How Donkey Kong made Melee history

[@turndownforwalt]

Thank you INTO THE AM for these Elevated Everyday Graphic Tees! Get yours now and get 10% off site-wide when you click the link below: intotheam.com/WALT

[@RobSomeone]

3:50 How have you not broken 100k yet? I don't even play Melee, I just love these stories you tell.

[@billwoods7578]

Please never let Jorge commentate again.

[@arJunebugSmash]

bit at the end was v sweet walt

[@4sfield527]

I've been watching you since like 2014 at Xanadu's in PM, and it's wild to see you go from PM God, to being a melee commentator mostly, to being a melee champion, and standing on a podium with the best players in the world. Good shit, man!

[@DarkAuraLord]

@@4sfield527 same here dude. Now we just need Sethlon to show out with Roy. Watching him play PM Roy was my favorite thing, dude was an absolute menace.

[@fendour_]

Junebug twitch stream possibility?

[@kevinmartin9674]

player of the year

[@SwordMaster3000]

I so badly want to see a dk major tournament win it is unreal but at least you got 3rd place and there is always the next one

[@Darksilver740]

The ending to Cody 3-0 over June was just unreal. Cody, the WINNER, walks off stage after the game yet Junebug, the LOSER(still 3rd place) has the whole crowd on his back as he basks in the glory of the Bronze medal. I have never seen an interaction like this before

[@DarkAuraLord]

Melee is sick.

[@plutigvid]

Cody was pissed about it too. There's a clip of him looking at the camera looking all mad and saying something right after Junebug gets the medal

[@Extracredittttt]

Reminded me a lot of Abate beating S2J and then getting wiped by Mango. I love Junebug!

[@HawaiiPart]

@@plutigvidCan you send me a link? Idk where to find it

[@friesfromsc]

@@plutigvidhe extremely obviously mouthed that he was going to the restroom, probably to the staff on stage

[@ellachino4799]

rapp snitches with a dk sound fount goes unbelievably hard

[@BrayDONee0]

For real. Need that released asap!

[@Sweetpeeb02]

@@BrayDONee0just search up rapp snitch knishes donkey Kong and it’ll pop up by fxsnowy

[@ellachino4799]

@@BrayDONee0 i just put "rapp snitches with a dk sound fount" into youtube and it popped up

[@Timberwolfee]

Sure does!

[@robertgonzalez7562]

Glad someone else noticed. 🔥

[@ALloydRH]

Worth acknowledging Junebug actually took a game off Mang0 with that DK.

[@ericwolf9664]

From what I saw on the replays, he easily could have taken it to 5 if he didn't have the self kills.

[@KyokujiFGC]

@@ericwolf9664 Yeah, the SDs really shook his confidence, I think. He wasn't moving the same way afterwards. I think he was also feeling some fatigue at that point in the tournament. He was doing a lot of desperation grab out of shield that kept getting jumped punished.

[@krusher181]

@@KyokujiFGCyeah he was playing for so long he prob isn’t used to it. Mango is very used to playing deep into super majors with a big crowd. One game was impressive imo. Way mango is playing recently… most players can’t win a game against him let alone a set

[@nickrulez809765]

I think there is a reasonable chance he would have won if he hadn't had that SD.

[@kupaxykalee4454]

(on fd)

[@orange567_]

The year is 20DK. Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK. The DKs have maximized their punish game, and matches are decided by who can get the first grab. Jmook is the only non-DK player left.

[@jackwilliams1468]

The year is 20DK Donkey Kong is now officially the best character in Melee. Every Fox mains have dropped Fox in favor for DK The DKs have maximized their punish game, and matches are decided by who can get the first grab Jmook is the only non-DK player left.

[@riboiman4005]

.tfel reyalp KD-non ylno eht si koomJ .barg tsrif eht teg nac ohw yb dediced era sehctam dna ,emag hsinup rieht dezimixam evah sKD ehT .KD rof rovaf ni xoF deppord evah sniam xoF yrevE .eeleM ni retcarahc tseb eht yllaiciffo won si gnoK yeknoD .KD02 si raey ehT

[@WeAreRisenzUPS]

THE KONGQUEST CONTINUES!!! WE MID TIERS WILL KONGQUER THIS GAME BIT BY BIT!

[@anitabath8315]

The rise kongmunism

[@lilzpotato846]

@A_Person_64i was i a north jersey tourney last weekend and I was beating this guys fox, he picked zelda and fucking SMOKED me 😂

[@fractal_aura]

Eggdog invitational was so wild. Junebug played out of his mind

[@TheXell]

The Dong expands further.

[@towerdefensebrigadebackup]

Ayo

[@peterevans2854]

W comment.

