How Depression Affects The Brain - Yale Medicine Explains

  Рет қаралды 1,846,264

Yale Medicine

Yale Medicine

Күн бұрын

For more information on mental health or #YaleMedicine, visit: www.yalemedici....
For many people, depression turns out to be one of the most disabling illnesses that we have in society. Despite the treatments that we have available, many people are not responding that well. It's a disorder that can be very disabling in society. It's also a disorder that has medical consequences. By understand the neurobiology of depression we hope to be able more to find the right treatment for the patient suffering from this disease. The current standard of care for the treatment of depression is based on what we call the monoamine deficiency hypothesis. Essentially, presuming that one of three neurotransmitters in the brain is deficient or underactive. But the reality is, there are more than 100 neurotransmitters in the brain. And billions of connections between neurons. So we know that that's a limited hypothesis. Neurotransmitters can be thought of as the chemical messengers within the brain, it's what helps one cell in the brain communicate with another, to pass that message along from one brain region to another. For decades, we thought that the primary pathology, the primary cause of depression was some abnormality in these neurotransmitters, specifically serotonin or norepinephrine. However, norepinephrine and serotonin did not seem to be able to account for this cause, or to cause the symptoms of depression in people who had major depression. Instead, the chemical messengers between the nerve cells in the higher centers of the brain, which include glutamate and GABA, were possibilities as alternative causes for the symptoms of depression. When you're exposed to severe and chronic stress like people experience when they have depression, you lose some of the connections between the nerve cells. The communication in these circuits becomes inefficient and noisy, we think that the loss of these synaptic connections contributes to the biology of depression. There are clear differences between a healthy brain and a depressed brain. And the exciting thing is, when you treat that depression effectively, the brain goes back to looking like a healthy brain, both at the cellular level and at a global scale. It's critical to understand the neurobiology of depression and how the brain plays a role in that for two main reasons. One, it helps us understand how the disease develops and progresses, and we can start to target treatments based on that. We are in a new era of psychiatry. This is a paradigm shift, away from a model of monoaminergic deficiency to a fuller understanding of the brain as a complex neurochemical organ. All of the research is driven by the imperative to alleviate human suffering. Depression is one of the most substantial contributors to human suffering. The opportunity to make even a tiny dent in that is an incredible opportunity.

Пікірлер: 2 300
@Booklover-coffeelover
@Booklover-coffeelover Жыл бұрын
When you tell people you have depression the most common thing they say is "everyone gets sad from time to time". It's so hard to explain that depression has nothing to do with sadness or happiness, it's a completely different state of mind, where even minor inconveniences in life are seen as the greatest obstacles. Sadness, grief, pain, happiness, all these are normal feelings of life. Depression robs you of the ability to react normally in almost every aspect of life. Just like any other disease.
@ceooflonelinessinc.267
@ceooflonelinessinc.267 Жыл бұрын
I dont know dude. I am clinical depressed and I def feel sad?
@mamathapendyala
@mamathapendyala Жыл бұрын
@@ceooflonelinessinc.267 I know it's not worded that way but I guess what the original comment was trying to say was that depression is definitely sadness but also more than that
@vivekchaturvedi2313
@vivekchaturvedi2313 Жыл бұрын
Well said
@mistycloud4455
@mistycloud4455 Жыл бұрын
A.G.I Will be man's last invention
@bobbiemiles-foremaniii8747
@bobbiemiles-foremaniii8747 Жыл бұрын
Well you better take a bunch of drugs then
@christianscott4135
@christianscott4135 Жыл бұрын
Depression, anxiety, PTSD is not an easy situation for anyone. Please take care of yourselves and loved ones.
@loganturner9175
@loganturner9175 Жыл бұрын
@@ralphadams2433 I’ve been hearing of this psilocybin mushroom, I’ve read about it as well, do you know anywhere I can source them?
@ralphadams2433
@ralphadams2433 Жыл бұрын
Yes, dr.cobb
@ralphadams2433
@ralphadams2433 Жыл бұрын
Sure, dr.cobb
@alanbaker6311
@alanbaker6311 Жыл бұрын
Psychedelics are very good remedies and medications for depression,anxiety etc. helped my mom a lot.
@royperry1165
@royperry1165 Жыл бұрын
dr.cobb has been my supplier for over a year now, he’s good
@mr.nobody9934
@mr.nobody9934 3 жыл бұрын
Depression has effected my memory the most. Its gotten to the point where I can barely remember anything about my childhood or the names and faces of people I've known for most of my life. My memory spans a week at most before things get extremely hazy. Can't even remember the feeling of being happy. I'm not saying that I'm never happy, I probably am sometimes, it's just that I'm not able to recognize emotions I'm feeling. Funny thing is, I can't even remember why i was ever depressed or angry I'm just stuck with these feelings without ever knowing why. I could set something down, blink, and forget where it is. It's still where I left it, it's just that it was immediately erased and it's like the item became completely invisible despite it being right in front of my face. This just sucks to live with daily and I'm only 18. ADHD sure as hell doesn't help either. Didn't even realize it was this long.
@AnNa-gv6ep
@AnNa-gv6ep 3 жыл бұрын
We are all in this together💛 stay strong! Therapy does help too
@jaz7316
@jaz7316 3 жыл бұрын
We will get better. I don’t know you but I wanna tell you I know that we will. We will get to where we’re going ❤️
@thatdamnguy9566
@thatdamnguy9566 2 жыл бұрын
Keep staying strong and fighting, one day I hope that you will get better ❤️
@tman5634
@tman5634 2 жыл бұрын
Depression has many aspects & symptoms. All of us who suffer with it can support eachother in whatever our own challenges are.
@lachlanrussell5042
@lachlanrussell5042 2 жыл бұрын
I’m practically the same as u my man, except I’m 20 and I have/had ADHD just haven’t taken meds for it in 7 years
@tragisscott
@tragisscott Жыл бұрын
reading through the comments and seeing how incredibly relatable they are to what what i'm experiencing, truly makes me feel less lonely.. take care, everyone.
@blueblack3591
@blueblack3591 Жыл бұрын
Take care
@Tt-dr2ld
@Tt-dr2ld Жыл бұрын
kzbin.info/www/bejne/aXfZfK2Jd7iEmcU ❤
@humblebox3174
@humblebox3174 Жыл бұрын
You too take care :-) whatever you're going through I wish you always stay safe, strong, healthy and happy 💜💙 One of the things that has helped me get through this over the last 5 yrs is keeping a record of my experience, recording what has worked for me and what hasn't and helping out fellow human beings with the same. I made a channel dedicated to this matter where I publish those video records to help other ppl going through the same. It really makes me happy whenever one says I could reach their heart, even if it's a tiny bit, if my videos have been helpful to ppl. If you need a friend, Humble Box will always be here for you. I wish you happiness and warmth 😊. Hope one day you'll be able to help out others with the same as your condition gets better. I'll be rooting for you, you can do it! 😊
@gamewriteeye769
@gamewriteeye769 Жыл бұрын
Loneliness is a pathway to darkness and madness.
@govindmishra7938
@govindmishra7938 Жыл бұрын
kzbin.info/www/bejne/qqrFgJxqnc-NfLM
@jacquiclaudia3638
@jacquiclaudia3638 2 жыл бұрын
Thank-you for taking depression seriously. My whole family would just say get over it, stop being so emotional, it got to a point where I could not get out of bed, yet I was doing everything that was recommended. I am starting to see the light. Wow, so many kind people! Thanks so much guys. Everything is good 7 months later hah! I’ve been hitting the gym, taking life a bit slower, accepting myself the way I am and learning to love myself. Deleting social media is partly part of the reason I can accept myself and definitely getting some fresh air daily, even if I’m busy I always make it a priority, otherwise I will be sad. I even missed a party due to needing some time out! Exercise and prayer/breathing helped me out. Hope you’re all okay ppl!
@zack_sporesoninstagramsell1421
@zack_sporesoninstagramsell1421 2 жыл бұрын
⬆️look up that handle he got dmt, lsd, xanax, psilocybin mushrooms 🔌💊🍄
@Hubcool367
@Hubcool367 2 жыл бұрын
What did you do to start seeing the light? Like you, I've been doing everything that was recommended, for years. But when I point out to my therapist that "just go take walks" doesn't work for me, as I've taken plenty of walks for a whole while, he'll just twist it and instead say that it probably doesn't work because I've been walking "too much", or not at the right time, or some other similar nonsense. A little exercise and a little bit of sun is apparently all anyone ever needed to cure depression, and if it doesn't actually magically cure you, it's all your fault and you're just somehow doing it wrong..
@nostalgicbliss5547
@nostalgicbliss5547 Жыл бұрын
Crazy people still have that mindset in 2022
@asmaemahfoud4276
@asmaemahfoud4276 Жыл бұрын
don't abandon ur emotions treat them
@user-ey5fc4fh6w
@user-ey5fc4fh6w Жыл бұрын
Jesus is a healer follow him and receive him as lord and savior and be renewed and redeemed in the name of Jesus
@smunna1452
@smunna1452 Жыл бұрын
I didn't know how serious depression is until I felt it, you can't describe it to others about how you feel. Depression makes me sad all the time, can't focus on anything , talking with someone and also thinking of something at the same time makes me socially less active, always losing the arguments. So , it's really sad to be depressed but happy to see these guys talking seriously about depression..
@Dragon_BeBop
@Dragon_BeBop Жыл бұрын
Exactly how I feel. 🥺
@Ljounieh
@Ljounieh Жыл бұрын
Right. Everything seems to demand too much energy I just don't have
@Radhakrishncharandasi
@Radhakrishncharandasi Жыл бұрын
You all need just one medicine - Meditation to realize ' I am not the body' I am not the mind' I am the soul - and when u meditate on these thoughts, slowly u will realize all your problems exist in mind. But you are not the mind. 🙏🙏🙏
@goojay6696
@goojay6696 Жыл бұрын
Exercise,sunlight,omega 3,sleeping well,hobbies,music,serotonin-raising foods,socializing,daily affirmations,meditation/mindfulness,helping others,time with pet/s.
@hailbones666
@hailbones666 Жыл бұрын
@Goo Jay Yep, and I still have depression. This isn’t a bad habit, it’s a fundamental dysfunction in how the brain works
@SokMark
@SokMark 4 ай бұрын
could remember several years ago I was diagnosed with ADHD. Also suffered severe depression and mental disorder. Not until my mom recommended me to psilocybin mushrooms treatment. Psilocybin treatment saved my life honestly. 8 years totally clean. Never thought I would be saying this about mushrooms.
@AsaTillby
@AsaTillby 4 ай бұрын
they saved you from death bud, lets be honest here. and mushrooms are one of the most amazing things on this planet i wish people would all realize. they could solve a lot of problems, more than just mental treatments, environmental clean up; the possibilities are endless with fungus.
@AndrewElliott-oe5ym
@AndrewElliott-oe5ym 4 ай бұрын
Can you help with the reliable source I would really appreciate it. Many people talk about mushrooms and psychedelics but nobody talks about where to get them. Very hard to get a reliable source here in Greece. Really need!
@mariaclara4480
@mariaclara4480 4 ай бұрын
YES very sure of Dr.raymycology. I have the same experience with anxiety, depression, PTSD and addiction and Mushrooms definitely made a huge huge difference to why am clean today
@RogerStevens-hs4ju
@RogerStevens-hs4ju 4 ай бұрын
I hate that psilocybin gets grouped with drugs like cocaine and heroin. Mushrooms are a remedy, not a vice! I went on a microdose treatment for a couple of months and within the first week, every sight of a cigarette got me questioning why I was doing all that to myself. It really works.
@ParkBills
@ParkBills 4 ай бұрын
How do I reach out to him? Is he on telegram
@mwerdeman
@mwerdeman 2 жыл бұрын
If depression can cause memory loss, could I assume it could also cause loss of intelligence? I ask because I don’t feel as if I know how to properly diagnose an engine anymore. It seems as I fumble through and then second guess myself. I know I’m getting older so I can’t bend and twist like I once could, but removing parts feels more difficult that it was just a few years.
@minicc26
@minicc26 2 жыл бұрын
I think so I've been depressed for the longest but at 22 was when I felt a drastic difference for the worst. Mind you at 22 I had a pretty bad episode of another mental illness that really threw me over the edge. Since then its felt like my brain has been shot, I am 25 now and proud to say emotionally I'm doing alot better went to therapy have accomplished some major lifestyle changes but I still have the effects of that turning point at 22, my next goal is to intellectually recover what I have lost. Sometimes simple questions at work I cant answer it's annoying but I try not to beat myself up about it. I have faith if I keep working hard my mind can get back to functioning and processing normally. I still have to go through awkward moments when interacting with others, saying inaccurate or nonsensical things but i have to go through those moments and keep pushing forward to get better. I will probably be focusing now on what I eat, exercising, drinking water, reading and other habits that can help with my brain functioning.
@sora1804
@sora1804 2 жыл бұрын
I believe that the our actions are coorelated to how we are feeling, if ur always sad its normal that ur brains gonna be tired and u wont think as much. I bet if something really good happened in ur life u would start thinking better
@jonash5320
@jonash5320 2 жыл бұрын
cognition is definitely impaired. Focus is lost. Dont know if IQ reduces, but performance sure does.
@ketokeko
@ketokeko 2 жыл бұрын
i don't think so
@gettingcalledoutontwitteri1882
@gettingcalledoutontwitteri1882 2 жыл бұрын
@@minicc26 I am 23 and feeling so miserable
@elizabethwilliams6651
@elizabethwilliams6651 4 ай бұрын
Psychedelics are just an exceptional mental health breakthrough. It's quite fascinating how effective they are against depression and anxiety. Saved my life.
@Jennifer-bw7ku
@Jennifer-bw7ku 4 ай бұрын
Yes, dr.sporessss I have the same experience with anxiety, depression, PTSD and addiction and Mushrooms definitely made a huge huge difference to why am clean today.
@Jennifer-bw7ku
@Jennifer-bw7ku 4 ай бұрын
Yes he is. dr.sporessss
@patriaciasmith3499
@patriaciasmith3499 4 ай бұрын
Microdosing helped me get out of the pit of my worst depressive episode, a three year long episode, enough to start working on my mental health.
@APOLLINAIREBARTHOLOMIEU
@APOLLINAIREBARTHOLOMIEU 4 ай бұрын
Can Dr. sporessss send to me in UK?
@Jennifer-bw7ku
@Jennifer-bw7ku 4 ай бұрын
Absolutely, his offerings extend to global delivery, prioritizing complete confidentiality for individuals valuing their privacy.
