomly guessing, i.e. as soon as it's not a pure data artifact, the Dunning-Kruger effect goes away. I even think the graph in the original paper is a pretty stunning example of academic dishonesty. Why on earth do they plot raw scores as percentiles? Why do they elongate the y-axis so much? To make the graph look steeper so there appears to be more space in that gap? The mathematical illiteracy of the paper, its bizarre data analysis, and suspiciously gamed data visualizations, are all rather unfortunate. There are so, so many examples, especially within psychology literature, of very attractive conclusions that people want to believe simply because they make for nice bite-size quips, especially to throw at people you think are stupid, but are backed up only by bad science and even worse mathematics.

[@fpedrosa2076]

You're the one misunderstanding the study. The numbers there are not absolute grades - or how many questions they got right or wrong - but it's the percentile of the test subjects. If 100 very smart students take a test with 100 questions and the worst student gets 80 then they would still be in the 1% percentile, because the other 99 students got better results than them.

[@JonWeinand]

Thanks for this reply; I had the same thought and apparently so did the authors of the original study. I read the original paper and they say "at first blush the reader may point to the regression effect", and then simply explain it away without actually trying to statistically account for it, noting that the size of the overestimation in the lowest performers is much larger than the size of underestimation in the highest performers. BUT, it seems pretty reasonable that this could be a combination of the regression effect and a general tendency to overestimate. When looking at the graphs for all of their different studies in this paper it is pretty clear that the participants don't generally have a good idea of where they are in relation to their peers. In other words, there is essentially no correlation between the confidence these participants had and their scores. When there is no correlation there, of course those at the ends will differ. What I would like to see is where they track the same participants across several different versions of a given area say, "logic" as in study 2, and what I would guess happens is that regression to the mean and general overestimation effects essentially annihilate any statistical significance.

[@JonWeinand]

@@fpedrosa2076 Read the original comment again more carefully.

[@fpedrosa2076]

@@JonWeinand Ok, so I was the one who messed up there. I didn't see anything in the graphs about raw data, so I had to look at the actual study to check. Yeah, the raw scores match what Fennec mentioned.

[@JonWeinand]

@@fpedrosa2076 I'm genuinely impressed by your forthrightness. I saw another of your comments here and I appreciate that you have read the study. I admit I was a bit hasty myself in judging their paper, but I still feel uneasy about it. Specifically, if you suspected regression, and you had students come back anyway, why wouldn't you just have them come back for the same test? Do you have any thoughts on it yourself?

[@CrzyMan_Personal]

"I still don't know the answer, but my ignorance is a bit more elaborate." Wow... why do I love that line so much?

[@skipanardoross6805]

Really enjoyed this presentation and I'm very confident that I understood it.

[@aksy1430555]

I have an opinion on why the Dunning-Kruger effect may have been associated with "stupid people" From my own experience and observation, what I would consider someone "stupid" in a broad sense is the kind of people who are stubborn in their quest to gain knowledge. These are people who care more about being right in an argument than gaining more knowledge on a topic. This is the reason they choose to "refuse" more data since to accept it, they would need to first admit that they were indeed wrong in the first place. This is where I think the Mount Stupid comes into play. I believe Mount Stupid has more to do with confirmation bias than incompetence. It exists because of people who find it difficult to accept that they may be wrong, which is why they unintentionally refuse to learn more, and hence never climb that curve of confidence because they choose to be where they are, and hence their knowledge remains as it is. I have noticed that the Dunning-Kruger effect affects everyone, in multiple ways, and not just learning. I remember last year, I was telling my friend she should break up with her boyfriend since he isn't good for her and a year later I realised that the Dunning-Kruger effect was into play. I thought I understood their whole relationship but failed to recognize that I only knew what she was telling me, which later made me realise that my assessment may have been flawed. This is why I think this distinction of people refusing to accept their incompetence is moreso the reason for the Mount Stupid to exist than it is about incompetence in general. P.S. Fantastic video by the way, demonstrating just how confusing it is to study something like the Dunning-Kruger effect when it keeps affecting us while we are learning about it.