[@PierreLucSex]

It is the way

[@louiederpman7113]

As mang0 himself has said and been repeated many times: "There is still so much melee left to be played". That last little section really reminded me of that

[@MNTNPG]

By the way, the “Junebug-Quang inversion effect” isn’t exclusive to this moment and is an observable phenomenon that Cody once talked about on stream before. He said that, whenever he plays Amsa in bracket, he doesn’t practice with other Yoshis because he actually does worse against Amsa every time he’s done so, for some inexplicable reason. Weird stuff for sure

[@nahometesfay1112]

Probably because they play so differently

[@snipermoose2580]

You love watching a player like Junebug succeed. All the effort he put into a lower tier character is paying off. Especially how happy he was to put on a good performance in front of family and friends in his home town. Junebug is the GOAT, and amazing video Walt

[@Fattyb00batty]

Joshmans reaction to getting socked is priceless

[@DarkAuraLord]

seriously, I rewound that part like 3 times 😂bro was FLABBERGASTED 💀

[@herobrineharry7698]

He IS the leader of the bunch. You DO know him well. And he’s FINALLY back, to kick some tail.

[@netmonmatt]

It sucks that they were forced to rebrand, but i gotta admit, SuperNova is an absolutely sick name

[@freddiesimmons1394]

Why were they forced

[@Blustorm1]

​@@freddiesimmons1394 Likely rules Nintendo set when they had tournament register with them. Smash factor became S factor recently too.

[@HasXXXInCrocs]

This was the first ever major tournament I've attended and holy shit this was the most insane sporting event ever. The crowd was more electric than even when I saw the Caps in the play offs the year the won the cup. Even my fiance popped off when June punched Josh for the win! So glad I got to experience that once in a life time event and I'll be going back every single year from now on.

[@catcatcatcatcatcatcatcatcatca]

As a viewer, DK has skyrocketed my interest in Melee. As someone who hasn’t played the game since early childhood, I really love the breakdowns of the advanced match-ups, tactics and mechanics. This lets me appriciate the complexity of the game even if I have no time nor spare effort to learn any of them myself. The fact a new character can reach drastically higher results so many years after the games release is a testament to the complexity of the game and more importantly the effort, skill and dedication of the players dedicated to it.

[@WyattHoldW]

I’m not even done with the video yet and have to stop and say you did an awesome job with this man. Good shit and thank you

[@lemoncakestudios3031]

It was great to work with you Walt! Glad to see my footage put to good use. Let's go Junebug, congrats on the bronze! So cool to watch you dominate Melee in person and can't wait to see where you go from here :)

[@nscott64]

To think that I used to watch Junebug play PM like 10 years ago, not knowing he was going to become one of the most beloved Smash players. We're all here for 20DK!

[@netglitch_]

Joshman's reaction at 1:53 to getting raw punched is amazing

[@paulcochran7007]

Being a part of that crowd was incredible. Definitely one for the books

[@justinclary7760]

Walt, we met briefly after supernova and I mentioned to you that I’ve been playing 10 years with my friends and that they are essentially family at this point in life and moments like this have reinvigorated our passions for this game and community. You’re goddamn right we aren’t stopping anytime soon.

[@HeckYep]

As a dumbass kid who mained DK after falling in love with the Ding Dong kill confirm, I'm so happy with the current state of Smash. It's so validating to my stubborn loyalty to the character. That back air is pure dopamine. I plan to finally try out Slippi just to go ham with DK. Edit: The 9-Wind is so baller, June is a legend to DKs everywhere.

[@SuburbanWitcher]

I used to play/watch a lot of PM in the 3.02-3.5 era with Junebug and man this is such a throwback to see him again

[@harlevans8498]

5:37 WOAHHH DK WHAT ARE YOU DOING!!!!

[@leomassafm160]

he's spanking the monkey

[@Aaron-mn2ro]

need a ganon resurgence BADLY

[@DarkAuraLord]

Kage, my beloved

[@Aaron-mn2ro]

@@DarkAuraLord B I Z Z A R R O F L A M E

[@DarkAuraLord]

@@Aaron-mn2ro EEEEEEEEEEEEEEEZZZZZZZZZZZZZZZZZZZZZZZ MONEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEY

[@faithinseabass]

Sick video as Usual, Walt! Keep pumping these out, it's easy to see how much care goes into making them.

[@twanheijkoop6753]

Watching his run from home was already incredibly hype, can't imagine being in the crowd live.