@tman5634
@tman5634 2 жыл бұрын
Depression as an illness, has a great deal of aspects but for someone never to have been there, just imagine an individual totally losing interest in life, losing interest in anything & everything they used to enjoy. Nothing inspires them, excites them or motivates them anymore. They just want to shut off from the world & in many cases 'just sleep' Some have thoughts of rather not being alive because life is giving them nothing, some very unfortunately go further & try means of ending their life. Some tragically succeed. Then theres the many cognitive issues of such a person & in my case dibilitating mind chatter...something at it's extreme, I wouldn't wish on anyone. I'm fortunate to know & understand things will subside & improve, i'll get my zest for life back in time. I just need to hang in there & make little steps that I know will help. For me (& many others), it's prolonged periods of 'chronic stress' that brings on bouts of depression. Stress were the individual feels overwhelmed & helpless or feels severely let down by unjustices in society. Were people don't seem to care anymore about whats right & wrong, or atleast enough. Real depression is nothing like being fed up for a dew days, it's a totally different animal & experience...it's an illness just like any other illness that comes on & is awful to cruel & tragic for sufferers. Because it's not physical, in that it can't be seen, makes it much harder to associate & sympathise with. This could be the main reason why it's been a tabboo subject for many many years & so, not well understood by most. All the very best to all.
@spacewang6547
@spacewang6547 2 жыл бұрын
I feel very close to this. I’m in a real bad spot right now. I ended up letting it take over me and I no called no showed to my job which was 13-1 scheduled 12 hour days in a factory. I got in contact with my HR and explained the situation I’m in and they pushed me off for 3 weeks until I decided to send a follow up message to see where we were at. I got responded to with a phone call of attitude and told basically that my problem is not a real problem. I’m now sitting here while my head degrades me for make those decisions to put me in this spot, while trying to reason with myself that the reason I put myself in this situation is because I’m really feeling this low. Now I’m left without health insurance, won’t be able to pay my bills much longer and no desire to want to even get back out there because I just feel like a burden to everyone around me and most importantly I feel a burden to myself. I’m 6’5, 235, smart, strong, average looking and 27 with the biggest heart and will to help others because I don’t want anyone to feel this way and the world repays me by me getting taken for granted of and advantage of. Then if I stick up for myself everyone leaves like I wasn’t important. I’m always left isolated. My friends aren’t really my friends, I have two great parents but no one else to call family. With my work schedule dating was impossible and left me isolated from a life. All the meanwhile I’ve kept this on the inside because the truth is people don’t care about a man struggling. I’m left no with no help, no will or energy to roll out of bed, most likely going to keep declining. I’ve been dealing with deep depression since I was 15, no one saw the warning signs of an honors student getting a 16% overall in classes. An athlete not changing for gym or participant, a shop class teacher watching me blank stare at the wall because I made dissociation part of my defensive mechanism. I’ve been faking it till I make it and now I really don’t have the strength in my soul to keep pushing. I don’t fit in with these act first think later and disrespectful humans. I prayed for god to give me some sort of strength but I realized no one is there to answer me. This life is easy, yet people complicate things. Now I’m talking to the internet on a comment from 2 months ago because your post spoke to me. I don’t know what I’m trying to say. I love you and anyone reading this, good luck and I wish you can be stronger than I am to be able to get help when it’s actually there instead of falling to your lowest with nothing to bring you back up. Goodbye.
@tman5634
@tman5634 2 жыл бұрын
@@spacewang6547 I've only just received this notification. The main thing is, be easy on yourself & try & distance yourself from things & others that are negative in your life. Sometimes we can, sometimes we can't, but it's best we try. I'm in a better place than two months ago, thank you, even though i'm currently very poorly with Covid. Please take care, you're not on your own & if you want or need to communicate more, then please do so. All the best
@spacewang6547
@spacewang6547 2 жыл бұрын
@@tman5634 The day after I sent this, I looked at my problems and I went to the doctor and was prescribed Zoloft and medical MJ. Complete change, no more fight or flight feeling at every scenario. Don’t have internal monologue to just get out of bed for hours, I’m up and moving again. My brain is not going 100mph. There’s no more thinking about living, there just living and getting up and going. Thanks, T Man. You changed a persons life indirectly. For anyone else… don’t give up but you have to put in the effort to change your mindset and when you do it will all fall in place eventually. Thank you.
@RedLP5000S
@RedLP5000S 2 жыл бұрын
This has to be the single greatest explanation of depression ever. Thank you for so eloquently describing our illness.
@gwho
@gwho 2 жыл бұрын
normies: "software issues don't exist!"
@valbhipatel5693
@valbhipatel5693 Жыл бұрын
This explains a lot if loss of focus in school, memory loss, and so much more in my case. I always thought I wasn't smart enough or didn't have the ability to focus, but rather, I noticed I'd have these problems the most during my time of depression and severe stress. Thank you for sharing this.
@elisabethholm3259
@elisabethholm3259 Жыл бұрын
You may want to look into ADHD as well! Often people with ADHD also have depression and/or anxiety - someone with ADHD and anxiety :)
@Superman-cy9sn
@Superman-cy9sn Жыл бұрын
So did you find any effective memory booster?
@valbhipatel5693
@valbhipatel5693 Жыл бұрын
@@elisabethholm3259 thank you❤️
@valbhipatel5693
@valbhipatel5693 Жыл бұрын
@@Superman-cy9sn this is a really great question and I hope I can explain my words In the right way. I did not find an effective memory booster. But I started therapy and natural coping methods such as walking, meditation, recording myself talk about my problems and listening to them helps me. I’d would definitely say overtime, my memory got better because now I experience less stress and sort of cut myself off from the people and root which were the main cause of my stress and anxiety. And that allowed me to heal more with time. Which I noticed also helped my memory get better. From what I heard somewhere, and correct me if I’m wrong, our brain acknowledges that there is something causing stress and havoc in our mind, and in order to forget it, we need to have less or no memory of it. So this sort of has to do with memory loss with depression and anxiety. So we can forget the root of the cause. But again, it’s just what I heard and it makes sense that our brain would do that to adapt for our wellbeing.
@theharshtruthoutthere
@theharshtruthoutthere Жыл бұрын
@@valbhipatel5693 For suicidal minds: kzbin.info/www/bejne/ioDHqWCLmNmMbck
@octopusxoctopus
@octopusxoctopus Жыл бұрын
There’s an interesting hypothesis according to which antidepressants move the brain into a state of increased neuroplasticity. So then when having CBT treatment you create new neural paths easier - patterns of hope, positive self talk and acceptance. This means you can also deepen the depression by strengthening the negative neural paths. This helps to explain why some people don’t benefit from antidepressants (as in drug resistant depression) and why the combined treatment of meds+therapy works. This made a lot of sense to me and since learning this I carefully choose how I talk to myself and which patterns I choose to engage in. What and how you think actually translates directly to your brain’s structure and chemistry. So don’t underestimate the power of words.
@minnimau1
@minnimau1 Жыл бұрын
would you say that trying to understand depression by constantly researching (like for ex. this video) peoples experiences and trying to find an answer to the suffering make it worse? It feels like an addiction and I cant stop doing it, scrolling threw reddit or google..
@katejones2172
@katejones2172 Жыл бұрын
@@minnimau1 I think when u find answers that apply to you dig a bit more & find your go to place dig more then let it go!! Otherwise u just keep going down a rabbit hole
@justacinnamonbun8658
@justacinnamonbun8658 Жыл бұрын
Yale Medicine: In other words, we still have no idea how the brain works exactly. But we can put a man on the moon and take pictures of Jupiter and Saturn from a satellite moving at about 500mph through space. Then again, NASA isn't in the very lucrative business of selling psychotropic drugs that at the end of the day don't cure the problem and don't provide long term relief. But makes a lot of 💰💰💰.
@xxphoenixx8398
@xxphoenixx8398 Жыл бұрын
If antidepressants are linked to neuroplasticity and positive thinking, how would you explain a person who tries 4 antidepressants and only "feels better" with the 4th? Anyways, I think that's an interesting hypothesis. Is there a specific name for it?
@mimin123fan
@mimin123fan Жыл бұрын
I've been learning about negative self-talk in therapy and it's so true. The more we talk down on ourselves the more we start to believe it, and we rewire our brain to hate ourselves and we slow down in everything. The world slows down and we see everything in black and white. It's hard to unlearn the negative self-talk once our brains get so used to it
@JohnGeorge-pw2xo
@JohnGeorge-pw2xo Ай бұрын
I was severely traumatized years ago as a teenage. Got diagnosed with cptsd. Spent my whole life fighting cptsd. I suffered severe depression and mental disorder. Not until my wife recommended me to psilocybin mushrooms treatment. Psilocybin treatment saved my life honestly. 8 years totally clean. Never thought I would be saying this about mushrooms.
@MuratBasar-jm9lc
@MuratBasar-jm9lc Ай бұрын
I'm so very happy for you, Psilocybin is absolutely amazing, the way it shows you things, the way it teaches you things. I can not believe our world and our people shows less interest about it's helpfulness to humanity. It's love. The mushrooms heals people by showing the truth, it would be so beneficial for so many people, especially politicians and the rich who have lost their way and every other persons out there.
@DarlingtonFrancis
@DarlingtonFrancis Ай бұрын
Hey mates! Can you help with the source? I suffer severe anxiety, panic and depression and I usually take prescription medicine, but they don't always help. Where can I find those psilocybin mushrooms? I'm really interested in treating my mental health without Rxs. I live in Australia don't know much about these. I'm so glad they helped you. I can't wait to get them too. Really need a reliable source 🙏
@nicholda436
@nicholda436 Ай бұрын
YES very sure of Predroavaro. I have the same experience with anxiety, depression, PTSD and addiction and Mushrooms definitely made a huge huge difference to why am clean today.
@Marylongor
@Marylongor Ай бұрын
Ive done shrooms last month in my house. It taught me how severely traumatized I was from alcohol. I healed from many mental traumas from my past and was able to forgive, let go. Shrooms to me is a remedy not a vice. I even felt more refreshed the morning after. So no hangovers. No depression mood for days. No anxiety.I now have a more calm mind
@StephenHackle
@StephenHackle Ай бұрын
How do i reach out to him? Is he on instgram
@rkara34
@rkara34 Жыл бұрын
I’ve had severe depression for nearly 9 years. I was a straight A student. I’m in College now and it’s been harder to focus, to put concepts together, and sometimes it take me a long time to even count. I don’t remember much of my life, I loose memories quicker, and I can’t remember what I’ve studied for long. It feels like my brain is deteriorating. I don’t even know how to approach the university for help.
@Ichigo29ify
@Ichigo29ify Жыл бұрын
I was there, and i wish i had done more for myself before it got worse, do your best for yourself just like you would advocate for a friend!
@Dandy-lu5xf
@Dandy-lu5xf Жыл бұрын
If you ask for help they’ll tell you to withdraw from the university lol
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of years of server depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@marvinholdinghausen4392
@marvinholdinghausen4392 Жыл бұрын
@@Dandy-lu5xf Which I did. I studied psychology. The Irony, right?
@Dandy-lu5xf
@Dandy-lu5xf Жыл бұрын
@@marvinholdinghausen4392 You withdrew from the university?
@kathykaveh1471
@kathykaveh1471 Жыл бұрын
Depression, among some other mental disorders, is a double whammy. Not only are depressed people suffering and in immense pain that robs them of life and even basic functioning (let alone, joy), people who don't have clinical depression say things like, "You're just too sensitive, lazy, spoiled, ungrateful, etc." And they compare situational depressions (such as loss of a loved one, which has a REASON and a time frame) to clinical depression and think that time will fix it or that "you should be over it by now." Worst of all is when people say, "What do you have to be depressed about?" That's just it. It's not about a reason. It's a chemical imbalance. When the brain is the very organ that needs to function to let you help yourself is not functioning properly, it is nearly impossible to do the things to "help yourself." When people tell me to go for a run when I am so depressed I can barely get out of bed, I equate that to telling someone with a broken leg to go for a run to help their broken bone heal. It's so easy for those who don't have depression to stigmatize, judge and blame people who do, which makes depressed people not reach out to their loved ones for help, which makes them feel lonely, hopeless, and on and on. It's a vicious cycle and a cruel illness. And the "advice" people give to depressed individual is often akin to adding insult to injury. I hope all depressed people who are reading this are hanging in there and not beating themselves up for something that is not their fault.