[@VallisYT]

Hey Akshay, thank you for your thoughtful comment! I especially liked your remarks that learning and accepting new data sometimes requires to first admit one's own mistakes. This is something I have been thinking about a lot lately, since I have noticed how often my pride tries to interfere with my learning. So, every time I feel this happens, I attempt to detach myself from my pride and try to neutrally assess the situation, even if this means that I have to admit that I am wrong (even in this comment section, there are a lot of good remarks about smaller and some bigger mistakes I have made in this video). However, this is a painful process. I am sure that my handling of my own mistakes can still be improved, and I cannot really blame people who prefer being wrong to the shame and pain of being corrected.

[@sergeyfox2298]

Based on the video, if I'm understanding what it said, we're all basically experiencing stupidity and are already associated with the stupid people. Indeed, stupid people then are not so beneath us after all. That's what's freeing. Our culture is so sure we actually not stupid and those people are stupid unlike us. That itself is likely an effect of the effect, because we are not even aware of our actual stupidity or not-stupidity level and assuming we are above average. So freeing.

[@jacobs-corner]

@@sergeyfox2298 Freeing indeed. Ignorance is bliss. Knowledge is power. Edit: With power comes responsibility, something most people don't want.

[@aksy1430555]

@@plainguy3567 I wasn't talking about my ignorance. I wanted to convey that I genuinely felt, on a very intellectual level that I thought I understood everything in their relationship. I believed that I completely knew what she was thinking and feeling, sometimes even better than she did. I thought I was being entirely rational and only recently realised that it was D-K.

[@1.4142]

Confirmation bias really is the king of all biases, isn't it.

[@MrBuzzBill]

Well said! My fragile summation: (Presented with very limited confidence) Many people are effected by the Dunning Krueger effect while discussing the Dunning Krueger effect. Your conclusion, I think, is the best antidote to the effect itself. Just always realize that there is ALWAYS more to learn about ANY subject even if you're an EXPERT.

[@VallisYT]

Thank you, this is a neat summation of the video :)

[@williamwilliam5066]

"affected"

[@MrBuzzBill]

@@williamwilliam5066 Hurtful! Just hurtful. 😆👍

[@timhallas4275]

There's always a bigger fish. There's always a better answer.

[@theunderachieversnl7429]

@@VallisYT how sure are you of that ;p

[@synka5922]

honestly I felt more in line with the graphs from the study. I tend to feel overconfident in a topic I dont know much about, but as I learn more about it that confidence only increases at a steady pace. and I definitely see that point at which my skills exceed my confidence, back in school I would often think "oh man I bombed this test" and then still end with a 1 or 2 grade (A or B in american grades)

[@zangbeef891]

Love the video! I appreciate you citing sources and critically analyzing the articles. You spoke with the cautiousness of an expert!

[@VallisYT]

Thank you, Zach! Citing sources and maybe even showing them in the video is something I would like to see more on KZbin because it lends more credibility and transparency to the video, so I have decided to start by my own videos :)

[@catcatcatcatcatcatcatcatcatca]

The bias is also very self serving: mount stupid is easy to project behind you as long as you have any serious doubt about the subject; thus as long as you acknowledge at least superficially the lack of your knowledge, you at least are for sure ahead of those idiots behind you! I think this is why the curve is so popular in media - it doesn’t potray reality as nearly nobody is on the mount stupid. it simply doesn’t exist as the graph potrays it. Thus we all can pat ourself on the back, and keep successfully avoiding the mount stupid, while walking the normal, predicted path. Usually I stand on the more real mount stupid when I start projects: as I don’t know what could go wrong, nor all the steps between milestones, I assume learning the most identifiable parts of the project is close to the full needed knowledge. This is often not at all the case, but assessing things you can not know is both impossible to do accurately and easy to forget. I think this is the real mount stupid; being able to identify less gaps than actually exists. It’s like the participants kinda estimated their own points correctly, but wastly underestimated the total of the score. thus landing in very wrong percentage.