[@ItsMeChair1]

First instance of AsumSaus footage for todays video: 0:20

[@Bones_]

Watching top 8 your commentary was really great! Like I was watching an Olympic sport level of quality. Just the right mix of well measured pace, in depth stats, and clear and concise speaking even when the energy picks up

[@jmendozas197]

Once again, you killed it with another banger of a video! It was crazy watching this live.

[@MoeSzyslak-nu3zd]

Just found your channel, dude you are amazing. I’ve been on a binge watching all your videos.

[@hockeyfreak896890]

Beautiful storytelling man. Idk why but that ending sequence started to make me tear up haha. Great job as always.

[@TimeEnthusiast]

He was a strong presence in PM too..

[@heyitsmort7744]

“Anything could happen” is such a legendary line before June’s punch 😂

[@anakaleflax]

Wow you work quick, Supernova was crazy and it's awesome to see Junebug & DK get more love :D

[@DualSaga184]

After having watched your previous DK video and then hearing that Junebug made it into the top 8 of this tournament I decided to watch the top 8 and was quite happy with the hype plays Junebug was able to pull out.

[@ME-ec6wi]

That minute where he glazed himself was kinda weird lol, great video tho Junebug is soo good at DK

[@StepBaum]

Really well made :) watched a couple vids now and you earned a sub. Great analysis!

[@danielk7245]

Being in the crowd for this was truly an experience unlike any other

[@necromax13]

20DK is real. Thanks Junebug, Quang, Ringler, and Akir.

[@camhenning27]

Watching his run live was insane

[@vilegoblin]

the mario clip at 4:16 of him walking in engine lip synced to what Walt is saying lives rent free in my head

[@MrGetownedLP]

14:59 FeelsStrongMan June is for the people HOLYY

[@drewholmes7356]

Melee is just flat out science at this point. I don't even play melee, much less play competitive, yet this is so captivating to watch.

[@RiskierGoose340]

I think I just realized that the DK-Pika matchup is just Guilty Gear Strive’s Potemkin-Chipp matchup: a slow character who struggles in neutral but can survive a lot of hits and can deal a lot of damage, vs a fast character that is amazing in neutral but doesn’t deal a lot of damage and dies super easily.

[@jaspervermeer659]

I just love how much Junebug is enjoying it

[@OkOk-ht6gr]

Is crazy how I just finished your pikachu video and then not even a minute later there’s a new one

[@Gabriel64468]

Sick run by June, but almost is doing a lot of lifting in that title ^^‘

[@Stinkbug_Ab]

Im soooo happy Junebug is sticking with it

[@LAST1GGK]

June bug is legit the reason I even can comprehend PM shout out to bro fr

[@Alx1116]

This is for the guys that used to play the game so much you’d main everyone for a while and saw potential in dk. I love melee

[@equinox3861]

Current mood: Jorge on commentary for a Junebug set at Supernova 2024

[@chw14556]

Honestly DK is super fun to watch so it’s sweet seeing him represented more.

[@wingzero7678]

Now we just wait another 10 to 20 years for someone to pick up my boy Ganon from the shelf and start winning like DK is now

[@fatalbert135]

Awww yeah. This is what I was waiting for this week

[@raphaelmacasaet1081]

POV: Me proving my friends that low tiers are good.

[@bfors8498]

Junebug is a must watch player

[@MarMaxGaming]

it's true... writing, voicing, editing... they take forever!

[@spadorade]

Axe shoulda went yink

[@MarMaxGaming]

I saw Dk actually won neutral sometimes against Pika with those swift disjointed back airs

[@TheAlolanRaichu]

hope everyone attending supernova enjoyed their stay in nova! we got lots of roads, lots of grass, lots of suburbs, and lots of breweries :D

[@maxspecs]

The good ol’ “don’t get hit by Giant Punch” challenge. Clearly not impossible but damn hard.

[@InkedDoesStuff]

As much as I'm rooting for the Kong Renaissance, I'm a bit worried this success might be a little short than we expect. I have no doubt that DK is good, but his results may begin to plateu as good players begin to learn the matchup

[@KincaidCS2]

23 years later, melee is still fucking sick

[@Enochuout]

I wouldn't mind if your next video is a DK video. Just keep encouraging Junebug to compete in everything he has opportunity for, more DK is better for everyone.

[@Extracredittttt]

This was the most hype i have EVER been watching melee. good to day to be from mdva ❤❤❤

[@astackzzzz277]

One punch man reference on the thumbnail is epic

[@nicodemos4829]

melee is just magic at this point

[@mrmediocre848]

I mean, DK does bring out the inner monkey within all of us. I'm pretty sure Supernova would've gone supernova in reality if Junebug won the whole thing

[@FortuneKOF]

This is exactly why Melee will be forever timeless. Smash will release a new game, kill the previous entry over and over. but Melee will forever remain standing strong.