@julsisisi
@julsisisi Жыл бұрын
❤ yes its really hard and it gets super lonely 😢... one day at a time fam 🙏🤍
@crummybunny777
@crummybunny777 10 ай бұрын
God said unless you're born again spiritually u will not enter the kingdom of heaven also God doesn't judge us by our good works he's judging us by our sins Gods standards are so high he's that HOLY saying oh my God is using Gods name in vain it's called blasphemy ❤ To get to heaven you must believe with all your heart that Jesus died and rose again paid full price for your sins repent and receive his Holy spirit. KZbinrs I recommend Impact videos ministries David diga Hernandez IsaiahSaldivar Mapalo DLM christian lifestyle Billy garham Danial adams Living waters Okay now pray this to be saved and to get to heaven pray out loud Jesus I confess that you are my lord and savior I believe in my heart that God raised him from the dead by faith in your word I receive salvation now Thank you for saving me! I am now reborn a christian a child of almighty God I am saved thank you Jesus! *Be genuine when praying this* Watch videos on how to receive Gods holy spirit on YT God creates Jesus redeems The holy spirit changes Now our good deeds and works we think are good are like filthy rags in the eyes of God Things to get rid of in your home 1sage 2dream catchers 3crystals 4crystal ball 5ouija board 6 tarot and angel cards 7religious statues 8demonic movies music or video games 9soul ties items 10pornography Now like a theif robbing a store, demons won't make it obvious they are there unless they have to. Now know you can't save yourself Jesus said I am the way the truth and the life You have insurance on your house if it ever caught on fire which rarely happens but when it comes to your soul, you play with it like you have forever to make your choice which you don't 150k+ people Die everyday and you never know when it may be you God spent 9 months shaping and forming you before you were born but only 7 days on earth you're fearfully and wonderfully made beautiful in the eyes of God❤ Don't waste time Hearts are deceitful above all things ask God for wisdom and understanding we are just tiny humans with a 3 pound brain and our imaginations cannot go beyond what we already know❤ Your souls is so valuable both Satan and God want it but it's your choice who you will serve You serve the devil when you Lie Hate Blasphemy Disobey Lazy Gossip Gluttony Wanting what others have cause what God has for you is for you he will never deliver your male to someone else's house Hate And unforgivness And cussing murder and more And once you die, you're locked with your choice of where you're spending eternity God doesn't care about you doing more good then bad cause he's not judging that God never said that's the way to heaven So who's lying you or God? Be serious about this❤ God is holy and righteous God is love So either you would play around because you don't believe hell exist or you don't believe you're going there but the bible makes it very clear The path to destruction is wide and easy many are on it the path to eternal life is hard and nerrow very few find it and to get into heaven u can only enter through the nerrow gate❤ You dont have to wait until you die to know if youre going to heaven you can know right now 100% where youre going❤ Satan doesnt rule hell this is a myth when lucifer known as satan now became prideful and rebelled against God he took many angels with him Demons are fallen angels we live in a spirital and physical world so hell was made for punishment for satan and his angels and the reason why people go there is because they Align themsleves with the devil in SIN! Sin separates us from God and the wages of sin is death if youre found guilty with one sin on judgment day you will not enter the kingdom of heaven so the thing is We us humans broken Gods law and jesus paid the fine! So the good news is you dont have to go to hell if you accept him as your lord and savior! God offered us eternal life as a free gift and you receive it by faith! You dont have to work for it you dont have to pay all you have to do is receive it by faith❤ Don't expect Gods best when you always give him your least don't reject him anymore let him come in and change your life❤❤❤❤😂❤❤❤❤❤❤❤❤❤
@crummybunny777
@crummybunny777 10 ай бұрын
​@@julsisisiGod said unless you're born again spiritually u will not enter the kingdom of heaven also God doesn't judge us by our good works he's judging us by our sins Gods standards are so high he's that HOLY saying oh my God is using Gods name in vain it's called blasphemy ❤ To get to heaven you must believe with all your heart that Jesus died and rose again paid full price for your sins repent and receive his Holy spirit. KZbinrs I recommend Impact videos ministries David diga Hernandez IsaiahSaldivar Mapalo DLM christian lifestyle Billy garham Danial adams Living waters Okay now pray this to be saved and to get to heaven pray out loud Jesus I confess that you are my lord and savior I believe in my heart that God raised him from the dead by faith in your word I receive salvation now Thank you for saving me! I am now reborn a christian a child of almighty God I am saved thank you Jesus! *Be genuine when praying this* Watch videos on how to receive Gods holy spirit on YT God creates Jesus redeems The holy spirit changes Now our good deeds and works we think are good are like filthy rags in the eyes of God Things to get rid of in your home 1sage 2dream catchers 3crystals 4crystal ball 5ouija board 6 tarot and angel cards 7religious statues 8demonic movies music or video games 9soul ties items 10pornography Now like a theif robbing a store, demons won't make it obvious they are there unless they have to. Now know you can't save yourself Jesus said I am the way the truth and the life You have insurance on your house if it ever caught on fire which rarely happens but when it comes to your soul, you play with it like you have forever to make your choice which you don't 150k+ people Die everyday and you never know when it may be you God spent 9 months shaping and forming you before you were born but only 7 days on earth you're fearfully and wonderfully made beautiful in the eyes of God❤ Don't waste time Hearts are deceitful above all things ask God for wisdom and understanding we are just tiny humans with a 3 pound brain and our imaginations cannot go beyond what we already know❤ Your souls is so valuable both Satan and God want it but it's your choice who you will serve You serve the devil when you Lie Hate Blasphemy Disobey Lazy Gossip Gluttony Wanting what others have cause what God has for you is for you he will never deliver your male to someone else's house Hate And unforgivness And cussing murder and more And once you die, you're locked with your choice of where you're spending eternity God doesn't care about you doing more good then bad cause he's not judging that God never said that's the way to heaven So who's lying you or God? Be serious about this❤ God is holy and righteous God is love So either you would play around because you don't believe hell exist or you don't believe you're going there but the bible makes it very clear The path to destruction is wide and easy many are on it the path to eternal life is hard and nerrow very few find it and to get into heaven u can only enter through the nerrow gate❤ You dont have to wait until you die to know if youre going to heaven you can know right now 100% where youre going❤ Satan doesnt rule hell this is a myth when lucifer known as satan now became prideful and rebelled against God he took many angels with him Demons are fallen angels we live in a spirital and physical world so hell was made for punishment for satan and his angels and the reason why people go there is because they Align themsleves with the devil in SIN! Sin separates us from God and the wages of sin is death if youre found guilty with one sin on judgment day you will not enter the kingdom of heaven so the thing is We us humans broken Gods law and jesus paid the fine! So the good news is you dont have to go to hell if you accept him as your lord and savior! God offered us eternal life as a free gift and you receive it by faith! You dont have to work for it you dont have to pay all you have to do is receive it by faith❤ Don't expect Gods best when you always give him your least don't reject him anymore let him come in and change your life❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤
@ccaselli7
@ccaselli7 9 ай бұрын
There is so much ignorance about it..its true. It's a physical brain illness, that causes depression.
@brettsfav4
@brettsfav4 9 ай бұрын
Well said!
@RatusMax
@RatusMax Жыл бұрын
I was deep in depression, but then I got out of it. I found my own meaning to life and what I wanted to do for the rest of it. I had to evaluate myself, my emotions, my existence, my everything. Then I had to reason why I should change my life and if it was worth doing. The alternative has no change. No matter what happens, I am alive and can create change with small steps. So long as their consistent and thoughtful. I walked out of it and since I logically did so, I can't fall back into it even if certain patterns that arise come back. When I do I don't beat myself up about it and feel sad. I become aware and stop it. Then start taking the steps forward again. I won't like the first few years, I kept walking backwards and had slow progress. However, now I am moving forward. It's like the snowball effect. Life isn't fair, just, and/or guaranteed and I now accept that. So I now do what makes me function at ease before dealing with anyone else. Then if I have spare time, I look into other's problems. One great thing I realized was to disconnect myself from TV News, Social Media( Except YT, I use it to learn new skills), Netflix, etc. I've gone back to reading, playing offline games, painting, working on small projects at home, etc. Once I limited my online play time to 3 hours per day, my life became different. I really didn't give a crap about what others were doing. I got to enjoy media at my own pace. My depression was caused due to the fact that there is an infinite amount of information around me and I could not consume it all at once. I would never be completed/finished. Moving to books, offline games, painting, projects, etc. Made me see a beginning, middle and end. When I completed something, I felt happy. I also found out I now had time to exercise. All my bodies aches and pains went away after exercising. So I continue that as well. No more was the infinite social media scrolls,infinite videos, infinite online games, I could track progress again in my life. This is how I know, there will be a study that show the dangers of social media. Moderation is key. Everytime I wake up, I decide how I will spend my online time. I have 3 hours because I plan a beginning, middle and end and stick to it. Otherwise, I'll fall back into the old pattern.
@fayizavizuna
@fayizavizuna Жыл бұрын
I'm where you were to be honest social media is hell out of addiction here from this app to this to that i sometimes even see neglecting myself (well i do regret it and vomiting for to change the loop routine) but the thing is it helps me away of thinking too much or overthinking and dreaming which can hurt me because i can't have ways to reach etc. it's like distraction for me because i can't be offline because idk what to do if i try except eating, studying (which i don't even do regularly) and sleep or being in bed no out side or sports or activities well i love all of those things but can't do it just a society and parental control and different cultural boundaries well it might change one day but ik well i don't have depression I'm having full hopes and happy to live more everyday, getting new chance to breath although I'm helpless ik "one day I'll do me and be me" just it's amount of time and growth. So it's maybe i don't wanna feel isolated, confined in 4 walls direction's only so that's why i use phone as distraction and ik it messes up my life routines but well it was from very first. I always think i don't have any mental issues but maybe so over powered, pressured abd and held back. I'm really ending university this semester now I'm 21 (i just want to leave here and be what i want doing whatever i like) hope i might be stepping out of the cage i felt I'm wingless in.
@fayizavizuna
@fayizavizuna Жыл бұрын
Maybe I'm so stressed about things happening around me and everything happened i feel guilty i can't solve nothing i just want see people being happy and healthy and here they dk right from wrong and it's so corrupted that i feel like i have to end all of this- mess but idk how so i just have to witness any horrible things to make me feel bad about myself that can't do anything about it. well i myself is helpless so idk what i can do for someone else out there.
@RatusMax
@RatusMax Жыл бұрын
@@fayizavizuna ​ Don't put the world's problems on your shoulders. One human can't bear it, nor can they single handedly solve it. Start small by volunteering and helping the community locally. Do it with your spare time, try to expand. Do NOT EVER be selfless. Always make sure that before you help anybody, you and your problems are always dealt with. The foundation you build to help others will always have a risk to falter if they are not. It does not make you a bad person to put yourself first. You need to survive in order to help others. EDIT: Also when you help somebody, if possible, try to make them stand on their two feet and not make them dependent on you. This will help them in the long run. The most important thing I can tell you while I was in my self-reflection is that it is IMPOSSIBLE for life to be perfect. Having the idea of saving everyone, stopping evil, Being 100% good, etc. only exist in a perfect world. Once you understand perfection can't exist for life to exist in this universe, you can understand not to beat yourself up too much about things that are happening. As the human is a flawed imperfect creature. Never strive for perfection. Strive to make the next day better than the last. No matter how small the step is. This way you don't have to look too far into the future and you have goals you can make in the present. These small goals start to add up. Let's talk about war. This was the De Facto solution of the past to resolve problems. Our technology was limited, and it was all we had. We evolved to use war as a means to resolve things. It's strange to think that there can be life somewhere in the universe that has never had war and evolved to become intelligent some other way. The predator prey dynamic won out of everything else on our planet. War is essentially started because of the primitive ingrained evolutionary behaviors of the human mind. It is hard to overwrite millions of years of evolution in a matter of a century. We must actively check ourselves every day. It's why someone said "Democracy is one generation away from extinction". If we don't actively check ourselves and teach our children to check themselves, these ingrained behaviors will take over and pure dictatorships are built again. It's the default setting for humans. Being aware of this shows that humans can't be perfect. They can only get to a certain percentage of being perfect. Maybe 75% or something lol. Right now, nobody is perfectly executing democracy in the U.S.A. Otherwise we would not have the same politicians in office for years or a binary system. Yet it seems to be working for now (depending on who you ask lol). So don't strive for perfection. Make a perfect plan and see how close you can get to it before it takes an extreme amount of time and resources to complete. Then make a new plan with all that information that can get around that one. Of course ask for help you are not alone. This is how Newton found his solutions and Einstein as well. They weren't one man who did things alone. They had a lot of help from others along the way. Humans just have this ingrained reasoning to assign a head to things. It's just in their nature.
@fayizavizuna
@fayizavizuna Жыл бұрын
@@RatusMax you really worded well and explained what was growling inside my head whenever my heart locks itself around something I'm not responsible about, thank you so much i feel so happy someone out there far away understands me even a little (no wonder i felt so connected to your comment) i just want them to teach new gen how it's like to be good human and then future will build itself. Really one person can never change nation, country, continent or world so ik that very well but i hope i can help people without losing myself into that process. And i have life, dreams and things I've to accomplish so it's how this life is balance and being patience, again thank you so much well i hope every leader and responsible people will understand this "if we don't actively check ourselves and teach our children to check themselves, these ingrained behaviors will take over and pure dictatorship are built again" that's so right it's all about self awareness, control and redeeming. We can't fix no one until they began to do it i hope my soul that knows that, can accept it.
@sheilaharrington9383
@sheilaharrington9383 Жыл бұрын
Beautiful, Ratus.
@saas4987
@saas4987 Жыл бұрын
from my experience i can say that depression makes me wanna neglect things, especially logical thinking. because more i do so, more i remember past and more i feel horrible. i think this is kind of self defense mechanism to avoid feeling even worse. and more you ignore present and past memories, maybe your brain starts to degrade because it is not used and it gets dusty like all machines do.
@mimimira5412
@mimimira5412 Жыл бұрын
This is definitely how I am right now. How is it going for you have you managed to get out of that state
@regular2435
@regular2435 Жыл бұрын
I went through a depression after a heart break that I caused myself thinking I'd find someone without my ex's health issues. I left her and moved far away at the same time making it impossible for us to see each other and maybe reconnect. Anyways, long after I realized she was my true soulmate and I'd do anything for her. By then it was too late, she'd healed her broken heart and had to move on. I learned that girls don't give exes second chances after enough time has passed. Long story short, there was a chemical composition in my brain that made me depressed, there was nothing I could do to rewire my brain. Therapy didn't help, but exercising did
@jhilamkaranjai9226
@jhilamkaranjai9226 Жыл бұрын
Winning Secret which none will TEACH! kzbin.info/www/bejne/jnTQnZuEoNaKeLs
@jonpato
@jonpato 4 ай бұрын
I hate that I know exactly what you mean
@alingjulie388
@alingjulie388 2 жыл бұрын
the thing is, it’s not really about being sad. it is about feeling numb, at least on my experience way back 2016. that feeling of nothingness always looming and you don’t know when will it end. i could not pinpoint exactly what triggered my depression, but i felt like that it was an accumulation of all major and minor burdens. i was also very active in the church, praying and being a member of the worship team. some of the people in the church knew what i was going through. one morning, a pastor went to sit beside me and told me that i was just lacking in spiritual faith. he thought his words helped, but it did plunge me into a deeper hole. it made me question the validity of my prayers, sung songs, and validity as a Christian. fast forward to today and i can say i am doing way much better. entering the university as a college student, being away from home and living alone somehow did help(?) i am not sure how, but i have discovered something abt me and it’s that i do revel in solitude. oh, i forgot to share that i went to a psychiatrist, and the doctor told my parents that there’s nothing wrong about me, but still prescribed me some meds (i eventually had to stop taking the meds because my mind tolerates the drug so quick that the dosage had to be adjusted) all i want to share is that, just like any parts of the body, the brain gets sick too.
@vincentpaullopez3294
@vincentpaullopez3294 Жыл бұрын
Stating that you lack spiritual faith because of depression is already a totally insensitive to say to a Christian. What about Elijah who lost his will to live until God provided him food? What about David who lamented in his Psalms? Or even Job who lost everything? There are many people in the Bible who expressed their depression too, and yet their faith is so strong. Therefore depression, while it can be a spiritual case, is also a medical one. Sadly, some people do not have an open mind to understand depression. You may have it, but it doesn't invalidate your Christianity. It's not through invalidating advices such as you should pray more or just have more faith to recover from depression. It's about looking on God even if you have depression. It doesn't hinder our faith in itself. But it may hinder us from doing things that God meant us to do. It may even question our faith, doubt on it, but it only proves more that you do have faith. And faith is something that is gifted to us, not earned through good works. And faith is something that cannot be lost. God bless you sister.
@vincentpaullopez3294
@vincentpaullopez3294 Жыл бұрын
Well, I have replied on the spiritual side of your comment, but I might comment on other aspects too. It's a blessing that you've been recovering from it. Sadly, I could not. And it might be next year before I could even do a proper checkup for a doctor about this, even though I'm suffering for 7 years now. Simply because my family may be too stereotypical about mental illnesses and might just tell me I should have more faith too. And also because the city is too far away and I don't have any access to it right now..
@EVNL576
@EVNL576 Жыл бұрын
@lolol But don’t give up on hope. Hope is the backbone of humanity.
@onahnathaniel3090
@onahnathaniel3090 Жыл бұрын
Thank you for sharing
@MK-ut2ee
@MK-ut2ee Ай бұрын
Islam is the answer. You don’t need any pastor. Direct connection to God.
@tessymitch
@tessymitch Жыл бұрын
Psychedelics saved me from years of uncontrollable depression, anxiety and illicit pill addiction.imagine carrving heavy chains for over a decade and then all of a sudden that burden is gone.Believe it or not in a couple years they'll be all over for treatment of mental health related issues
@andersonjemma
@andersonjemma Жыл бұрын
When you've experienced psilocybin,the visions,the feeling that others feel become relatable and real,but when you haven't they could sound weird
@williamspiper
@williamspiper Жыл бұрын
Please does anyone know where I can get them? I put so much on my plate and it really affects my stress and anxiety level .I would love to try to shrooms.
@williamsjames9074
@williamsjames9074 Жыл бұрын
@@ChloeNguyen-gs5hz is he on insta?