[@Draber2b]

That's a pretty good guess. My first thought was that people like the "mount stupid", because of how hilarious it is. The concept of some commom, hyper-cocky idiots is funny, satisfying and gives place for mockery. But technically even the fake graph doesn't state that low confidence equals "I'm not the worst like those uberconfident morons". There is still a part on the left of the "mount stupid". Why do people assume their lower confidence means that they are more competent than "mount stupid"? They may be less. Most didn't look carefully at this graph.

[@boryshacker]

Wtf this channel is pure gold! Subbed

[@filipsperl]

While the original study doesn't provide enough info, you can clearly tell that the downward trend of confidence in the image is based on the ratio between the two lines from the study. I'd say subsequent studies that focus more on an absolute measure of competence rather than how good you are relative to other people, can then also show the eventual rise of confidence, as well as willingness to admit when you know next to nothing

[@FAB1150]

That might not be the "dunning-kruger curve", but I always found that it does hold up. Not only while studying, but also while learning a new skill, or doing loong repetitive tasks... With anything, really. Take learning a physical skill, for example with a skateboard, or roller blades: You start and you have no idea what you're doing, you're so unconfident that you're very cautious with everything you're doing, and don't really fall or injure yourself. All of a sudden, it clicks. "Oh, I can do this all day!", and you feel on top of the world. You start getting very confident way too quickly, until your first fall. Then your world crumbles, and even though you now know the limits of what you're doing, you're scared of trying again and hurt yourself. Your confidence has dropped to almost zero, and only hard practice will get it back up. That's the curve! Same with very long tasks: you start, and you see the amount of work you have to do. "I will never do all of _this_ in time!", you say. So you start, but quickly find out that it isn't too bad, you probably will finish in a respectable time without being mega-strained. Until you work for a while and look at the clock, and it hits you. "I've been working for an hour, and I'm still almost at the same progress as before?! This thing is impossible!". Only with time you start getting accustomed to what you're doing, getting more efficient at it, and you slowly see the light at the end of the tunnel. That still is the curve!

[@micklucas1451]

What’s the curve’s real name?

[@helgearnewinkelbauer9798]

"My ignorance is now a bit more elaborate", story of my life. Nice video!

[@Kerdon91]

I'd love to see a follow up video about the "Overconfidence in Beginners" study. After watching the video and doing some digging myself I know that the popular dunning-kruger graph does not represent the actual study. However, I'd still be interested to know if there is any other scientific evidence that supports the graph, as seen in the "Overconfidence in Beginners" study you showed.

[@Maddog-xc2zv]

Tons of literature with studies in many areas of knowledge, from behavioral sciences to more biological approches, including the neuro sciences which boomed with the decoding of the human genoma, although we're still giving baby steps and many theory is for now just that with no empirical evidence.

[@JuNTaBiOs]

I first encountered the gartner hype cycle graph on a cable tv documentary ages ago, but it wasnt necessarily describing how people perceive their performance. years later i encountered this similar graph but is now apparently named "dunning-krugger effect" and i was like, "i swear i recall the name of this graph sounded like "garter" for me, mustve remembered it wrongly"

[@mobatyoutube]

Thank you for pointing this out. I also noticed this similarity.

[@mabromwich]

Yes - this appears to be conflation of the Gartner Hype Cycle which has some similarities with Dunning Kruger in that initially you believe in yourself due to success bias but later discover you lack skills/knowledge. The more you learn, the less you know.@@mobatyoutube

[@FatalionPanic1]

"The study doesn't show that incompetent people are more confident or arrogant than incompetent people." 5:23 - I believe there was meant to be at least one "competent" instead of two "incompetent". It's up for debate which "incompetent" one is the wrong one :P

[@VallisYT]

You are correct, that was my mistake :) I got it right both in my script and in the subtitles, yet I didn't notice that I said it the wrong way although I must have listened to this sentence dozens of times while creating this video-which once again proves how blind we can be to our own mistakes, even if they are this simple and obvious :D

[@ChrisBryer]

To me, it always feet more like a cautionary tale about understanding and accepting that you dont know understanding and simply being humble. And, i feel the saying "The more you know, the more you dont know." seems to fit here.