[@eu4um]

I fucking love June man. He's so cool.

[@cowboyclip]

Subbed, 100k coming soon!

[@chw14556]

20+ years later and the game is still evolving. Incredible. Now the question is, which “mid tier” is next? G&W is a fair bet.

[@jeremyrosenberg2357]

Subbed to you my man. Great content.

[@lasagnahog7695]

With Junebug not playing his character as long as the top players and being able to see mistakes being made as he wins makes me super excited for him, and melee as a whole, going forward. If all melee was was spacies/marth/shiek I wouldn't even bother watching and Junebug gives me hope that that doesn't come to pass.

[@Extracredittttt]

It's crazy that, the longer the game has gone on, the more mid-tiers become viable. 20XX ideology was so wrong and I am very glad it was Yoshi and DK both at their peak!

[@LordFartamor]

Congrats on 100k subs Walt

[@raphaelmacasaet1081]

You know you have good fans when there are pulling this crap 10:01, 10:17, and 13:29

[@kevinmartin9674]

been waiting alllll week for this video. what an event

[@K_v_B]

Thumbnail goes hard.

[@inediblemangoes7797]

Also your video editing is getting so fucking good

[@angelodegiule1753]

Low tier mains keep rising up. It’s beautiful to see

[@tenebrisdumplin4583]

It's pretty funny that DK can function in melee for the exact same reason he's good in later smash titles, Cargo up throw up air is probably the best throw confirm in the series. The utter domination his punish game can levy against fast fallers combined with his tankiness are a very unusual profile for melee. You can even see Mango have to change his style somewhat and resign to walling DK out defensively.

[@x9x9x9x9x9]

Off topic but if into the am brought back their old space hoodies I would buy them. My all time favorite zipup hoodies came from them.

[@joolian4763]

Junebug is likely one of the best smash players of all time, he has been around a long time and has developed the meta across different games. He's a beast.

[@Wrestleroftheyear]

Mans should enter the smash iron man or whatever they call playing all the games

[@FloetryFox88]

For over 20 years since 2002, I have BEEN saying that DK was a really good character!! I was a DK solo main in in Melee from 2006 to 2011 and was one of the first few people praising the character as a secret high tier for YEARS! Now that people are finally seeing DK's true potential like I have, it truly brings a smile to my face! 😂💯🙌🏿

[@fraggnum__9660]

Im so happy. I love melee dk and I’ve had a strong feeling for multiple years that he could win a major. Now i have proof.

[@Clementinee]

it’ll forever be Super Smash Con

[@gorg9928]

The 20DK is real.

[@iMacxXuserXx485]

There will be more ICs representation in the top 50 soon. Nicki is coming for Top 50 with ICs!

[@paz8723]

>small win >small win >small win

[@NeilOwnsU2]

new leader of the bunch! you know him well!!!

[@jpeghub]

i didn't know you did brawlhalla commentary, that's awesome

[@raptoria1705]

Still unbelievable how there are as many DK players in top 100 as there are jigglypuff players

[@MeatSnax]

I know we did see a bit of a Sheik renaissance a couple years ago, but I really think there's a ground swell of low execution > large reward among the more recent top players, and we're gonna see optimized Sheiks taking more tournaments than ever. I also think the crowd plays a BIG factor in these low tier heroes, people really underestimate how much it can shake a player, even at the very tippy top, for everybody to be cheering every time you get comboed or KO'd. Think about any time you were playing with somebody who trash talked a lot or played in front of people who wanted you to lose, you really need practiced, professional composure to not have it affect you greatly. Someone like Leffen or Hbox who's used to being cheered against will have a much easier time than a flashy Fox main or someone who's normally a Top 8 underdog, I mean Axe has probably never been cheered against unless he was playing Amsa or Mang0 or somebody that REALLY gets the crowd going.

[@ghostbaleada]

This tourney had some G&W mains also doing decently. I think G&W is next tier list shaker

[@drastic6411]

Here's to 100k soon! This is like my 3rd account I'm subbed on lol

[@thomasa4749]

Honey wake up new Walt video!

[@jakegwolford]

Walt remains undefeated.

[@legendarysoil1064]

Junebug is actually inspirational like bro decided that donkey kong should be broken and did it

[@Thomas-nz4si]

People have been saying DK was on the cusp of being viable for years now, usually being placed right below Ganon. I think a lot of people knew that DK was unexplored and had potential within the top 100, but I don't think anyone expected this. I'm interested in seeing what's going to be a bigger aspect in the future, matchup unfamiliarality or optimizing Kong's punish game.