@evanssmith5566
@evanssmith5566 Жыл бұрын
Psychedelic is the answer to most severe anxiety and depression... The use of magic mushroom helps one completely get over depression
@JoanPatterson-pv1sg
@JoanPatterson-pv1sg Жыл бұрын
@@williamsjames9074 yes
@EM-ri5dj
@EM-ri5dj 3 жыл бұрын
Really do like the analogy of the city and it stopping. That’s what my depression feels like when I’m depressed and not.
@blveflame
@blveflame Жыл бұрын
To me it actually feels more of a hydraulic override instead of the city not moving
@savannahinparis
@savannahinparis Жыл бұрын
I was able to cure my depression through the following: -meditation -plant based diet -Talk/art therapy -reading G and PG rated books -watching G rated movies -listening to classical/instrumental/uplifting music only -journaling daily -walking daily -being in nature constantly -building Lego sets -painting/creative writing/clay making -baking -Getting 8.5 hours of sleep only at night Starting with severe depression/suicidal thoughts I was able to apply these methods in my life and get better within a few months. I still do this to this day everyone. Now it’s been exactly two years and I’m the happiest I’ve ever been in my life. It takes daily conditioning but if you just keep going you will get better. You are never alone:)
@neetucarpenter7992
@neetucarpenter7992 Жыл бұрын
Where do you live ?? Can I get help from you ??
@savannahinparis
@savannahinparis Жыл бұрын
I’m not a licensed psychologist but I can try to help you if you have any questions for me. You can just comment below this. I don’t feel comfortable giving out my number. But I can help:)
@kaycampbell364
@kaycampbell364 Жыл бұрын
Explain talk therapy when there is no one to trust
@savannahinparis
@savannahinparis Жыл бұрын
@@kaycampbell364 I think talk therapy is beneficial. Once you find someone you can trust it can help. There is always someone you can find to trust. Therapists do want to help you. Give it a try:)
@ujjainidatta450
@ujjainidatta450 Жыл бұрын
Were u under medications?
@gililuigi279
@gililuigi279 2 жыл бұрын
If you're reading this I'm praying something amazing happens for you today.❤️🙏🏼
@rae_xines
@rae_xines Жыл бұрын
It's honestly so interesting seeing people say their viewpoints when it comes to the struggle of mental health and depression. I am someone who's too afraid to ask for help as I find asking for help a 'burden' that others around me shouldn't go through and have to worry about me but I believe one day I'll be able to get out of this mess and go towards the light in finding a future.
@kelleymcfadden9675
@kelleymcfadden9675 Жыл бұрын
I am so sorry you are going through this. My heart goes out to you. Jesus said in His Word that He can give you a peace like nothing this world can give. I'd like to share my best friend's story with you and I know that if you ask Jesus to show you the truth, He will shed His light on you. God bless you. Precious Memories-By Sonya Lakey Family Story Little did our family of six know that Friday evening, September 24th, 2021, would be the last night our family would be complete. We laughed together, played games, sang, and enjoyed listening as our 16-year-old son, Ethan, played the piano for us. I packed a lunch for Ethan for a church mountain hike he was going on the following day. My mother (who was visiting from out of state) and I woke early with Ethan on Saturday morning. He hugged me and smiled, never pulling away or rushing me. He got in the car, waved, said he'd see me later and he loved me. It was hard to watch my "new driver" heading out on his own that morning. As Ethan pulled out of the gate, I turned to my mother and said, "It's just so hard letting go." Little did I know how much "letting go" I was really doing. That was the last time I saw Ethan. He did not make it home that evening. That afternoon, a friend tried to contact my husband, leaving an urgent message to call him back. He tried several times to return the call to no avail. As we were preparing supper, an overwhelming feeling of deep concern for Ethan filled my heart. I quietly blinked back tears. I glanced out the window, half expecting to see a police officer pull up to the house, but no one arrived. However, within a few minutes, a patrol car DID pull into the driveway. In my heart, I feared the worst. My husband and I went out to meet the officer, who confirmed our fears. Hesitantly, he told us our son had fallen off of a bluff and had succumbed to his injuries. Our hearts were crushed; they still are. Yet, in all of our brokenness, deep, continual grief and loneliness, our family has such a blessed Hope and assurance that we will see our dear son and brother again. You see, when Ethan was a young boy, he was saved; he put his faith in Jesus alone to forgive his sins and to take him to Heaven when he died. He realized some very important truths from the Bible that he would want to share with you. His Story Everyone is a sinner. Sin is any violation of God’s Law. God is holy, just and righteous, and He cannot allow sin in His presence. Ethan realized that he - like all of us - had sinned; and his sin separated Him from God. “For all have sinned, and come short of the glory of God; ” (Romans 3:23) “Wherefore, as by one man sin entered into the world, and death by sin; and so death passed upon all men, for that all have sinned:” (Romans 5:12) He understood that, because of his sin, he deserved to spend eternity in Hell. “For the wages of sin is death;” (Romans 6:23a) [Wages: price] “But the fearful, and unbelieving, and the abominable, and murderers, and whoremongers, and sorcerers, and idolaters, and all liars, shall have their part in the lake which burneth with fire and brimstone: which is the second death.” (Revelation 21:8) Ethan believed that Jesus, God’s Son, paid the price for all sin when He died on the cross - because His sinless sacrifice was the only thing that could satisfy the just demands of a righteous, holy God. Jesus was buried in a borrowed tomb, but He arose the third day, triumphant over sin, death, and Hell. Jesus is alive today! “For God so loved the world, that he gave his only begotten Son, that whosoever believeth in him should not perish, but have everlasting life.” (John 3:16) “For by grace are ye saved through faith; and that not of yourselves: it is the gift of God: Not of works, lest any man should boast.” (Ephesians 2:8-9) Ethan was sorry for his sin, repented (turned), and received by faith the free gift that God offered to him. “For whosoever shall call upon the name of the Lord shall be saved.” (Romans 10:13) “...but the gift of God is eternal life through Jesus Christ our Lord.” (Romans 6:23b) Because of this great salvation, Ethan lived his life serving Jesus. He worked hard to spread this Good News to the world. He is alive in Heaven with Jesus today; and because of this great HOPE in Christ, we know we will see him again soon - not because he was a great kid, but because of his faith in the great Saviour! “And I give unto them eternal life; and they shall never perish, neither shall any man pluck them out of my hand.” (John 10:28) Your Story What about you? What if you had fallen to your death that day - What if you were to die today? Where will you spend eternity - Heaven or the Lake of Fire? There will not be any parties in the Lake of Fire. It is a place of eternal torment for those who reject God's Son. The Word of God is very clear that there is only One Way to Heaven. “Jesus saith unto him, I am the way, the truth, and the life: no man cometh unto the Father, but by me.” (John 14:6) We did not know that Ethan would step into eternity that day; however, because he put his faith in Jesus alone for his salvation, Ethan was ready to go. Some day - perhaps today - you will take your last breath here on earth, and you will step into eternity. Where you spend eternity is determined by what you do with Jesus Christ. Will you accept Him or reject Him? You are not promised another day or another breath. Eternity begins soon - Are you ready? “...Believe on the Lord Jesus Christ, and thou shalt be saved…” (Acts 16:31b) “For whosoever shall call upon the name of the Lord shall be saved.” (Romans 10:13) “(...behold, now is the day of salvation.)” (2 Corinthians 6:2c) ********************************************************* If you need more help or if you would like to send a word of encouragement to the family, please go to: facebook.com/GITM-Foundation-113997824650357/ If you don't have a church to attend, we would love for you to join us in person @ Liberty Faith Bible Church in Norwood, Mo. every Sunday morning central time 11:00 A.M., Sunday evening 7:00 P.M., and Wednesday evening 7:00. P.M. where you will hear sound, biblical preaching from God's Word as well as uplifting, godly music. Or you can join our livestream family at: libertyfaith.net Facebook: Reg Kelly-Table In The Wilderness Sermon audio: Liberty Faith Church Pastor Reg Kelly KZbin: Liberty Faith Church Reg Kelly sermons (not livestream, but recorded)
@SingingSuperstar28
@SingingSuperstar28 Жыл бұрын
Do you kinda feel guilty when asking for help? Cause I get that. And it sucks because once you finally gather all your courage to ask for help, you realise that people are happy to support you. It's all a about taking that first step. Maybe you could try asking for smaller things first? I started by asking my parents for a hug
@rachelllm9279
@rachelllm9279 Жыл бұрын
I have felt that too.. I don't know how long you've fought with this but you're stronger than you know 💜 I deal with things that have impacted my mental health for a long time. I reached out a few months ago for the first time and got more support than I imagined I would. My first step was telling someone on TheHopeLine live chat what I was dealing with, they listened and gave me advice on how to tell someone in person. I'd recommend that if you are unsure how to get help, and I'm cheering u on 💕
@chrispypotatoes
@chrispypotatoes Жыл бұрын
you sound just like me. i eventually got to a full on breaking point after a suicide attempt and was in such a poor mental state that i knew if i didn’t get help, my death would end up being a bigger burden on my family than me getting help. so that night that i broke down is the night that i confessed to my mum that i needed to see a doctor, and that i wasn’t ok. i’m now a somewhat functioning human thanks to psychologists and antidepressants. i know how hard it is to reach out for help, i put it off for years. but please know that not getting help will put an even bigger burden on those around you, so please look after them by looking after yourself and reaching out. you’ve got this.
@christinahornsby2848
@christinahornsby2848 Жыл бұрын
I feel the same way
@shivanisharma7814
@shivanisharma7814 Жыл бұрын
My experience was , I did not want to do anything, I just wanted to sleep, people consider me as a lazy person , but I know this isn't laziness, it's different. I am healing now , a lot of changes are in me , seeking balance :)
@Blessed-qg2kb
@Blessed-qg2kb Жыл бұрын
Apne treatment lia
@michaellesniak1310
@michaellesniak1310 Жыл бұрын
Psychedelics definitely has potential to deal with health issues like anxiety and depression , I would like to try them but it's hard to source them here, you
@MirableHarison
@MirableHarison Жыл бұрын
proven very effective in the treatment of various mental health issues aside from other health benefits. Helped me get out of years of depression and excessive alcohol use.
@UopolysGreat
@UopolysGreat Жыл бұрын
​@@MirableHarisonI've been looking to try shrooms, anyone knows where can I acquire some?
@kathleenmcclenahan5701
@kathleenmcclenahan5701 Жыл бұрын
​@@UopolysGreatYes. dr.jeffshroom
@vickiebeaver6843
@vickiebeaver6843 Жыл бұрын
​@@UopolysGreatShrooms are very helpful
@BenAnderson-mg4hu
@BenAnderson-mg4hu Жыл бұрын
​@@kathleenmcclenahan5701sorry to disturb, Is he on insta? I would love to get some for myself.
@arnoldidierariza3450
@arnoldidierariza3450 5 ай бұрын
I suffered severe depression several years ago. I could remember several years ago after divorce with my wife which brought me into my disastrous journey on Alcohol and cigarettes. I suffered severe depression and mental disorder. Got diagnosed with cptsd. Not until a friend recommended me to psilocybin mushrooms treatment. Psilocybin treatment saved my life honestly. 8 years totally clean. Much respect to mother nature the great magic shrooms.
@BestOffer-ii9ny
@BestOffer-ii9ny 5 ай бұрын
Microdosing helped me get out of the pit of my worst depressive episode, a three year long episodeenough to start working on my mental health
@fakiriayoub8087
@fakiriayoub8087 5 ай бұрын
The shroom experience stands as my most remarkable journey, an awe-inspiring encounter that left an indelible mark of amazement.
@HealthyPriestessSophie
@HealthyPriestessSophie 5 ай бұрын
Is he on instagram?
@خواطرإنسان-ي7ث
@خواطرإنسان-ي7ث 3 ай бұрын
laying
@eri_sama
@eri_sama 2 ай бұрын
bot
@catcatcatcatcatcatcat
@catcatcatcatcatcatcat Жыл бұрын
Depression is more than just being sad. But people dont seem to acknowledge that. I know countless people who went to school with me and posted online about their “depression” and “anxiety” but it was very obvious they didn’t struggle with it. And as for the people who say “you dont know what goes on in their personal life/behind closed doors” you’re right. I don’t. But depression is an obvious thing. You can see it clearly from the outside. I couldn’t get out of bed to get food even or to go to the toilet. Nevermind showers, I didn’t brush my teeth or anything. My physical health got so bad because I was so depressed and I’m still recovering. I thought I knew what depression was but when it happened to me I realized I never knew.
@crummybunny777
@crummybunny777 10 ай бұрын
God said unless you're born again spiritually u will not enter the kingdom of heaven also God doesn't judge us by our good works he's judging us by our sins Gods standards are so high he's that HOLY saying oh my God is using Gods name in vain it's called blasphemy ❤ To get to heaven you must believe with all your heart that Jesus died and rose again paid full price for your sins repent and receive his Holy spirit. KZbinrs I recommend Impact videos ministries David diga Hernandez IsaiahSaldivar Mapalo DLM christian lifestyle Billy garham Danial adams Living waters Okay now pray this to be saved and to get to heaven pray out loud Jesus I confess that you are my lord and savior I believe in my heart that God raised him from the dead by faith in your word I receive salvation now Thank you for saving me! I am now reborn a christian a child of almighty God I am saved thank you Jesus! *Be genuine when praying this* Watch videos on how to receive Gods holy spirit on YT God creates Jesus redeems The holy spirit changes Now our good deeds and works we think are good are like filthy rags in the eyes of God Things to get rid of in your home 1sage 2dream catchers 3crystals 4crystal ball 5ouija board 6 tarot and angel cards 7religious statues 8demonic movies music or video games 9soul ties items 10pornography Now like a theif robbing a store, demons won't make it obvious they are there unless they have to. Now know you can't save yourself Jesus said I am the way the truth and the life You have insurance on your house if it ever caught on fire which rarely happens but when it comes to your soul, you play with it like you have forever to make your choice which you don't 150k+ people Die everyday and you never know when it may be you God spent 9 months shaping and forming you before you were born but only 7 days on earth you're fearfully and wonderfully made beautiful in the eyes of God❤ Don't waste time Hearts are deceitful above all things ask God for wisdom and understanding we are just tiny humans with a 3 pound brain and our imaginations cannot go beyond what we already know❤ Your souls is so valuable both Satan and God want it but it's your choice who you will serve You serve the devil when you Lie Hate Blasphemy Disobey Lazy Gossip Gluttony Wanting what others have cause what God has for you is for you he will never deliver your male to someone else's house Hate And unforgivness And cussing murder and more And once you die, you're locked with your choice of where you're spending eternity God doesn't care about you doing more good then bad cause he's not judging that God never said that's the way to heaven So who's lying you or God? Be serious about this❤ God is holy and righteous God is love So either you would play around because you don't believe hell exist or you don't believe you're going there but the bible makes it very clear The path to destruction is wide and easy many are on it the path to eternal life is hard and nerrow very few find it and to get into heaven u can only enter through the nerrow gate❤ You dont have to wait until you die to know if youre going to heaven you can know right now 100% where youre going❤ Satan doesnt rule hell this is a myth when lucifer known as satan now became prideful and rebelled against God he took many angels with him Demons are fallen angels we live in a spirital and physical world so hell was made for punishment for satan and his angels and the reason why people go there is because they Align themsleves with the devil in SIN! Sin separates us from God and the wages of sin is death if youre found guilty with one sin on judgment day you will not enter the kingdom of heaven so the thing is We us humans broken Gods law and jesus paid the fine! So the good news is you dont have to go to hell if you accept him as your lord and savior! God offered us eternal life as a free gift and you receive it by faith! You dont have to work for it you dont have to pay all you have to do is receive it by faith❤ Don't expect Gods best when you always give him your least don't reject him anymore let him come in and change your life❤❤❤❤❤❤❤
@blakehoward2804
@blakehoward2804 9 ай бұрын
It's not that I "couldn't" get out of bed, from my experience, it's just that it is *immensely* harder to do so with depression. That's part of what feeds into the guilt of it all too, that I know I could do the thing if I tried hard enough, but then there would be another thing after it, and it all just feels so overwhelming that I don't even want to try. I bet, if I tried, and accepted that I will have a much lower capability to do things in life when I am having a depressive episode, then I might be able to at least be a little bit productive during those times. Sometimes it feels like I just might as well not do anything if I am going to be mad at myself or have others be mad at me for how little I am able to do during those times. It's hard 😢.