[@Maddog-xc2zv]

exactly. But the part of "you don't know" it's not addressed on the video and people not used to these "riddles" of nature and behavior just consider what they do know and not the all lack of info they don't know, which is vaaaastly superior. Also more competent people also tend to forget, due to the commonly said "muscular memory" (which is not a scientific term), they don't know (don't consciously remember they already know) what they don't remember they know; but they do, just like in a good paradox.

[@masterfall27]

Something interesting I noticed with the graph at 3:40. If you take the magnitude of the difference between the actually ability and perceived ability, you get something resembling the dunning kruger curve. Those that performed the worst grossly overestimated their ability, those who understood their ability achieved modest scores, and those who overachieved knew they were better than others but were still modest in their perceived ability. If you extend this on, I think you can get a pretty good analogy for real life. The actual test ability will reach 100% far before the perceived ability does. If you could extend the graph further to the right, it would take much longer to reach complete confidence. You can become almost perfect at something long before you realize how far you've come.

[@slashing_S]

Yes the area between the curves does represent the dunning kruger curve. Fantastic observation, I think this an important piece of linkage

[@NicoisLOST]

Very cool video! Hope you keep it up.

[@meerkat_4660]

I feel the mount stupid curve is less a representation of dunning Kruger’s results than it is an assumption about confidence made using the results, which I still think holds weight. As you mentioned in your second point, dunning Kruger doesn’t necessarily show that less knowledge means more confidence (higher self evaluation), just that the less knowledge you have the less likely your self evaluation will match up with your actual skills. However, if when talking about skills or knowledge we are referring to ideals we live by or feel very strongly about, we can assume that we will most likely over evaluate ourselves. Dunning Kruger suggests that our evaluation would be off, and the type of skills and knowledge in question suggest that it will be off by being an over-evaluation (overconfidence). I agree that it’s still dishonest to view the graph as a pure representation of what dunning Kruger found, but it’s also not completely right to say the graph has nothing to do with dunning Kruger at all.

[@rc3769]

Great comment.

[@daveed467]

the 'wrong' graph still communicates a more folksy wisdom based on the scientific study..its 'not wrong' just not the exact graph from the experiment

[@VallisYT]

Correct. The Mount Stupid graph in itself isn't wrong (although its amplitudes are certainly exaggerated), but it is wrong to use it as a visualization for the Dunning-Kruger effect.

[@missingnola3823]

I would say that the folksy graph is wrong. As Vallis shows, the actual study does not show a decrease in confidence at all as we go up the performance curve. Even if you consider the folksy graph a representation of the vector between self-evaluation and actual performance/knowledge (which would require, at the least, relabeling of the axes), it still isn't a very accurate representation. For instance, it doesn't represent at all the observed inversion between confidence and performance at the highest quartile. It does represent that there is a phenomenon of a "mount stupid" (or, more accurately, "mount overconfidence"), but the rest of the curve is not what the data suggest is occurring.

[@lobster838]

The wrong graph is actually completely disproved by the scientific study, since the correlation between true and percieved ability remains consistently positive. We don't have any evidence that suggests that it is correct, so calling it 'not wrong' seems to be a misrepresentation....

[@jesap6460]

@@lobster838 yeah no we asked 65 psychology students how funny they thought they were and then we tested how funny they actually were (actual original study), thus disproving mount stupid completely.

[@Anankin12]

@@VallisYT I think mount stupid refers to the foolishness of people thinking they know lots about something, not their actual intelligence. At least, I have and seen it interpreted that way.