@KhongorzulOdmaa
@KhongorzulOdmaa 4 ай бұрын
@@blakehoward2804exactly
@TimTalley6388
@TimTalley6388 6 ай бұрын
Depression haunted my life from a very young age, and I was put on a bunch of SSRIs as a child in attempt to deal with it. None worked.Psychedelic mushrooms was brought to my attention. It was the first thing that actually had real effects. They should only be used with great care and respect.
@RobPendy
@RobPendy 6 ай бұрын
Been through this conversation before. But someday i wish to experience this when I'm not so terrified of it.
@MichaelLucas-eu8gf
@MichaelLucas-eu8gf 6 ай бұрын
I actually just started the research process of microdosing and all that. Im to the point where I want shock treatment.
@CastroTristen
@CastroTristen 6 ай бұрын
dr.perryshroom is your guy. Got all kinds of psychedelics stuff. Guided me through my first ever experience
@SusanHoskins-df9kk
@SusanHoskins-df9kk 6 ай бұрын
I find it funny if there's any psychedelic therapy 0nline
@MorganSantillanes
@MorganSantillanes 6 ай бұрын
YES, he is dr.perryshroom. There's a lot of potential in psychedelics
@romeza.
@romeza. Жыл бұрын
Ive lived in depression since i was 11,12 cos of my situations that I faced in my childhood. As a victim of child abuse, mental/emotional abuse, loneliness i can say depression diagnosis would be normal for me but my memory hasn’t been weak. My memory didn’t get affected. I rather became more and more aware in my actions and in my self and fulfilled my responsibility as a human cos i know how much it hurts and i didnt want to be the cause to give that to someone else
@lruiz4426
@lruiz4426 Жыл бұрын
Be strong ...and forget about the past... Create ur new future......life is amazing.....soldier...and ur already stronger then 80 percent of humanity. Go live ......something or someone is out there waiting 4 u
@atmosphero7074
@atmosphero7074 Жыл бұрын
U r a hero ❤❤❤
@sidneyysky-nr3dd
@sidneyysky-nr3dd Жыл бұрын
Psychedelics saved me from years of uncontrollable depression , anxiety and illicit pill addiction . Imagine carrying heavy chains for over a decade and then all of a sudden that burden is gone . Believe it or not in a couple years they'll be all over for treatment of mental health related issues .
@BernarditaBuenaventura
@BernarditaBuenaventura Жыл бұрын
I have researched and found out that shrooms are very helpful , it has really helps to reduce anxiety and depression . I would love to try magic mushrooms some day
@AnjeloValeriano
@AnjeloValeriano Жыл бұрын
Please does anyone know where I can get them ? I put so much on my plate and it really affects my stress and anxiety levels , I would love to try shrooms
@Gladyspete
@Gladyspete Жыл бұрын
​@@AnjeloValerianoYes Dr. Mile
@julietfabian1490
@julietfabian1490 Жыл бұрын
I was having this constant, unbearable anxiety because of work stress. Not until I came across dr.mile, a very intelligent mycologist. He saved my life honestly
@kimcamiliamingang1813
@kimcamiliamingang1813 Жыл бұрын
​@@julietfabian1490 Please how do I contact him? Is he on Instagram ⭐?
@richardvalentin584
@richardvalentin584 2 жыл бұрын
I have had clinical depression since I was 18 and now I am 42 and it is a really complex and horrible disease and there is still no medicine to cure it hopefully one day they can find it
@Justanobodybro
@Justanobodybro 2 жыл бұрын
what about ketamine therapy
@richardvalentin584
@richardvalentin584 2 жыл бұрын
@@Justanobodybro I listened but I haven't tried it
@indian4470
@indian4470 2 жыл бұрын
So how u overcome that disease.plzz tell i have that disease
@richardvalentin584
@richardvalentin584 2 жыл бұрын
@@indian4470 exercise, avoid stressful things, change your mindset, serotonin medications, good nutrition and sleep well
@indian4470
@indian4470 2 жыл бұрын
@@richardvalentin584 bro can i escape from depression without medicine?
@fortnitex5500
@fortnitex5500 Жыл бұрын
I'm so happy I finally found ppl taking depression seriously, like it's not just being sad, it's being so numb, not motivated, hating the light of the day, eating problems, staying in bed, AND ALSO FEELING ABSOLUTELY NOTHING ALL THE TIME, idk if this make sence but this is how I felt when I was 14. I was in a very deep depression. And I think it effected my brain so bad, before my depression I was able to focus and remember things, I even had good grades at school, but after everything changed. It killed me tbh
@mr-0074
@mr-0074 Жыл бұрын
@I DON’T CARE but bro your username
@mr-0074
@mr-0074 Жыл бұрын
@I DON’T CARE understandable continue your great work and have a nice day
@666666666ddddddddddd
@666666666ddddddddddd Жыл бұрын
Yeah. Right now I'm not eating much, spending a lot more time in bed, having sleepless nights, having thoughts of hopelessness, suicidal thoughts. Honestly, it's shit, I get how you feel. It's hard to even get enough motivation to be able to do even the most simplest of activities.
@MotherGaiadence
@MotherGaiadence Жыл бұрын
Depression and suicidal tendencies that should be normalized in our society. That’s what a lot of us go through, but we tend to suppress it. Thank you for sharing your story, I can relate because I feel all of those things to.
@ArezHassan
@ArezHassan Жыл бұрын
@@666666666ddddddddddd how are you now?
@BowserTowser
@BowserTowser 2 жыл бұрын
Had depression for years, medicines and later ECT. Relapses in depression kept on happening. 3 years ago I had my first psychedelic experience. It felt like all these connections were restored, everything felt novel. Which contributed to pure motivation, that I even stopped smoking tobacco and drinking alcohol. I feel able to enjoy pure existence without stimulants, depressants or anti-depressants.
@thehandliesthandle
@thehandliesthandle 2 жыл бұрын
i microdosed LSD, and for two weeks didn't have as intense anxiety which ive always had, i didn't have the urge to abuse caffeine which has always been my unbreakable habit, i slept well even though i have had a lifetime of insomnia. theres something to psychedelics. i had all of those problems consistently for my whole life and a miniscule dose of LSD fixed it for two weeks. very strange. it didnt seem to make my mood good, but it seemed to break negative thought loops i have which made things easier
@anasmalaika
@anasmalaika 2 жыл бұрын
I can understand you guys because I have already started my ketamine infusions and I’m already noticing improvements from my depression and anxiety. I hope more different successful ways of treatments will be approved very soon 🙏🏻. If you haven’t done already,try watching videos on the role of psychedelics in the treatment of mental illnesses. 🙏🏻
@stickinug
@stickinug 2 жыл бұрын
I stopped hallucinogens a long time ago but when I was using them, that was the only time in my life that the depression was fully gone. It didn't "fix" me, though, as the depression came right back about 5 months after I last tripped.
@terrellsmith6715
@terrellsmith6715 2 жыл бұрын
@@stickinug so trip every 5 months
@LiviTech
@LiviTech 2 жыл бұрын
What psychedelic did you use?
@and14ara56
@and14ara56 Жыл бұрын
The conversations happening in this comment section make me feel so much more normal and less alone. The problem is I’ve brought up these concerns at school and at work and in book clubs and with therapists and doctors and I’m always treated like these concerns are extremely abnormal. These conversations are needed if we really care about supporting each other but the shame that comes when we speak of these things in any environment needs to be addressed.
@shashwat2591
@shashwat2591 Жыл бұрын
Hope you are doing and will do better, keep the positivity and hopefulness intact at any cost
@richardlopez2932
@richardlopez2932 2 жыл бұрын
The opposite of depression isn't mania or happiness. The opposite of depression is well-being. It's a matter of having health to begin with, and then figuring out what an individual actually needs in their life to function in a reliable and satisfying way.
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of years of server depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@lil18thletterking77
@lil18thletterking77 Жыл бұрын
@@Trica_lover isn't that illegal in the Us?
@Trica_lover
@Trica_lover Жыл бұрын
@@lil18thletterking77 people says it's illigal But I have always been getting them safely from them and nothing happened
@goofball2228
@goofball2228 Жыл бұрын
I had depression as a teenager after the pandemic. Even after I overcame my depression, I felt like my brain didn’t work the same as before. I have a harder time with memory and visual processing skills than I used to.
@shashwat2591
@shashwat2591 Жыл бұрын
It's okay to change as change is the only constant, we all change whether for good or bad is not under our control, don't let it demotivate you, you are still you, stay positive
@goofball2228
@goofball2228 Жыл бұрын
@@shashwat2591 ty
@nairyziudanga1140
@nairyziudanga1140 9 ай бұрын
How did you able to get over your depression?
@trailsofsamurai4975
@trailsofsamurai4975 7 ай бұрын
Avoid antidepressants now,do yoga and meditation
@goofball2228
@goofball2228 7 ай бұрын
@@nairyziudanga1140 well I started exercising and eating healthier and I stopped isolating myself. I also went to therapy and tried some antidepressants
@ThomasUrah
@ThomasUrah 9 ай бұрын
Psilocybin DMT, mushrooms and psychedelics, as a whole, have shown substantial promise as beneficial agents that can truly aid individuals grappling with mental health difficulties.
@ArvinMaih
@ArvinMaih 9 ай бұрын
I totally agree! DMT, Psilocybin mushrooms and psychedelics in general have shown great potential in helping people with mental health issues. It's truly remarkable how effective they can be in treating depression and anxiety
@DaveFarhat
@DaveFarhat 9 ай бұрын
Can you help with the reliable source I would really appreciate it. Many people talk about mushrooms and psychedelics but nobody talks about where to get them. Very hard to get a reliable source here in Spain. Really need!
@DannyFellon
@DannyFellon 9 ай бұрын
I can say Dr.Jaffet is the man for you....
@YundaGregg
@YundaGregg 9 ай бұрын
Dr. Jaffet sure has pure psychedelics products.
@DaveFarhat
@DaveFarhat 9 ай бұрын
How can I reach out to him? Is he on instagram
@Yoyoadventure
@Yoyoadventure 8 ай бұрын
Thank you for addressing such an important subject. It’s hard when you feel alone and you have to go through that on your own
@TheSteelDialga
@TheSteelDialga Жыл бұрын
One of the biggest things that helped me get through depression or depressive states of my life was my intense workouts. Taking care of yourself physically is super important to your mental health. People separate these two groups, but they share the same body. Your brain is connected to every part of your body, so it makes sense that both mental and physical health should be accounted for. This is something I learned about from one of Dr. Rhonda Patrick's podcasts (FoundMyFitness). She's fantastic.
@kimgloria6094
@kimgloria6094 2 жыл бұрын
I've had depression my entire life. With two break downs in between . My last major episode I could not function and spent years in bed. Years after being in bed I got in remission. However, my brain felt as if it were damage and unhealthy . I could barely string a sentence together. I still suffer from language difficulties . Is this common in major depression. Thank you.
@aimalkhan4609
@aimalkhan4609 2 жыл бұрын
Yeah, I ended up having the same problem. Depression affects your cognitive abilities.
@discipleofjesus719
@discipleofjesus719 Жыл бұрын
Hey I’m sorry to hear that and I really do hope you’re doing alright. May God bless and strengthen you! “Come to me, all of you who are tired and have heavy loads, and I will give you rest.”- Jesus ‭‭Matthew‬ ‭11‬:‭28‬ ‭‬‬
@Detested-t9d
@Detested-t9d Жыл бұрын
Same having trouble in speech like mixing words and memory loss, overthinking, headaches,severe bodyache, feeling of numbness like no value of existing as feeling neither happiness nor sadness,no feeling of enjoyment,just stuck between the peoples who don't know about something like mental illness. Don't know how will i end up Literally no one really cares neither parents nor frnds Wishing to have death but still have a low feeling of living but life demotivates me whenever i stands up to move on✨
@Detested-t9d
@Detested-t9d Жыл бұрын
Wishing for fellow survivors to get well soon May Almighty ease for everyone
@kimgloria6094
@kimgloria6094 Жыл бұрын
@@Detested-t9d I know exactly what you mean. Motivation is zero when your are depressed. When people would tell me to exercise I want to scream because I can barely move much less exercise. What you are describing is " anhedonia " It's actually worse than depression because you are numb. Much like a zombie. It's a lack of emotion of any kind. I could not taste food , I could cry. I couldn't laugh, I felt no love, no joy , no happiness , no anger.....Nothing !!! I was an empty shell. It's is a living hell. I had it when I had my nervous break down major depression episode that lasted for YEARS. At that time I wanted to give my pets away. Because I could not love them, nor could I care for them. I just wanted to be alone in my hell and numbness. It was painful not to be able to feel. I thought about taking my own life everyday. But, That's not the answer and it causes pain to others. But I know the isolation from having mental illness. But, It can get better. Do not loss hope. I'm better than I was and I was so so so sick, I could not function at all.!!! . It took an expensive psychiatrist and years and years of all different kinds of medications. I'm better now, But , I am never out of the woods because there is always an episode around the corner.
@gem3778
@gem3778 Жыл бұрын
Only people who have lost someone to depression can understand how traumatic it is for the entire family. Please take care of yourselves.
@pabitragautam2170
@pabitragautam2170 Жыл бұрын
I have lost my brother ❤
@APPB738
@APPB738 Жыл бұрын
I have lost someone to the devastating damages of psych meds
@jimwilliams3816
@jimwilliams3816 Жыл бұрын
It is always heartening to see depression in particular, and brain activity in general, described in terms of complex neurochemical functions. Basic brain science ought to be a standard part of K-12 education. I think the absence of that, coupled with some relics of behaviorism in psychology, contributes to a general sense for many that the brain is some mysterious and largely inert region of the body, which simply houses thoughts and emotions, all freely chosen. Those of us who have experienced serious divergence from typical brain function, like depression, are familiar with the sensation of neurological functions gone awry. While therapeutic approaches and neuroplasticity can be effective in many cases, it is not always easy of even possible to “think” your way out of brain dysfunction. It can be like trying to start a car that has water in the tank.
@jimwilliams3816
@jimwilliams3816 Жыл бұрын
@ww ww Yep, "know but not feel" is a good way to put it. I have issues with hypofrontality/low dopamine and hypervigilance, which can push me either to fight/flight or depression (or both). If my prefrontal cortex is doing well enough, it can explain things to my limbic system, and I feel like a human being. Other times, it's too tired to win any such fights, and plays a bystander as the limbic system runs wild. At worst, it's so weak that my amygdala and sympathetic nervous system can outright suppress it, or tell it what the deal is...which, as far as my amygdala is concerned, is that everything sucks and we're all gonna die.
@666666666ddddddddddd
@666666666ddddddddddd Жыл бұрын
Watching this whilst currently suffering from severe depression. I find neuroscience very fascinating, being able to understand how the parts in the system all interrelate. It's absolutely amazing just how far science has come!
@Daniel-Trust
@Daniel-Trust Жыл бұрын
👆👆check them out they got the best deals at a very reasonable price 🍄😀 they help with depression and anxiety
@crummybunny777
@crummybunny777 10 ай бұрын
God said unless you're born again spiritually u will not enter the kingdom of heaven also God doesn't judge us by our good works he's judging us by our sins Gods standards are so high he's that HOLY saying oh my God is using Gods name in vain it's called blasphemy ❤ To get to heaven you must believe with all your heart that Jesus died and rose again paid full price for your sins repent and receive his Holy spirit. KZbinrs I recommend Impact videos ministries David diga Hernandez IsaiahSaldivar Mapalo DLM christian lifestyle Billy garham Danial adams Living waters Okay now pray this to be saved and to get to heaven pray out loud Jesus I confess that you are my lord and savior I believe in my heart that God raised him from the dead by faith in your word I receive salvation now Thank you for saving me! I am now reborn a christian a child of almighty God I am saved thank you Jesus! *Be genuine when praying this* Watch videos on how to receive Gods holy spirit on YT God creates Jesus redeems The holy spirit changes Now our good deeds and works we think are good are like filthy rags in the eyes of God Things to get rid of in your home 1sage 2dream catchers 3crystals 4crystal ball 5ouija board 6 tarot and angel cards 7religious statues 8demonic movies music or video games 9soul ties items 10pornography Now like a theif robbing a store, demons won't make it obvious they are there unless they have to. Now know you can't save yourself Jesus said I am the way the truth and the life You have insurance on your house if it ever caught on fire which rarely happens but when it comes to your soul, you play with it like you have forever to make your choice which you don't 150k+ people Die everyday and you never know when it may be you God spent 9 months shaping and forming you before you were born but only 7 days on earth you're fearfully and wonderfully made beautiful in the eyes of God❤ Don't waste time Hearts are deceitful above all things ask God for wisdom and understanding we are just tiny humans with a 3 pound brain and our imaginations cannot go beyond what we already know❤ Your souls is so valuable both Satan and God want it but it's your choice who you will serve You serve the devil when you Lie Hate Blasphemy Disobey Lazy Gossip Gluttony Wanting what others have cause what God has for you is for you he will never deliver your male to someone else's house Hate And unforgivness And cussing murder and more And once you die, you're locked with your choice of where you're spending eternity God doesn't care about you doing more good then bad cause he's not judging that God never said that's the way to heaven So who's lying you or God? Be serious about this❤ God is holy and righteous God is love So either you would play around because you don't believe hell exist or you don't believe you're going there but the bible makes it very clear The path to destruction is wide and easy many are on it the path to eternal life is hard and nerrow very few find it and to get into heaven u can only enter through the nerrow gate❤ You dont have to wait until you die to know if youre going to heaven you can know right now 100% where youre going❤ Satan doesnt rule hell this is a myth when lucifer known as satan now became prideful and rebelled against God he took many angels with him Demons are fallen angels we live in a spirital and physical world so hell was made for punishment for satan and his angels and the reason why people go there is because they Align themsleves with the devil in SIN! Sin separates us from God and the wages of sin is death if youre found guilty with one sin on judgment day you will not enter the kingdom of heaven so the thing is We us humans broken Gods law and jesus paid the fine! So the good news is you dont have to go to hell if you accept him as your lord and savior! God offered us eternal life as a free gift and you receive it by faith! You dont have to work for it you dont have to pay all you have to do is receive it by faith❤ Don't expect Gods best when you always give him your least don't reject him anymore let him come in and change your life❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤
@shandanakhan2424
@shandanakhan2424 Жыл бұрын
It’s like moments just get erased from my mind and it’s not even two minutes since they’ve happened. My communication has been impacted so much that I second guess myself. I cannot even defend myself or confront people because I hardly ever remember what had happened at a certain instance. I wish people understood the struggle of persistent gloom and sadness. The feeling of never feeling full again. Never feeling like yourself or confident enough. I just wish… it’s so hard to work twice as hard yet when you look back it would take you half the effort and time to do the same thing you struggle to do after being depressed. I low-key feel I have adhd and today found out about literal thinkers in autistic people.. not saying I have autism but it answered my worry of why I think the way I do.
@calc9670
@calc9670 Жыл бұрын
Literally like I feel like I’m just dumb I can’t talk or think anymore i feel like something is wrong with me
@brittanycamara3563
@brittanycamara3563 Жыл бұрын
I feel this way too it makes work really difficult and stressful cause I feel incompetent. I’m a lab tech
@nyatt
@nyatt Жыл бұрын
@@brittanycamara3563 i wanted to go to grad school and then work in a lab also but now with my grades im not sure theyll take me, all becuase i've been dealing with this for so long and can hardly function anymore :/
@Fear_Therapy
@Fear_Therapy Жыл бұрын
I'm always fascinated by the science of mental health. ❣😍
@kittycatmeowmeow963
@kittycatmeowmeow963 Жыл бұрын
Same here.
@argonhelix8394
@argonhelix8394 Жыл бұрын
I never knew depression until i experienced it.The dark moments your brain goes into.Its like going into the darkest tunnel and not moving at all.
@amandarecoveryjones8216
@amandarecoveryjones8216 Жыл бұрын
For me, depression is a vicious and tormenting cycle. Meds kept me numb in a way but also very sleepy and not wanting to do anything at all. Without meds, I'm doing a lot more but dealing with the torment, rumination and even the false belief that I'm well enough to live as if I've overcome. All I do now is turn to God and take one day at a time......
@ascend555
@ascend555 Жыл бұрын
Daily meditation and prayer helps too
@mandibendavid9350
@mandibendavid9350 Жыл бұрын
I’m just scrolling down reading all those hard comments and I gotta say to all of you champions out there and those who’s reading this that suffer from depression do not give up keep on fighting there’s still HOPE
@mandibendavid9350
@mandibendavid9350 Жыл бұрын
That’s great to hear god bless you. Btw didn’t know mycotrippy could help
@liamc7097
@liamc7097 Жыл бұрын
Short version: We still don't really know
@lennard4454
@lennard4454 2 жыл бұрын
First of all TEACH for GODDAM IN SCHOOLS that this exists and that people have to look out for their mental health. This alone would probably prevent many depressions and reduce the course of the desease in many cases
@KWifler
@KWifler 2 жыл бұрын
That's why people used to have duels to the death! If anything harms your mental health, they wanted to make it gone for ever.
@-astrangerontheinternet6687
@-astrangerontheinternet6687 2 жыл бұрын
Taking responsibility for one’s own education and the education of their loved ones would help solve depression much more than cries that something else fix it for ya. 100%. May you understand and find peace.
@theaudiobookshop2220
@theaudiobookshop2220 Жыл бұрын
totally agree
@tylerscudder9358
@tylerscudder9358 2 жыл бұрын
The key to defeating depression is to defeat your self. Defeat the part of u that is scared to push boundrys and make u happy with your life. Overcome and transform your inner self. But is easyer said then done. Use your fear to your advantage.
@Ice.muffin
@Ice.muffin 2 жыл бұрын
You are one of the very few intelligent ones it would seem.
@highlyindian4162
@highlyindian4162 Жыл бұрын
It's not how it works. It's not a heartbreak or something.
@DJ-ll9hv
@DJ-ll9hv 9 ай бұрын
I was driving somewhere today playing this song I enjoy that’s calm and smooth and I felt like a wave of emptiness come over me. There are many people in this world, many with families, in relationships and happy about the holidays. I don't have a particular place in this world and if I disappeared now not much in the world would change.
@jessilu540
@jessilu540 9 ай бұрын
Your words actually described my situation and it made me feel less alone. I wish you all the best and you are a fighter!
@emmalouie1663
@emmalouie1663 6 ай бұрын
It's true. Lots of people are very unremarkable. Millions of people come and go over centuries and most of them we don't know about. But is this a very KEY point about depression/anxiety that some people from childhood maybe feel they have NO PLACE in the world. I know that is a feeling I have probably had from the age of maybe 5 years old or earlier. I would say this is due to parental/family neglect and mistreatment but then doctors try to sell people pills. What is the real issue is it family connection problems?
@gcks1234567
@gcks1234567 Жыл бұрын
Hardest thing for me is getting the right people to understand it’s frustrating because when i land in this depression/isolation I block everyone n everything in life I space off in my bed for day’s I’m trying to figure out when I’m doin better cuz I can’t live experiencing this darkness much longer I’ve Ben through a lot in. These past 5 years sometimes I feel like those hard times really did something that now it’s like a sickness because when I isolate myself I don’t think nothing my body just wants to be in bed with very little energy almost nothing I hate this shit but now slowly I’m trying to fight back on new things I’ve never thought of trying like therapy, church etc fingers crossed … god loves us we gota push forward ❤
@kiiriig7762
@kiiriig7762 Жыл бұрын
Depression for 3 years and slowly coming back to my studies it took a whole day to understand one topic of my studies. Back then I was lil quick to understand and learn what I studied but now it’s so hard.
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of many years of server depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@MJ-uk6lu
@MJ-uk6lu 6 ай бұрын
Hey, it's alright. When I took calculus 1 I never really understood much.
@honeytea8354
@honeytea8354 2 жыл бұрын
Ah no wonder I've been so forgetful...But from being so suicidal at the age of 11-12 to knowing Christ I've felt love and accepted for who I am. I've finally found Someone who understands me, is patient with me when I fail and Who supports me no matter what. And I know He will never abandon me! Life's not always great, but, I am always secure and loved dearly and that's all 11 year old me ever wanted.
@Midnight-vg8tk
@Midnight-vg8tk Жыл бұрын
I'm so happy for you! thats really amazing to hear. I hope it all goes well for you.
@honeytea8354
@honeytea8354 Жыл бұрын
@@Midnight-vg8tk Thank you so much for your kind words
@kelleymcfadden9675
@kelleymcfadden9675 Жыл бұрын
Jesus is the answer. Keep running to Him Honey!
@honeytea8354
@honeytea8354 Жыл бұрын
@@kelleymcfadden9675 thank you for the sweet reminder! :D
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of many years of server depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@freeckotreecko
@freeckotreecko 6 ай бұрын
I completely lost 3 years of my college life due to depression. The people I studied with, their names, faces, teachers, nothing. The only thing I remember is the mistakes I made, the dark thoughts, cutting myself, feeling tired, down and angry. It was hell. Right now I won't say I'm okay, just finished honors and I'm finding it hard to cope with life. Looking for jobs, life in general, parents fighting, everything is again getting to me. I don't feel okay. After Covid I was okay for 2 years and I think it's coming back. The only difference is I don't want to cut myself. That's good I think.
@emmalouie1663
@emmalouie1663 6 ай бұрын
I quit college due to the George Floyd political crap explosion in schools. The program I was in required me to take an anti-racism course which turned out to only target and label white-phenotype people as inherently racists. The course was being taught by an Islamist. The whole thing was weird as I wasn't studying religion, sociology, or politics. The instructors were using racial slurs targeted at White students. I contacted the Dean of Students office who hung up on me. I was already stressed, tired, depressed, dealing with other things in my PERSONAL life and then the school decided to attack me due to my race/skin color when it had nothing to do with my area of study. It was a nightmare. It was exactly NOT what I needed. I just needed to get through school without all the political crap being imposed on me. The Islamist instructor wanted students to do an assignment where they all video recorded themselves on camera making an oath of allegiance to HIS political cause. I thought it was a violation of constitutionally protected rights. It's compelled speech. Something was very wrong in that school. I left. I lost my scholarship etc. All I wanted to do was get the stupid degree and go get a stupid job and move on with my life. I don't even have health insurance like I don't talk to counselors or anything. School goes out of it's way to ADD ON EXTRA stressors for students. They don't want to hear from me. They claimed they created "alternative educational options" but after 3+ months they still haven't put that in writing. I'm bascially black-listed from the school for not following their political crap and the courses cost $1,000+ each... I can't believe I lost the scholarship I had. The whole thing has been such a nightmare. I'm not wealthy. I didn't just pick up and start all over at a different school.
@freeckotreecko
@freeckotreecko 5 ай бұрын
@@emmalouie1663 I'm sorry for the late reply. The irony is I'm muslim too, but damn! I'm from a completely different country but I am quite familiar with USA's politics but this is on another level. Bruh this is beyond my understanding. How can everywhere there be politics. Well my country ain't better with politics but at least here you're not forced to do what you went through with the oaths and shit.
@apassingbyno1
@apassingbyno1 10 ай бұрын
Joy or happiness and emotion in general isn't a constant state of being. Depression is. It's just masked away by emotions. I would describe depression as an amalgamation of all things negative that eats away at a persons outlook of life. It is dangerous because it narrows down your vision, making you focus more on the negative things, making it stronger. It doesn't go away. It can be suppressed by positive stimulations, but it would always come back. Even a daily dose of happiness cannot ensure its suppression. To deny it is to feed it. To acknowledge it is to feed it. It hides away itself in the shadows of joy and success, beneath every sigh of relief. To ignore it is pointless. To fight it is endless. But there's one thing it cannot feed on. Hope. Not from others, but from within. Your own self. Others cannot give you hope, they can only give you reasons so you can give it to yourself. Make no mistake hope cannot entirely defeat depression, it can only keep it at bay, giving yourself enough time to live out your life, hope some more, and repeat the process. Fighting depression is tedious. Depression would only win if you give up hope. So don't give it up. Another thing people always talk about is that you can't fight depression alone. Actually you can. It's just harder. Also, people think that depression only wins when the person who has it has taken their own life. No, depression has already won when it has overwritten your outlook in life. When you feel like everything has no meaning anymore. When you've felt time passing by, but all you gain is age. When you're alive but not living. At this point, it's fair to assume that you've given up hope. But it's never too late. When you're still alive there is always hope. Even if you've given it up, hope doesn't give you up. All you have to do, is give it a chance. Give yourself a chance. Give life a chance. Alone? Reach out. Overwhelmed? Give yourself space. Easier to see the world in black and white, but there's more to it than that. Sometimes it is just black and white, but that's acceptable. I've got a lot more to say but the point is just you just have to live through everything. Everything is part of life, and the hardest part is living. Every bit you gain along the way is your reward. Every bit you lose? A lesson.