[@stanleyschicken]

this is a very well made video! boosting for engagement

[@thechh8297]

If there is one thing that this video has taught me, it is that regardless of whether you prescribe to this version of the Dunning-Krueger Effect or the generally supposed version, the maker of the video felt confident enough to upload the video.

[@collinmiguel263]

Good video bro! 👍 I think you should've also mentioned and pointed out the fact that many times (often enough) certain quartiles correctly predict their position (more or less of course) percentile wise

[@VallisYT]

Oh, I just saw that I forgot to respond to your comment, but you are right, there are many people correctly assess their own performance, after all there seems to be a good correlation between the performance and perceived ability

[@infinemyself5604]

Isn't it because this lines are more or less straight and definitely not parallel so they have to overlap somewhere making good estimations inevitable?

[@jonathanwetherell3609]

As an undergraduate I was confident that I knew little about my chosen subject, Engineering. AS a group we suspected that we were not learning much but did not know enough to know if were correct. Out in the real world I started to learn. Soon I had learnt enough to know how little I knew. At the end of my career I had learnt so much that I was confident that I knew how little I knew. Also I was aware of those who had yet to learn and would never learn, as they knew it all.

[@simic9664]

"Also I was aware of those who had yet to learn and would never learn, as they knew it all". The last part says everything we need to know.

[@jaybingham3711]

@@simic9664 Which is precisely what leads to unhinged platitudes like "Move fast and break things." And all the fanboys that insist that it's sensible and worthy of being embraced. We're too enamored with our cleverness. We use it as a crucible with only the most minor of concern that wisdom might come about as a byproduct. The closest we'll likely ever come to that is the embarrassing placard we hung around neck when we decided to name ourselves Wise man. In reality, our actions prove we don't really aspire to such a thing.

[@flashrandom]

This is such a well made video, thanks a lot, now I know all.

[@yourk576]

I love the left-right audio test sounds in the background that's my favorite song

[@Packbat]

One of the most interesting bits in the original paper, I feel, is the part where they showed the subjects the tests that other subjects turned in and asked them to re-evaluate themselves. As the metacognition hypothesis would predict, the people who knew nothing could not tell that others were much more skilled. As the consensus effect hypothesis would predict, the people who knew a lot realized that they were further ahead of the pack than they thought.

[@hermitthefrog8951]

I think the Mt Stupid graph is a fair representation of confidence vs learning, but also correlates somewhat to confidence vs competence in that being unaware of one's incompetence does lead to some pretty spectacular errors that can only arise from unqualified confidence whereas an increase of knowledge makes one cautious because we learn by trial and error that "we don't know what we don't know"... and the truly enlightened strive to find out. In this way this is more philosophical than psychological.

[@bradleynugent9123]

Great video, look forward to more of whatwver you happen to make

[@abalakrishnan4152]

Watching this a day before final exams...great idea!

[@aplacetoexist]

Great video! I think you did a pretty good job going through the dunning Kruger effect! A quick tip that may help represent things correctly is instead of saying "empirical proof of (insert claim)" switch to "empirical evidence to support (insert claim)" as evidence for is not proof of! Again, great video, really enjoyed! Looking forward to some more!

[@VallisYT]

Thank you! And yes, you are correct, I should have said evidence instead of proof. It's good to know that there are critical people who watch my videos and point out these kind of mistakes, so I don't have to repeat them :)

[@thisrandomdude2846]

Fighting for the truth and ending ignorance is extremely honourable in my eyes. Thank you for teaching us about the misconceptions regarding this effect, and making this masterpiece of a video! I really appreciate it :D

[@piwi2775]

The irony about this effect is that people get confident about it even though they know nothing about the studies

[@augustin8302]

you saying you are certain you have only scratched the surface also matches the Dunning-Kruger effect, as, being in the 'upper quartile' , you are underestimating your knowledge and understanding of the topic!