@jyosthnadevilakili7452
@jyosthnadevilakili7452 Жыл бұрын
I have almost all the symptoms of this.... Crying for no reason all the day, low energy, loosing self confidence, sensitive over small things 😢😢even not able to speak with others ect. But now I'm 👌ok and iam feeling well now...... The only thing I learnt in this early phase of depression is to motivate yourself to come out of this problem.... 🙂👍 So, be happy by avoiding over thinking 🤔😡❌ and keep confidence upon yourself !!! 😇❤
@YourMom-iy6cv
@YourMom-iy6cv Жыл бұрын
@Elijah Dick isn’t it expensive
@dewaldsteyn1306
@dewaldsteyn1306 2 жыл бұрын
I was bullied in school a few years ago to the point where i literally got depressed. I think i still have a little bit of depression. Plus after i got treated for it, and it faded away, i got adhd and anger issues to this day, and i swear i even got memory issues because of it.😭 And this vidoe actaully helped me to understand it better👍
@thefirstsin
@thefirstsin 2 жыл бұрын
Damn ur lucky it faded mine however.. its tough
@lizriveratoro8729
@lizriveratoro8729 2 жыл бұрын
I don't Enjoy eating anymore. I barely eat. My short memory doesn't work anymore. It's like deleting everything of work, task including simple things of school of my children or my job.
@roshaney
@roshaney 2 жыл бұрын
I remember everything about the traumas I went through in 2020 but I cannot remember if I ate 15 minutes ago
@aml8760
@aml8760 Жыл бұрын
Same
@Guys_Love_Each_Other
@Guys_Love_Each_Other 5 ай бұрын
so... have u tried anything to improve ur situatioon
@NolanGreener777
@NolanGreener777 Ай бұрын
Jesus loves you and He can take that depression away❤️🕊️ all you have to do is ask❤️🕊️
@ruthvalentine6756
@ruthvalentine6756 Ай бұрын
THIS!!!
@techfest2359
@techfest2359 Жыл бұрын
1.Physical excercises like Running,Jogging. 2.Breathing excercise Pranayama. 3.Atleast 1 hours Meditation. You will be free from Depression.
@stargirl1743
@stargirl1743 25 күн бұрын
I was in depression for around 2 years. The patterns kept on repeating. I'm currently out of it, but the experience was a huge struggle. Memory loss, high stress which caused me hyperthyroidism, pain all over body, constantly falling ill, weak immunity, minor insomnia, regular gut problems, Repetitive Gastritis and GER, unable to process emotions, etc. I came out of it with my parents help earlier this year, I am 17 rn. I acknowledge all emotions and decided to let go of past, I came out of it pretty slow and am still healing from all the damage my body went through.
@keishaabreu393
@keishaabreu393 Жыл бұрын
I got severely depressed the same year that COVID hit the US and grief/guilt ruined me. I couldn't eat, get out of bed, couldn't eat well, couldn't focus on my studies, didn't want to go to work, and I felt like my life was over. Today I am doing better but it still affects me and is not 100% cleared, this illness is not just a feeling of immense sadness, there's A LOT more to it which more people should understand.
@Babarathompson556
@Babarathompson556 Жыл бұрын
Look up☝☝this handle on iñstàgram. They're a reliable supplier for Psychedelics & microdosing products which helps take care of your depression and anxiety and they also delivers securely to your location💯. Their products also come with a microdosing guide book.
@shashwat2591
@shashwat2591 Жыл бұрын
Glad you are doing better, getting better, hope you find supportive people, you have pushed through this and you always will
@val4177
@val4177 Жыл бұрын
I sometimes wonder what it would feel like to have a brain that doesn't have depression and anxiety...would I have been able to achieve more if I hadn't had these diseases in my brain..?
@shashwat2591
@shashwat2591 Жыл бұрын
Some questions can only be wondered about with no answers, but you are still here and pushing, I wish you well
@arslan3158
@arslan3158 7 ай бұрын
I can totally relate. Would I have been successful in life. If I didn't deal with depression. But the key is staying busy and staying positive. You will come out of it. Stay strong 💪
@cabellero1120
@cabellero1120 Жыл бұрын
It's harder to face Depression Alone ( when you don't have children or a significant other) Somehow, you find strength within you.
@Alecto44811
@Alecto44811 Жыл бұрын
I was always happy, motivated, and productive. People who had depression were just lazy to me, just do things? Until I went through trauma in my life and I seemed to develop something like depression. It's definitely not just laziness. Sometimes it was even physically painful. Horrible disease.
@msnV031
@msnV031 4 ай бұрын
Ive had depression since i was around 12 but when i turned 14 i was definetely at my worst and from that point on it was really clear that it was depression that i was struggling with for those years. (im 18 now) and ofcourse i knew where it came from (for the most parts) but ive never really indulged myself in what it actually does to your brain so this was really interesting to say the least. I also liked that everything got explained with so much details because i highly believe that when you get depression, from the first time you have it, its kind of always there and it never fully goes away again. So its really interesting to learn about how that exactly works.
@mikebrown41182
@mikebrown41182 4 ай бұрын
You’re young. I hope it will works out for you, future looks promising. As said in the video, one treatment does not fit all. No one should have to endure depression, or true clinical depression. I’ve had it since highschool 2004, now 20 years later i still have depression, so from 15 to 36, longer than i have lived without it i have struggled with it. Now it’s very individual so whatever works for you, might not work for me kinda concept. But hang in there, you will be better 👊🏼.
@GoldJustin-zs9ps
@GoldJustin-zs9ps 4 ай бұрын
I will recommend you to my mycologist who I get all psychedelics from
@GoldJustin-zs9ps
@GoldJustin-zs9ps 4 ай бұрын
Drluckytrips
@GoldJustin-zs9ps
@GoldJustin-zs9ps 4 ай бұрын
Dude is on Instagram
@hamidrezaasgary6045
@hamidrezaasgary6045 Жыл бұрын
I just open a youtube and i saw this video in atime that actually im struggling with anxiety and depression. I wanna say thank you for giving informations about this one for me .i wish all the people who are like me become well and happy.
@edonakrasniqi8147
@edonakrasniqi8147 2 жыл бұрын
It’s sad that people in this generation seeing depression as trend and make the symptom not taking seriously anymore
@ronnie3235
@ronnie3235 2 жыл бұрын
'This generation' has more mental health awareness than previous generations. It's a good thing. 😐
@psychedelicgulag
@psychedelicgulag 2 жыл бұрын
As a sociologist with major depressive disorder, I am always disappointed at the approach psychology takes; as if one could understand not only the causes of depression but also the possible solutions without addressing the overwhelming influence of environment. We do not exist in a vacuum. Without questioning the nature of our social systems and their impact on our health, no matter how deeply you look into the brain, you will only see half the picture at best, and at worst you will continue to push a narrative that essentially says, "the problem lies with the individual." I firmly believe nurture has a greater impact on health and behavioral outcomes than genetics. It's not either or of course, but it seems to me psychology does not address the most important factor: our material and social environment. To anyone reading this that suffers from depression, you are not alone. Although I have no friends anymore, and I know no one (besides my mother) wants to be around me, I also know there are almost 8 billion people in the world. I know many of them must feel the way I do. I don't think we are all that different fundamentally from one another. Like I said, nurture has had it's impact on all of us and no one chooses what family, class, race, sex, gender, etc. to be when they're born, therefore, they have no control over how they are nurtured. I think by acknowledging this we could potentially start to address the systemic causes of depression and thus create a society in which future generations are not burdened by so much mental illness. It's something worth fighting for because I would not wish this illness on my worst enemy.
@katejones2172
@katejones2172 Жыл бұрын
I agree it's a complicated picture
@ABCstockholm007
@ABCstockholm007 Жыл бұрын
THIS!!!!
@michaela8194
@michaela8194 Жыл бұрын
Well said. Not to be conspiratorial but, it is undeniable there are invested interests who do not want to acknowledge this because for them it would mean sharing wealth and power, or giving up a great deal of it. The individualized model you're referring to under psychology doesn't challenge the way things are, they take the current distribution of resources for granted and then proceed from there, as if it's inevitable. It's also this way in mainstream economics in my experience. They assume things that are demonstrably false and then build economic theories from those false premises.
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of 5 years major depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@SuperStudying
@SuperStudying Жыл бұрын
May the road be smooth for all reading this! It does get better and the wolrd needs you, and YOU need you! Take care of yourself.
@paulaput7466
@paulaput7466 Жыл бұрын
Exercice, this has help me over the years, now I stoped for a mounth or two and the simptoms of deprresion got worse. I suffred from depresion a long time but it never affect my brain function like the ability to speak , memorize and sempatize with others . A heatly lifestile is not a treatement but sure helps a lot. I know it's hard even to do daily task's with depression but still try to do the least amounth that you can do.
@shashwat2591
@shashwat2591 Жыл бұрын
Thanks for the advice, and I admire your strength to do whatever you can, you are amazing, don't let anyone tell you otherwise
@StFigarlandShanks
@StFigarlandShanks 6 ай бұрын
I hate feeling this way. Been like this for about 2 months now. Can’t get any motivation in life anymore, and all I can think about is how we all are gonna die one day, so what’s even the point in trying? I try not to say that exactly because I don’t wanna bring others down around me, but it’s seriously fucked how much suffering it cuases Never realized just how bad depression was until it finally came knocking on my door 😞 I’m so very sorry to anyone who’s also suffering, I love you 🫶 be strong for me ^it feels like an intrusive thought that never leaves you, and knowing that no one can do much to help about “death anxiety” makes it all worsen. I hope we’re all at peace and live in our own wonderlands after our times up
@StFigarlandShanks
@StFigarlandShanks 5 ай бұрын
All I can say to anyone reading this… is that it truly is your mindset tricking you into thinking such negativity. Ik depression is not the same sadness, but it often feels like it can be cured the same way… it just takes more effort on our part instead of the usual “getting cheered up…” We’re truly responsible for our perceptions of reality. When you feel so down that other people who laugh/ joke start to literally make you MAD… because you don’t know how to be that way, I understand that completely. THAT IS depression at its core. But I promise you all it WILL get easier and you WILL feel happier again. Pushing through on your darkest days alone will really help you overcome your thoughts eventually. Ik how hard and torturing it feels, but it’s gonna straighten out y’all 🙏❤️❤️ be strong for me, now and always
@ahmetberat7357
@ahmetberat7357 Жыл бұрын
I have researched and found out that shrooms are very helpful , it has really helps to reduce anxiety and depression . I would love to try magic mushrooms but I can't easily get some , Is there any realiable source I can purchase one
@kutevince7347
@kutevince7347 Жыл бұрын
I have been having constant and unbearable anxiety and depression because of university. dr.jeromespores is life saver. Thank you
@eliascharles9742
@eliascharles9742 Жыл бұрын
@@kutevince7347 Does he ship?
@raphaelquintin3734
@raphaelquintin3734 Жыл бұрын
@@kutevince7347 how can I contact him?
@kutevince7347
@kutevince7347 Жыл бұрын
@@eliascharles9742 Yes, he ships discreet and anonymous
@kutevince7347
@kutevince7347 Жыл бұрын
@@raphaelquintin3734 dr.jeromespores
@aimalkhan4609
@aimalkhan4609 2 жыл бұрын
It is an illness that I would not even wish on my worst enemy. I am wondering if medical science will ever be able to find the cure of clinical depression.
@timmorakinyo9529
@timmorakinyo9529 2 жыл бұрын
Exercise, healthy fat,mineral and vitamin and omega 3 fatty acid precisly with higher DHA ( small fish has a aboundant DHA, the brain food) and better sleep upregulate hormones.
@aimalkhan4609
@aimalkhan4609 2 жыл бұрын
@@timmorakinyo9529 I tried it but it didn't work.
@hidum5779
@hidum5779 Жыл бұрын
@@aimalkhan4609 consistency is the key. Takes some time depending on the severity
@kelleymcfadden9675
@kelleymcfadden9675 Жыл бұрын
I am so sorry you are going through this. My heart goes out to you. Jesus said in His Word that He can give you a peace like nothing this world can give. I'd like to share my best friend's story with you and I know that if you ask Jesus to show you the truth, He will shed His light on you. God bless you. Precious Memories-By Sonya Lakey Family Story Little did our family of six know that Friday evening, September 24th, 2021, would be the last night our family would be complete. We laughed together, played games, sang, and enjoyed listening as our 16-year-old son, Ethan, played the piano for us. I packed a lunch for Ethan for a church mountain hike he was going on the following day. My mother (who was visiting from out of state) and I woke early with Ethan on Saturday morning. He hugged me and smiled, never pulling away or rushing me. He got in the car, waved, said he'd see me later and he loved me. It was hard to watch my "new driver" heading out on his own that morning. As Ethan pulled out of the gate, I turned to my mother and said, "It's just so hard letting go." Little did I know how much "letting go" I was really doing. That was the last time I saw Ethan. He did not make it home that evening. That afternoon, a friend tried to contact my husband, leaving an urgent message to call him back. He tried several times to return the call to no avail. As we were preparing supper, an overwhelming feeling of deep concern for Ethan filled my heart. I quietly blinked back tears. I glanced out the window, half expecting to see a police officer pull up to the house, but no one arrived. However, within a few minutes, a patrol car DID pull into the driveway. In my heart, I feared the worst. My husband and I went out to meet the officer, who confirmed our fears. Hesitantly, he told us our son had fallen off of a bluff and had succumbed to his injuries. Our hearts were crushed; they still are. Yet, in all of our brokenness, deep, continual grief and loneliness, our family has such a blessed Hope and assurance that we will see our dear son and brother again. You see, when Ethan was a young boy, he was saved; he put his faith in Jesus alone to forgive his sins and to take him to Heaven when he died. He realized some very important truths from the Bible that he would want to share with you. His Story Everyone is a sinner. Sin is any violation of God’s Law. God is holy, just and righteous, and He cannot allow sin in His presence. Ethan realized that he - like all of us - had sinned; and his sin separated Him from God. “For all have sinned, and come short of the glory of God; ” (Romans 3:23) “Wherefore, as by one man sin entered into the world, and death by sin; and so death passed upon all men, for that all have sinned:” (Romans 5:12) He understood that, because of his sin, he deserved to spend eternity in Hell. “For the wages of sin is death;” (Romans 6:23a) [Wages: price] “But the fearful, and unbelieving, and the abominable, and murderers, and whoremongers, and sorcerers, and idolaters, and all liars, shall have their part in the lake which burneth with fire and brimstone: which is the second death.” (Revelation 21:8) Ethan believed that Jesus, God’s Son, paid the price for all sin when He died on the cross - because His sinless sacrifice was the only thing that could satisfy the just demands of a righteous, holy God. Jesus was buried in a borrowed tomb, but He arose the third day, triumphant over sin, death, and Hell. Jesus is alive today! “For God so loved the world, that he gave his only begotten Son, that whosoever believeth in him should not perish, but have everlasting life.” (John 3:16) “For by grace are ye saved through faith; and that not of yourselves: it is the gift of God: Not of works, lest any man should boast.” (Ephesians 2:8-9) Ethan was sorry for his sin, repented (turned), and received by faith the free gift that God offered to him. “For whosoever shall call upon the name of the Lord shall be saved.” (Romans 10:13) “...but the gift of God is eternal life through Jesus Christ our Lord.” (Romans 6:23b) Because of this great salvation, Ethan lived his life serving Jesus. He worked hard to spread this Good News to the world. He is alive in Heaven with Jesus today; and because of this great HOPE in Christ, we know we will see him again soon - not because he was a great kid, but because of his faith in the great Saviour! “And I give unto them eternal life; and they shall never perish, neither shall any man pluck them out of my hand.” (John 10:28) Your Story What about you? What if you had fallen to your death that day - What if you were to die today? Where will you spend eternity - Heaven or the Lake of Fire? There will not be any parties in the Lake of Fire. It is a place of eternal torment for those who reject God's Son. The Word of God is very clear that there is only One Way to Heaven. “Jesus saith unto him, I am the way, the truth, and the life: no man cometh unto the Father, but by me.” (John 14:6) We did not know that Ethan would step into eternity that day; however, because he put his faith in Jesus alone for his salvation, Ethan was ready to go. Some day - perhaps today - you will take your last breath here on earth, and you will step into eternity. Where you spend eternity is determined by what you do with Jesus Christ. Will you accept Him or reject Him? You are not promised another day or another breath. Eternity begins soon - Are you ready? “...Believe on the Lord Jesus Christ, and thou shalt be saved…” (Acts 16:31b) “For whosoever shall call upon the name of the Lord shall be saved.” (Romans 10:13) “(...behold, now is the day of salvation.)” (2 Corinthians 6:2c) ********************************************************* If you need more help or if you would like to send a word of encouragement to the family, please go to: facebook.com/GITM-Foundation-113997824650357/ If you don't have a church to attend, we would love for you to join us in person @ Liberty Faith Bible Church in Norwood, Mo. every Sunday morning central time 11:00 A.M., Sunday evening 7:00 P.M., and Wednesday evening 7:00. P.M. where you will hear sound, biblical preaching from God's Word as well as uplifting, godly music. Or you can join our livestream family at: libertyfaith.net Facebook: Reg Kelly-Table In The Wilderness Sermon audio: Liberty Faith Church Pastor Reg Kelly KZbin: Liberty Faith Church Reg Kelly sermons (not livestream, but recorded)
@aimalkhan4609
@aimalkhan4609 Жыл бұрын
@@kelleymcfadden9675 Thank you so much for your sympathy!