[@stormRed]

"Elaborate ignorance" is all we can really strive for at the end of the day. We'll never know 100% of any given subject and that's not a bad thing.

[@MrDSmith]

Now THATS a mind twist to absorb during first coffee ☕🤯🤣. I absolutely see your point. Metacognition is a double edged sword of the known unknown.

[@bjornsoderstrom2152]

Thank you for this, it makes a lot of sense.

[@ccbowers]

5:05 This is a key point. The concepts within Dunning Kruger effect apply to all of us, because we all have varying levels of ability in various domains. I've tried to make this point before to be told I was wrong

[@KerbalLauncher]

I've met people who claimed to have a Ph.D. in Robotics or some other "specialization" that is not really a specialization in any field. I've noticed that they always fall back to the "but my Ph.D.! but my Ph.D.!" argument when confronted with being wrong. Basically these people touched every field just enough to know that it exists, took one class on it, and now they think they're a master of electrical engineering, computer science, etc. They starting making things up that make little sense just to sound smart or look right to others who don't know any better.

[@offbeat4772]

To be fair, I think its specifically the deviations from the test score that is evidence of overconfidence in underperformers. While that may not have been what the study focused on, I do think there is still merit to the idea that at a certain point, when someone has accrued enough surface level knowledge, someone can vastly overestimate their understanding of something. If unknowledgeable people consistently overestimate their scores, it at least says that people tend to assume that they're not completely uneducated on the subject. I've definitely had feelings like this when I just started learning about something and first begin to grasp the basic concepts.

[@sebastian9147]

How the hell do you only have 7210 Subscribers. How. This is excellent quality content.

[@QoraxAudio]

Finally. First time I've seen this topic been explained correctly.

[@OzixiThrill]

I think the "mount stupid" graph could come from the same graph you show around 3:47, except by adjusting the grapth to match the same measured values as the "mount stupid" one uses; Which is a confidence/performance graph. That would mean that the actual test score would become the X axis, while the confidence would become the Y axis, and the two would be mapped together. Now, this won't replicate the "mount stupid" graph exactly, but it does give the initial assertion of the colloquial DK effect of less competent people overestimating their relative performance.

[@criscrix3]

Came to the comments to say exactly this but you beat me to it. Basically the 2nd quartile's confidence grows very little from the 1st quartile because they realize there's a lot more to learn. Compare that to the 2nd to 3rd quartile's confidence slope and you get the "mount stupid" graph.

[@Hyperlooper]

I think the curve accurately describes Dunning-Kruger at the level of abstraction that any meme could be expected to summarize a scientific paper. Sure, the subtlety is lost in service of something catchy and easily understood, but the useful lesson is still there: lower skilled people tend to be more confident in their knowledge and ability than they should be.

[@lpsp442]

The trouble is, the classic false DK graph suggests that, after you overcome Mount Stupid, escape the valley of doomerism and ascend to "Expert Hill", you're fine. ACTUALLY, Expert Hill is itself another Mount Stupid. There never is an end point to learning. The truth is always evolving and unfolding, reality is infinite. Once you have mastered one level, another level presents itself to throw everything you've previously learned into shadow. The full and extended graph would therefore be a sequence of narrow peaks, sharp drops and slow re-climbs to the next one, gradually narrowing in on a certain level of belief likely around 50%. Mount Stupid is just the first, entry-level set of knowledge, associated with the strongest fluctuation between "aha, I am an expert now!" and "oh no I am a tool". (bugger it, I like this post - gonna repost it as its own comment.)

[@HappyLittleBoozer]

Thanks for this video. The popular presentation of this effect always didn't sit right with me, but I was too lazy to investigate what it actually was.

[@Manas-co8wl]

Thank you for dispelling this idiocy.

[@aarvlo]

Also what's interesting is that the graph calculated how wrong they were about their performance compared to other students it didn't graph how well they assessed their actual performance, I wonder what the graph would look like if the scientists asked them what they think their scores were instead