@whachamacallitis
@whachamacallitis 3 жыл бұрын
Great video! 🙏 ❤️Please make more and expand on explanations🙏
@malavikapb879
@malavikapb879 Жыл бұрын
Hardest part of deppressed life is to remember is how happy we once were..and to see people in our age is enjoying life ...and ..to..feel is why ..I'm..sad ..without reason..and hear is..y r u too emotional all the time
@stevenrogers8939
@stevenrogers8939 Жыл бұрын
I promised myself not to continue suffering from depression anymore. I can’t do it. I refuse to live this way. I refuse to hide it from loved ones. They think I am the happiest person on earth but I am the opposite. I am extremely exhausted. I feel beaten and broken and the sad part is I don’t know why
@shashwat2591
@shashwat2591 Жыл бұрын
Mental illnesses are like that, you've fought and you always will, share with your loved ones, they deserve the truth, wish you the best
@Spiritualpath02
@Spiritualpath02 Жыл бұрын
I had clinical depression when I was 16-18. I could barely get out of bed and I walked through school like a zombie. I could not think at all, I had brain fog, and my head and body always hurt like hell. I'm 20 right now, and I'm doing better but still feel like shit sometimes.
@Daniel-Trust
@Daniel-Trust Жыл бұрын
👆👆check them out they got the best deals at a very reasonable price 🍄😀 they help with depression and anxiety
@discipleofjesus719
@discipleofjesus719 Жыл бұрын
Hi, i wanna say I truly hope you’re doing okay. If you don’t feel like it at times, just know that you are worth it and loved. God bless you, and He loves you. He is there for you. Take care friend and always reach out if you need help 🫂🤍 “God loved the world so much that he gave his one and only Son so that whoever believes in him may not be lost, but have eternal life.” ‭‭John‬ ‭3‬:‭16‬ ‭
@arze868
@arze868 Жыл бұрын
​@@discipleofjesus719 Why did God make this life so long then if he loves us so much?!!...hopefully i see him after i kill myself
@jhilamkaranjai9226
@jhilamkaranjai9226 Жыл бұрын
Winning Secret which none will TEACH! kzbin.info/www/bejne/jnTQnZuEoNaKeLs
@jamesbedukodjograham5508
@jamesbedukodjograham5508 2 жыл бұрын
I was very depressed back in the late 1990s but I recovered by the late 2000s. Depression is the cause of failure in so many students. A depressed Brain is overwritten by events that happen to people in their lifetime somewhat.
@Trica_lover
@Trica_lover Жыл бұрын
I used psychedelic to treat myself of years of server depression and anxiety *Lordytrip* has good psilocybin mushroom strains you contact them if you are looking to get magic mushroom or some other good psychedelic They can also help out with a proper guide on that
@govindmishra7938
@govindmishra7938 Жыл бұрын
How did you recover from that
@asleepawake3645
@asleepawake3645 Жыл бұрын
I think this is wrong to isolate depression as just a clinical brain illness. Depression seems to be a natural reaction of the entire body and brain when the mind anticipates an undesirable future or survivability ( example: prospect of job loss, failing class, losing loved ones, feeling inadequate among peers, etc ).
@khongroodmaa2139
@khongroodmaa2139 Жыл бұрын
Clinical depression doesn’t have a reason but everything u just named HAVE reasons thats what makes clinical depression different from what u just said
@asleepawake3645
@asleepawake3645 Жыл бұрын
@@khongroodmaa2139 , I thought clinical depression is just the severe form of depression. There is nothing that doesn't have a reason. Diagnosing the reason is the hard part.
@relaxationviewchannel
@relaxationviewchannel Жыл бұрын
On difficult days, don't look so much at the path, look at each step you've taken this far. Realize when you've already managed to walk!
@marteenee88
@marteenee88 Жыл бұрын
There should be a new name for depression. This scientific explanation shows there is more to the illness than just "feeling sad". With all the mention of neurons, brain chemistry, brain wiring/circuits gives it an aspect to look at of the disease.
@ruthwrites1251
@ruthwrites1251 7 ай бұрын
It should be called a brain disease
@ceooflonelinessinc.267
@ceooflonelinessinc.267 Жыл бұрын
But my question is what is if Depression is caused not from any form of chemical imbalance or whatsoever? What is if it is caused due to chronical circumstances like unemployment, having no friends, having failed for to many times?
@andralfoo
@andralfoo Жыл бұрын
why not both? a chemical imbalance may cause those things, and those things may cause a chemical imbalance
@shashwat2591
@shashwat2591 Жыл бұрын
Ahh, life and the problems, but life ain't perfect, so it will be uneven, gotta learn to accept the lows to appreciate highs
@khairx9093
@khairx9093 2 жыл бұрын
when u feel like washing clothes and taking transportation and even go for shopping is a painstaking job to even think about.
@RealMaryam-l7e
@RealMaryam-l7e 2 жыл бұрын
Thanks to the name above ⬆️ ⬆️ He sells shrooms…..🍫💊🔌💯
@alvvarel
@alvvarel Жыл бұрын
Thank you for sharing this. I don't exactly know when my depression really kicked in but I do know it was caused by when my parents argued all night and them finally splitting (albeit for just a few months). It was honestly insanity and very fucking unfair, but I won't share more details. 2020 and 2021 was hell for me and I'm sure most people share the same sentiment. I guess the way I can put as to how it manifested was the more I think about my problems, the more I'm hurting myself. I guess that's why my brain actively hamstrung itself in order to conserve sanity. It affected my memory (long and short term), social skills, logical thinking, and sometimes feelings altogether. Most people doesn't understand what's really going on with me. They'd just think I'm being edgy or something haha, and it's unfortunate really. Oh well.. Whatever your story is, know that you're not alone. We all got this in some way or another. Just don't ignore the past please. Take care all.
@shashwat2591
@shashwat2591 Жыл бұрын
You too, take care, you have it whatever it takes, wish you the best
@raghavankodoth4283
@raghavankodoth4283 Жыл бұрын
At the age of 55, I suffered from severe anxiety, on the verge of depression. I couldn't sleep a wink for days at a stretch. I got out of it by practicing meditation & increasing awareness to ward of stress. Understanding stress and getting control over emotions is the key to ocercome stress caused depression. I am 71 now and all these 16 yrs, I never had to visit a Doctor or take any sort of drugs for BP, cholesterol, sugar etc.
@nekotamo1851
@nekotamo1851 Жыл бұрын
How are you alive? I thought we with anxieties and depression are dying sooner like I don't wanna live past my 20s. I thought I'll have a heart attack in my 20s and it will end it all lol
@shashwat2591
@shashwat2591 Жыл бұрын
​@@nekotamo1851Hope it gets better, you have come this far and I hope you will keep being there fighting, never ever give up
@aiikae7101
@aiikae7101 Жыл бұрын
Thank you to everyone who has shared honestly.
@DanielGomez-le5wo
@DanielGomez-le5wo 2 жыл бұрын
They should do sit-ups where the upper part of the abdomen is worked, with the legs raised and trying to touch the feet with the hands and its variants that work the upper part of the abdomen, they will see improvements quickly. That upper abdominal exercise will take away your depression and anxiety, it will also heal your mind..
@babitasaha6655
@babitasaha6655 2 жыл бұрын
Are you a doctor?
@Crysta1986
@Crysta1986 Жыл бұрын
Solar Plexus chakra
@daveyork0
@daveyork0 2 жыл бұрын
'Plotting my own demise' was the phrase I can relate to here. Gee I hope I can go out there and not be irritable to the world, unforgiving, hypervigilant, fear-aggressive, combative-contentious.
@lizriveratoro8729
@lizriveratoro8729 2 жыл бұрын
That's how my depression works... everything bothers me.. noises, driving, I don't want to get to work. Everyday I woke up. And want to go to bed again and don't care, not even family. I love them. But I don't enjoy life anymore. It's annoying really fell. Like fuck the world and everyone.
@Swanky723
@Swanky723 Жыл бұрын
It took 9 years to get out of depression without professional help. Some people need the professional help but I couldn't afford. What I had was. 1. Honesty in emotions 2. Few real friends who genuinely listen 3. Music to uplift. Listened alot of gospel and Mariah Carey 4. Change in environment
@DocSnipes
@DocSnipes 7 ай бұрын
I agree with what it’s said in the video. Also, it’s important to heal the brain after depression (that prevents cognitive decline, among other things). Healing the brain after depression is a multifaceted process that involves physical, emotional, and cognitive changes. It's important to be patient and consistent with these strategies to support your brain's natural healing process.
@Ojkmt882
@Ojkmt882 2 жыл бұрын
Everytime I come across terms like "depression" "suicide" etc; Jonghyun’s death hits me the hardest.
@Jerryberger9235
@Jerryberger9235 2 жыл бұрын
Psychedelic’s definitely have potential to deal with mental health symptoms like anxiety and depression, I would like to try them again but it’s just so hard to source here
@georgewilliams1062
@georgewilliams1062 2 жыл бұрын
Psychedelics are the reason why i didn’t take my life when i was at my end. I was stripped of my ego and saw the beauty of life and interconnectivity and even though i still battle anxiety and depression, I’m doing better everyday and will never think in such a self destructive way again.
@zoeywinston6826
@zoeywinston6826 2 жыл бұрын
LSD and mushrooms completely changed my whole outlook on life. I became a better version of myself This experience gave me a lot of confidence about my self and my body. A bunch of bad thought / behavior patterns were broken. One of these was pretty bad OCD that made me wash my hands a lot. It gave me a lot of hope that things will be fine, this is the one thing that I heard throughout the trip: Everything is alright. The main reason for the trip was my severe depression and it definitely helped me (although it's not gone). Before all I could do was lay in bed. Now I am trying to rebuild my life one step at a time which wasn't possible before."
@sarahh321
@sarahh321 2 жыл бұрын
[_James_tray] Got psychs
@Jerryberger9235
@Jerryberger9235 2 жыл бұрын
@@sarahh321 Where to search?? Is it IG?
@sarahh321
@sarahh321 2 жыл бұрын
@@Jerryberger9235 Yes
@elenafoleyfoley168
@elenafoleyfoley168 Жыл бұрын
Excellent points, I understand alot more now dealing with depression. Very well explained 👏 I loved the Neurological system in college, fascinating how the brain 🧠 works, like a relay race, one neuron passing the batton to the next neuron. Love, light and lots of prayers 🙏🏻 to everyone suffering with depression 🕊🤍🕊 Great video thankyou 🙏🏻
@khushboosharma7633
@khushboosharma7633 Ай бұрын
I know how it feels because I also recovered from depression few months back. Want to help people out there who are facing the same problem. I'll listen your inner voice.
@chichyjacy8120
@chichyjacy8120 Жыл бұрын
I just overcame depression... They call in insight... Getting to realise that u were sick.. Things have changed alot.. I used to have low self esteem gloomy.... If you haven't ever been into depression I don't know if ull get what am saying.. I just met someone he told me I used to be absent minded... It's sad but am happy I got through it..
@Brittany12173
@Brittany12173 Жыл бұрын
🍁💊🍄🚢
@Brittany12173
@Brittany12173 Жыл бұрын
Smithspores on
@Brittany12173
@Brittany12173 Жыл бұрын
Insta
@Brittany12173
@Brittany12173 Жыл бұрын
Gram
@Unique_94
@Unique_94 Жыл бұрын
Am grateful for modern technology. Am happy to be a part of this forum
@Daniel-Trust
@Daniel-Trust Жыл бұрын
👆👆check them out they got the best deals at a very reasonable price 🍄😀 they help with depression and anxiety
@shashwat2591
@shashwat2591 Жыл бұрын
I like your gratefulness
@aartipanchal2569
@aartipanchal2569 3 жыл бұрын
Amazing information *Thankyou*
The Joker wanted to stand at the front, but unexpectedly was beaten up by Officer Rabbit
00:12
Bike Vs Tricycle Fast Challenge
00:43
Russo
Рет қаралды 84 МЛН
Depression Explained (Major Depressive Disorder)
8:02
Rhesus Medicine
Рет қаралды 243 М.
10 Things Depression Makes Us Do
4:35
Psych2Go
Рет қаралды 7 МЛН
What happens to your brain as you age
8:46
The Economist
Рет қаралды 695 М.
The Myth of Low-Serotonin & Antidepressants - Dr. Mark Horowitz
30:17
Who are you?
13:32
Our Animated Box
Рет қаралды 20 МЛН
How do antidepressants work? - Neil R. Jeyasingam
4:51
TED-Ed
Рет қаралды 3,8 МЛН
9 tactics to build a stronger mind | Lisa Genova
9:56
Big Think
Рет қаралды 1,1 МЛН
How an Addicted Brain Works
3:53
Yale Medicine
Рет қаралды 307 М.